CN114671921A - Large-scale oligonucleotide ammonolysis method - Google Patents
Large-scale oligonucleotide ammonolysis method Download PDFInfo
- Publication number
- CN114671921A CN114671921A CN202210488847.3A CN202210488847A CN114671921A CN 114671921 A CN114671921 A CN 114671921A CN 202210488847 A CN202210488847 A CN 202210488847A CN 114671921 A CN114671921 A CN 114671921A
- Authority
- CN
- China
- Prior art keywords
- oligonucleotide
- cutting
- cutting fluid
- nucleotide
- production
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091034117 Oligonucleotide Proteins 0.000 title claims abstract description 34
- 238000000034 method Methods 0.000 title claims abstract description 30
- 238000005915 ammonolysis reaction Methods 0.000 title claims abstract description 19
- 239000002773 nucleotide Substances 0.000 claims abstract description 31
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 31
- 239000002173 cutting fluid Substances 0.000 claims abstract description 25
- WGYKZJWCGVVSQN-UHFFFAOYSA-N propylamine Chemical compound CCCN WGYKZJWCGVVSQN-UHFFFAOYSA-N 0.000 claims abstract description 22
- 238000005520 cutting process Methods 0.000 claims abstract description 18
- VHUUQVKOLVNVRT-UHFFFAOYSA-N Ammonium hydroxide Chemical compound [NH4+].[OH-] VHUUQVKOLVNVRT-UHFFFAOYSA-N 0.000 claims abstract description 13
- 235000011114 ammonium hydroxide Nutrition 0.000 claims abstract description 13
- 229910021642 ultra pure water Inorganic materials 0.000 claims abstract description 11
- 239000012498 ultrapure water Substances 0.000 claims abstract description 11
- 230000008569 process Effects 0.000 claims abstract description 10
- 230000002194 synthesizing effect Effects 0.000 claims abstract description 8
- JLCPHMBAVCMARE-UHFFFAOYSA-N [3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-hydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methyl [5-(6-aminopurin-9-yl)-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate Polymers Cc1cn(C2CC(OP(O)(=O)OCC3OC(CC3OP(O)(=O)OCC3OC(CC3O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c3nc(N)[nH]c4=O)C(COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3CO)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cc(C)c(=O)[nH]c3=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)O2)c(=O)[nH]c1=O JLCPHMBAVCMARE-UHFFFAOYSA-N 0.000 claims abstract description 7
- 238000007098 aminolysis reaction Methods 0.000 claims abstract description 7
- 239000007788 liquid Substances 0.000 claims abstract description 7
- 238000002156 mixing Methods 0.000 claims abstract description 6
- 238000002360 preparation method Methods 0.000 claims abstract description 5
- 238000006243 chemical reaction Methods 0.000 claims abstract description 4
- 239000000203 mixture Substances 0.000 claims abstract description 4
- 230000008014 freezing Effects 0.000 claims abstract description 3
- 238000007710 freezing Methods 0.000 claims abstract description 3
- WEVYAHXRMPXWCK-UHFFFAOYSA-N Acetonitrile Chemical compound CC#N WEVYAHXRMPXWCK-UHFFFAOYSA-N 0.000 claims description 24
- 230000015572 biosynthetic process Effects 0.000 claims description 19
- 238000003786 synthesis reaction Methods 0.000 claims description 19
- 238000003776 cleavage reaction Methods 0.000 claims description 14
- 239000000178 monomer Substances 0.000 claims description 11
- 150000008300 phosphoramidites Chemical class 0.000 claims description 11
- 230000007017 scission Effects 0.000 claims description 11
- XKRFYHLGVUSROY-UHFFFAOYSA-N Argon Chemical compound [Ar] XKRFYHLGVUSROY-UHFFFAOYSA-N 0.000 claims description 10
- 238000001035 drying Methods 0.000 claims description 7
- 229910052786 argon Inorganic materials 0.000 claims description 5
- 238000007664 blowing Methods 0.000 claims description 4
- 239000007789 gas Substances 0.000 claims description 2
- 238000011068 loading method Methods 0.000 claims description 2
- QGZKDVFQNNGYKY-UHFFFAOYSA-N Ammonia Chemical compound N QGZKDVFQNNGYKY-UHFFFAOYSA-N 0.000 claims 3
- 229910021529 ammonia Inorganic materials 0.000 claims 1
- 238000004519 manufacturing process Methods 0.000 abstract description 21
- 239000000047 product Substances 0.000 abstract description 6
- 239000002699 waste material Substances 0.000 abstract description 5
- 238000011084 recovery Methods 0.000 abstract description 4
- 239000012043 crude product Substances 0.000 abstract description 3
- 230000009467 reduction Effects 0.000 abstract description 3
- 108020004707 nucleic acids Proteins 0.000 description 6
- 150000007523 nucleic acids Chemical class 0.000 description 6
- 102000039446 nucleic acids Human genes 0.000 description 6
- 238000005259 measurement Methods 0.000 description 4
- 238000001291 vacuum drying Methods 0.000 description 4
- OKKJLVBELUTLKV-UHFFFAOYSA-N Methanol Chemical compound OC OKKJLVBELUTLKV-UHFFFAOYSA-N 0.000 description 3
- 239000013256 coordination polymer Substances 0.000 description 3
- 238000001228 spectrum Methods 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000011031 large-scale manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 230000004907 flux Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 238000001668 nucleic acid synthesis Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 239000007858 starting material Substances 0.000 description 1
- 238000003756 stirring Methods 0.000 description 1
- 239000011550 stock solution Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H1/00—Processes for the preparation of sugar derivatives
Abstract
The invention relates to the technical field of oligonucleotides, and discloses a large-scale oligonucleotide aminolysis method, which comprises the following steps: s1, editing position information of the oligonucleotides and synthesizing the sequence. S2, placing the synthetic carrier on a synthetic instrument to prepare the nucleotide with the corresponding sequence. S3, preparing cutting fluid, wherein the preparation method of the cutting fluid comprises the following steps: freezing the mixture of ammonia water and/or n-propylamine and ultrapure water, and storing under the condition of low temperature. S4, mixing the nucleotide and the cutting liquid to carry out the cutting reaction to obtain the oligonucleotide. The volume of the cutting fluid and the cutting time are greatly reduced in the ammonolysis process; the production steps are simple, the production steps are reduced, the overall yield is improved, and the quality of crude oligonucleotide products is ensured; the recovery rate of the crude product is high; the reduction of the cutting fluid also greatly reduces the production of production waste liquid, reduces the production cost and reduces the problem of production environment pollution.
Description
Technical Field
The invention relates to the technical field of oligonucleotides, in particular to a large-scale aminolysis method of oligonucleotides.
Background
At present, the cutting process after the synthesis of the oligonucleotide is determined according to the synthesis scale, a flux instrument is used for synthesizing single-tube ammonolysis or ammonolysis pot ammonolysis with the synthesis scale less than 1umol, and the used cutting fluid and the cutting time are also determined according to the process. With the increasing demand of the drug-scale nucleic acid market and the gram-scale nucleic acid, large-scale synthesis of nucleic acids has become the mainstream of the research direction of pharmaceutical grade.
However, due to the incompleteness of the nucleic acid synthesis and cleavage processes in the current market, the cleavage solution ratio after cleavage is large, the cleavage time is long, waste and high production cost are caused, and the cleavage time and the cleavage method have certain influence on the product quality.
Disclosure of Invention
In order to solve the above technical problems, the present invention provides a large-scale oligonucleotide ammonolysis method, comprising:
s1, editing position information of the oligonucleotides and synthesizing sequences;
s2, placing the synthetic vector on a synthetic instrument to prepare nucleotide with a corresponding sequence;
s3, preparing cutting fluid, wherein the preparation method of the cutting fluid comprises the following steps: freezing the mixture of ammonia water and/or n-propylamine and ultrapure water, and preserving under the condition of low temperature;
s4, mixing the nucleotide and the cutting liquid to carry out the cutting reaction to obtain the oligonucleotide.
Preferably: the method for loading the nucleotide sequence on the carrier comprises the following steps: A. c, G, T dissolving phosphoramidite monomer in acetonitrile, placing in corresponding synthesis channels of a synthesizer, respectively, taking down the carrier column after synthesis, drying the carrier column, and separating to obtain nucleotide from the carrier column.
Preferably: the carrier column drying method is to blow the carrier column with argon gas, or to place the carrier column in a vacuum drying oven at 20-50 ℃ for 1-3 h.
Preferably: the A, C, G, T phosphoramidite monomer was dissolved in acetonitrile at a concentration of 0.1M.
Preferably: the cutting fluid is a mixed solution of n-propylamine, ultrapure water and frozen ammonia water.
Preferably: the volume ratio of the n-propylamine to the ultrapure water to the frozen ammonia water is 1-5:1-5: 3-15.
Preferably: the volume ratio of the n-propylamine to the ultrapure water to the frozen ammonia water is 1:1: 3.
Preferably: the volume ratio of the cutting fluid to the nucleotide is 100-200: 1.
Preferably: the volume ratio of the cutting fluid to the nucleotide is 300: 1.
Preferably: the cleavage reaction temperature was 65 ℃ for 3 h.
The invention has the technical effects and advantages that: the volume of the cutting fluid and the cutting time are greatly reduced in the ammonolysis process; the cutting fluid is simple to prepare, suitable for large-scale production and low in production cost; the production steps are simple, the production steps are reduced, the overall yield is improved, and the quality of crude oligonucleotide products is ensured; the recovery rate of the crude product is high; the reduction of the cutting fluid also greatly reduces the production of production waste liquid, reduces the production cost and reduces the problem of production environment pollution.
Drawings
FIG. 1 is a flow chart of a large-scale oligonucleotide ammonolysis process according to the present invention.
FIG. 2 shows the MS spectra of the oligonucleotide of the present invention.
FIG. 3 is a MS spectrum of an oligonucleotide of the present invention.
FIG. 4 is an analytical map of example 1 of the present invention.
FIG. 5 is an analytical map of example 2 of the present invention.
FIG. 6 is an analytical map of example 3 of the present invention.
FIG. 7 is an analytical map of example 4 of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings and specific embodiments. The embodiments of the present invention have been presented for purposes of illustration and description, and are not intended to be exhaustive or limited to the invention in the form disclosed. Many modifications and variations will be apparent to practitioners skilled in this art. The embodiment was chosen and described in order to best explain the principles of the invention and the practical application, and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated.
Referring to FIG. 1, in this example, a large-scale oligonucleotide aminolysis method for preparing nucleotides on a large scale and performing cleavage aminolysis is provided, the large-scale oligonucleotide aminolysis method comprising:
s1, editing position information of the oligonucleotides and synthesizing the sequence. The nucleotide starting material can be obtained commercially.
S2, placing the synthetic carrier on a synthetic instrument to prepare the nucleotide with the corresponding sequence. The synthesis can be carried out by an automatic synthesizer, and A, C, G, T phosphoramidite monomers are dissolved in acetonitrile and respectively placed in separate corresponding synthesis channels of the synthesizer. The support column was removed from the synthesizer and dried.
And S3, preparing cutting fluid. The preparation method of the cutting fluid comprises the following steps: mixing n-propylamine, ultrapure water and frozen ammonia water, and stirring to completely dissolve. Shaking and storing under low temperature.
S4, mixing the nucleotide and the cutting liquid for cutting reaction to obtain the oligonucleotide.
According to the large-scale oligonucleotide ammonolysis method, the volume of the cutting fluid and the cutting time are greatly reduced in the ammonolysis process; the cutting preparation is simple, the method is suitable for large-scale production, and the production cost is low; the production steps are simple, the production steps are reduced, the overall yield is improved, and the quality of crude oligonucleotide products is ensured; the recovery rate of the crude product is high; the reduction of the cutting fluid also greatly reduces the production of production waste liquid, reduces the production cost and reduces the problem of production environment pollution.
A large-scale oligonucleotide ammonolysis method of the present application will be described in detail below with reference to examples, comparative examples and experimental data.
Example 1
S1, firstly, synthesizing nucleotide, wherein the position information of the nucleotide sequence (GTGGAATTCTCGGGTGCCAAGGC, phosphoramidite monomer purchased from megadimension) is edited.
S2, the nucleotide sequence was placed on AKTA Oligopilot plus 100 type nucleic acid automated synthesizer. A. C, G, T phosphoramidite monomer is dissolved in acetonitrile with concentration of 0.1M, and is respectively placed in the corresponding synthesis channels of the synthesizer with the synthesis scale of 100 μmol and the carrier manufacturer Cytiva. And after the nucleotide synthesis is finished, taking out the carrier column from the synthesizer in a DMT OFF mode, drying the carrier by blowing with argon, and drying for 1h in a vacuum drying oven at the temperature of 30 ℃.
S3, mixing 20mL of n-propylamine, 20mL of ultrapure water and 160mL of fresh frozen ammonia water in sequence to prepare a cutting fluid, shaking up, and storing at the temperature of 2-8 ℃.
S4, placing the nucleotide prepared in the S2 into an explosion-proof pressure-resistant bottle, adding 30mL of cutting fluid in S3, and carrying out aminolysis for 3h at 65 ℃ to obtain the oligonucleotide.
Example 2
S1, firstly, synthesizing nucleotide, wherein the position information of the nucleotide sequence (GTGGAATTCTCGGGTGCCAAGGC, phosphoramidite monomer purchased from megadimension) is edited.
S2, the nucleotide sequence was placed on AKTA Oligopilot plus 100 type nucleic acid automated synthesizer. A. C, G, T phosphoramidite monomer is dissolved in acetonitrile with concentration of 0.1M, and is respectively placed in the corresponding synthesis channels of the synthesizer with the synthesis scale of 100 μmol and the carrier manufacturer Cytiva. And after the nucleotide synthesis is finished, taking the carrier column out of the synthesizer in a DMT OFF mode, blowing the carrier by using argon, and drying the carrier in a vacuum drying oven at 50 ℃ for 3 hours.
S3, placing the nucleotide prepared in S2 into an explosion-proof pressure-resistant bottle, adding 100mL of fresh frozen ammonia water, and carrying out ammonolysis for 4h at 70 ℃ to obtain the oligonucleotide.
Example 3
S1, firstly, synthesizing nucleotide, wherein the position information of the nucleotide sequence (GTGGAATTCTCGGGTGCCAAGGC, phosphoramidite monomer purchased from megadimension) is edited.
S2, the nucleotide sequence was placed on AKTA Oligopilot plus 100 type nucleic acid automated synthesizer. A. C, G, T phosphoramidite monomer is dissolved in acetonitrile with concentration of 0.1M, and is respectively placed in the corresponding synthesis channels of the synthesizer with the synthesis scale of 100 μmol and the carrier manufacturer Cytiva. And after the nucleotide synthesis is finished, taking the carrier column out of the synthesizer in a DMT OFF mode, blowing the carrier by using argon, and drying the carrier in a vacuum drying oven at 40 ℃ for 2 hours.
S3, 60mL of glacial methanol and 20mL of glacial ammonia water to prepare a cutting fluid, shaking uniformly, and storing at the temperature of 2-8 ℃.
S4, placing the nucleotide prepared in S2 into an explosion-proof pressure-resistant bottle, adding 100mL of cutting fluid, and cutting for 12h at normal temperature to obtain the oligonucleotide.
The above four ammonolysis modes and the ammonolysis recovery rates will be shown by the following graphs. In order to ensure the accuracy of the measurement, the volume of the sample measurement of each batch was fixed at 5uL, and the volume of the sample measurement of each batch was 120 mL.
Note: the overall yield calculation formula is as follows:
OD measured stock volume/(measured volume 3)
The yield of the cleavage is
The MS spectrum result shows that L is 4.75.
| Serial number | Measuring volume (ul) | Measured value | Volume of | Total OD value | The total yield is% | Operator | Auditor | |
| 1 | 5 | 1.778 | 120000 | 14224.00 | 65.00 | ZJK | CP | |
| 2 | 5 | 1.2308 | 120000 | 9846.40 | 45.00 | | CP | |
| 3 | 5 | 1.34 | 120000 | 10720.00 | 49.00 | ZJK | CP | |
| 4 | 5 | 1.356 | 120000 | 10848.00 | 49.60 | ZJK | CP |
The measurement volumes will be smaller due to the high concentration of the stock solution.
According to the above table and the analysis of the map, the analysis in the examples 1, 2, 3 and 4 shows that the volume of the cutting fluid in the example 1 is the minimum, the volume of the generated waste fluid is the minimum, and the pollution degree to the environment is the minimum; the cutting temperature is lowest, the cutting time is least, and the product quality is not influenced; the ammonia water used for cutting each batch of samples is relatively small in volume, so that the material cost is saved; the patterns under the conditions of example 2 and example 3 show that the effect of cleavage under these conditions on the product is not very different, the pattern under the conditions of example 4 is not particularly perfect compared to other experiments, and the cleavage reaction under these conditions may be more severe.
It is to be understood that the described embodiments are merely a few embodiments of the invention, and not all embodiments. All other embodiments, which can be derived by one of ordinary skill in the art and related arts based on the embodiments of the present invention without any creative effort, shall fall within the protection scope of the present invention. Structures, devices, and methods of operation not specifically described or illustrated herein are not specifically illustrated or described, but are instead contemplated to be practiced in the art by those skilled in the art.
Claims (10)
1. A large scale oligonucleotide ammonolysis process, said large scale oligonucleotide ammonolysis process comprising:
s1, editing position information of the oligonucleotides and synthesizing sequences;
s2, placing the synthetic vector on a synthetic instrument to prepare nucleotide with a corresponding sequence;
s3, preparing cutting fluid, wherein the preparation method of the cutting fluid comprises the following steps: freezing the mixture of ammonia water and/or n-propylamine and ultrapure water, and preserving under the condition of low temperature;
s4, mixing the nucleotide and the cutting liquid to carry out the cutting reaction to obtain the oligonucleotide.
2. The method of claim 1, wherein the loading of the nucleotide sequence on a carrier comprises: a, C, G, T phosphoramidite monomer is dissolved in acetonitrile, and is respectively placed in the corresponding independent synthesis channels of the synthesizer, and after the synthesis is finished, the carrier column is taken out and dried.
3. The method of claim 2, wherein the drying of the support column is performed by blowing argon gas to dry the support column, or placing the support column in a vacuum oven at 20-50 ℃ for 1-3 h.
4. The process of claim 2, wherein the A, C, G, T phosphoramidite monomer is dissolved in acetonitrile at a concentration of 0.1M.
5. The method of claim 1, wherein the cutting fluid is a mixture of n-propylamine, ultrapure water and chilled ammonia.
6. The large-scale ammonolysis process of claim 5, wherein the volume ratio of n-propylamine to ultrapure water to chilled aqueous ammonia is 1-5:1-5: 3-15.
7. The large-scale oligonucleotide ammonolysis method according to claim 5, wherein the volume ratio of n-propylamine to ultrapure water to frozen ammonia water is 1:1: 3.
8. The method of claim 1, wherein the ratio of the volume of the cleavage solution to the volume of the oligonucleotide is 100-200: 1.
9. The method of claim 8, wherein the volume ratio of the cleavage solution to the nucleotides is 300: 1.
10. The large-scale oligonucleotide aminolysis method according to claim 1, wherein the cleavage reaction temperature is 65 ℃ for 3 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210488847.3A CN114671921A (en) | 2022-05-06 | 2022-05-06 | Large-scale oligonucleotide ammonolysis method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210488847.3A CN114671921A (en) | 2022-05-06 | 2022-05-06 | Large-scale oligonucleotide ammonolysis method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114671921A true CN114671921A (en) | 2022-06-28 |
Family
ID=82080708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210488847.3A Pending CN114671921A (en) | 2022-05-06 | 2022-05-06 | Large-scale oligonucleotide ammonolysis method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114671921A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1985001051A1 (en) * | 1983-09-02 | 1985-03-14 | Molecular Biosystems, Inc. | Oligonucleotide polymeric support system |
| US4965349A (en) * | 1987-12-24 | 1990-10-23 | Applied Biosystems, Inc. | Method of synthesizing oligonucleotides labeled with ammonia-labile groups on solid phase supports |
| US5348868A (en) * | 1992-04-24 | 1994-09-20 | Beckman Instruments, Inc. | Methods and reagents for cleaving and deprotecting oligonucleotides |
| CN106256831A (en) * | 2015-06-18 | 2016-12-28 | 日东电工株式会社 | The method cutting away RNA oligonucleotide |
| CN111704644A (en) * | 2020-08-18 | 2020-09-25 | 苏州金唯智生物科技有限公司 | Ammonolysis solution and ammonolysis method |
| CN113004359A (en) * | 2021-02-25 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Method for purifying primer by oligonucleotide rapid deprotection group |
-
2022
- 2022-05-06 CN CN202210488847.3A patent/CN114671921A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1985001051A1 (en) * | 1983-09-02 | 1985-03-14 | Molecular Biosystems, Inc. | Oligonucleotide polymeric support system |
| US4965349A (en) * | 1987-12-24 | 1990-10-23 | Applied Biosystems, Inc. | Method of synthesizing oligonucleotides labeled with ammonia-labile groups on solid phase supports |
| US5348868A (en) * | 1992-04-24 | 1994-09-20 | Beckman Instruments, Inc. | Methods and reagents for cleaving and deprotecting oligonucleotides |
| CN106256831A (en) * | 2015-06-18 | 2016-12-28 | 日东电工株式会社 | The method cutting away RNA oligonucleotide |
| CN111704644A (en) * | 2020-08-18 | 2020-09-25 | 苏州金唯智生物科技有限公司 | Ammonolysis solution and ammonolysis method |
| CN113004359A (en) * | 2021-02-25 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Method for purifying primer by oligonucleotide rapid deprotection group |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106566876B (en) | Oligonucleotide probe and obtaining method thereof | |
| CN111196876B (en) | Synthetic method and application of Co-based MOF material with nucleic acid screening function and adjustable pore diameter | |
| CN102952877A (en) | Method and system for detecting alpha-globin gene copy number | |
| WO2019062289A1 (en) | Probe and method applying the same for enriching target region in high-throughput sequencing | |
| CN106939342A (en) | A kind of and the cream-coloured chain SNP marker of millet, primer and application | |
| ES2535702T3 (en) | Process for the preparation of an alkyl methanesulfonate solution | |
| CN107603971B (en) | Preparation method of in-situ hybridization probe | |
| CN114671921A (en) | Large-scale oligonucleotide ammonolysis method | |
| CN107904283A (en) | A kind of instant multiprobe hybridized slides and its preparation method and application | |
| CN109234433B (en) | A kind of SNP marker and its application of wax gourd seed type gene | |
| US11685915B2 (en) | Method of collecting nucleic acid | |
| CN107513560B (en) | A kind of quick detection probe of IGH gene breaks of low cost and its preparation method and application | |
| CN100400507C (en) | Modafinil synthesis process. | |
| CN106397080A (en) | Preparation method of alpha, beta-unsaturated ketone | |
| CN112898363A (en) | Phosphoramidite monomer composition and preparation method and application thereof | |
| CN106167825B (en) | A kind of relevant microsatellite marker of yellow catfish growing characteristic and its detection and application | |
| CN108440596A (en) | A kind of half fumaric acid tenofovir Chinese mugwort draws the novel preparation process of phenol amine | |
| CN106834493B (en) | A kind of AML1-ETO fusions quick detection probe of low cost and its preparation method and application | |
| CN108588196B (en) | Method for preventing aerosol pollution formed by PCR | |
| AU597024B2 (en) | Process for the preparation of hydroxylamines and products thereby obtained | |
| CN114107453A (en) | Kit for detecting instability of microsatellite | |
| CN114609234A (en) | Method for detecting content of metal elements in polyether amine solid catalyst | |
| CN113621014A (en) | Ammonolysis pretreatment solution and ammonolysis method for solid-phase synthesis of DNA | |
| Ravikumar et al. | Development of siRNA for therapeutics: efficient synthesis of phosphorothioate RNA utilizing phenylacetyl disulfide (PADS) | |
| CN112779324A (en) | Method for single cell detection and analysis and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |