CN108588196B

CN108588196B - Method for preventing aerosol pollution formed by PCR

Info

Publication number: CN108588196B
Application number: CN201810366355.0A
Authority: CN
Inventors: 杨松江
Original assignee: Beijing Zhongneng Tongda Technology Development Center LP
Current assignee: Beijing Zhongneng Tongda Technology Development Center LP
Priority date: 2018-04-23
Filing date: 2018-04-23
Publication date: 2021-12-14
Anticipated expiration: 2038-04-23
Also published as: CN108588196A

Abstract

The invention discloses a method for preventing aerosol pollution formed by PCR. The invention provides a method for preventing aerosol pollution of a PCR product, which comprises the following steps: 1) solidifying the liquid PCR reaction system into a solid state to obtain a solid PCR reaction system; 2) and adding a template into the solid-state PCR reaction system for PCR amplification, thereby preventing aerosol pollution of PCR products. The invention adds the agarose with low melting point into a PCR reaction system, when the agarose becomes liquid in the high-temperature PCR amplification reaction and the melting curve analysis, the amplification and the analysis of the target gene are not influenced, the kit returns to the room temperature after the analysis process is finished, and the agarose becomes solid, thus preventing the aerosol pollution formed by a large amount of target gene fragments generated by amplification. The agarose is easy to obtain, non-toxic and pollution-free, and does not need special treatment after the reaction.

Description

Method for preventing aerosol pollution formed by PCR

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for preventing aerosol pollution formed by PCR.

Background

Polymerase Chain Reaction (PCR) is an in vitro nucleic acid amplification technique developed in the last 80 th century. It has the outstanding advantages of specificity, sensitivity, high yield, rapidness, simplicity, good repeatability, easy automation and the like. The target gene or a certain DNA fragment to be researched can be amplified to hundreds of thousands or even millions of times in a test tube within a plurality of hours, so that the target gene or a certain DNA fragment can be directly observed and judged by naked eyes. The PCR technology can amplify sufficient DNA from one hair, one drop of blood and even one cell for analysis, research, detection and identification. The PCR technology is a revolutionary initiative and milestone in the field of biotechnology, and particularly shows that the PCR technology cannot be replaced when being applied to the field of food safety detection. Although the application of PCR technology is extensive, the reaction is characterized by large amplification capacity and extremely high sensitivity, the generation of false positive can be caused by extremely trace pollution, wherein the pollution of PCR amplification products is the most common pollution problem in PCR reaction. The copy quantity of the PCR product is far higher than the limit of detecting several copies by PCR, so that the false positive can be caused by trace contamination of the PCR product. In addition, aerosol pollution caused by uncovering of a PCR reaction tube and the like due to repeated heating during operation is also a problem which is worthy of particular attention. The aerosol is a colloid dispersion system formed by dispersing and suspending small solid or liquid particles in a gas medium, and can be polluted by forming the aerosol when air is rubbed with a liquid surface, for example, a reaction tube is shaken violently during operation, and the aerosol can be formed by uncovering, sample sucking and repeated sample sucking of a pollution sample injection gun. How to effectively avoid aerosol pollution of PCR products and reduce false positive of PCR is a problem which is urgently needed to be solved at present.

Disclosure of Invention

The invention aims to provide a method for preventing aerosol pollution of a PCR product.

The method provided by the invention comprises the following steps:

1) solidifying the liquid PCR reaction system into a solid state to obtain a solid PCR reaction system;

2) and adding a template into the solid-state PCR reaction system for PCR amplification, thereby preventing aerosol pollution of PCR products.

In the method, the method for solidifying the liquid PCR reaction system into the solid state is to add low-melting-point agarose into the liquid PCR reaction system.

In the method, the step of adding the low-melting-point agarose into the liquid PCR reaction system is to add the low-melting-point agarose aqueous solution into the liquid PCR reaction system, and then to stand and solidify.

In the method, the mass volume percentage of the low-melting-point agarose in the solid-state PCR reaction system is 0.05-15%.

In the method, the mass volume percentage of the low-melting-point agarose in the solid-state PCR reaction system is 0.1-5%.

In the method, the mass volume percentage of the low-melting-point agarose in the solid-state PCR reaction system is 1 to 5 percent.

The application of the low melting point agarose in preventing aerosol pollution of PCR products is also the protection scope of the invention.

The invention adds low melting point agarose into a PCR reaction system, when the agarose becomes liquid in high temperature PCR amplification reaction and melting curve analysis, the amplification and analysis of target genes are not influenced, the kit returns to room temperature after the analysis process is finished, and the agarose becomes solid, thus preventing a large amount of target gene fragments generated by amplification from forming aerosol pollution, avoiding aerosol pollution of PCR amplification products, effectively reducing PCR false positive, and the low melting point agarose is easy to obtain, non-toxic and pollution-free, and does not need special treatment after the reaction.

Drawings

FIG. 1 shows the results of an RFU analysis of the melting curve Delta.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 method for preventing aerosol contamination by PCR

The principle is as follows: agarose with low melting point is added into a PCR reaction system, so that the PCR reaction system is solid at low temperature and normal temperature. The agarose becomes liquid when the high-temperature PCR amplification reaction and the melting curve analysis are carried out, the amplification and the analysis of the target gene are not influenced, the kit is restored to the room temperature after the analysis process is finished, and the agarose becomes solid, so that the aerosol pollution caused by a large amount of target gene fragments generated by amplification can be prevented.

1. Adding low-melting-point agarose to solidify the liquid PCR reaction system into a solid state

1) Preparation of low-melting point agarose solution

Taking the preparation of 5% (mass/volume g: ml) agarose as an example: 0.05g of low-melting agarose (Sigma-Aldrich Co, A2576) is weighed, 1mL of water is added, the mixture is fully shaken and mixed evenly, and the mixture is heated to liquid state to obtain the low-melting agarose aqueous solution.

2) PCR reaction system added with low-melting-point agarose

The low melting point agarose aqueous solution heated to the liquid state is added into a liquid reaction system according to the amount shown in the following table 1, and is kept stand for 30min in a refrigerator at 4 ℃ for cooling and solidification, so that a solid PCR reaction system is obtained.

Table 1 shows the components and concentrations of the PCR system

In the above PCR system:

the sequence of the upstream primer is as follows: ACAACCAGAGCTTGGCATATTGTATCT

The sequence of the downstream primer is as follows: CTCCAAAATATCACTTTCCATAAAAGCAAGG

The concentration of the above-mentioned low melting point agarose solution added to the PCR reaction system may be any one of 0.05% to 15%, with a preferred concentration of 0.1% to 5%.

3) Preparation of control PCR System without addition of Low melting agarose

Control PCR system (liquid): the control PCR system was obtained in exactly the same manner as in Table 1, except that no low-melting agarose solution was added.

2. Adding template for PCR amplification

The positive plasmid template is obtained by inserting a DNA molecule shown in a sequence 1 into a pMD-18T vector.

Experimental groups: to the solid-state PCR reaction system (low melting point agarose concentration of 1% or 5%) obtained in 2) of 1, a positive plasmid template (500 pg/reaction) was added, and the sample was carefully put into the system.

Control group: the positive plasmid template (500 pg/reaction) was added to the control PCR system (liquid) obtained in 3) of 1), and the sample was taken into the system.

Negative group: TE buffer was added to the solid-state PCR reaction system (low melting point agarose concentration of 1%) obtained in 2) of 1 as a negative control.

And (3) placing the 3 groups of reaction systems in a fluorescence PCR amplification instrument with the same type number for fluorescence PCR amplification to obtain a PCR amplification product.

The procedure for the above fluorescent PCR amplification is as follows 2:

table 2 shows PCR amplification procedure

The analysis result of Delta RFU of each PCR amplification melting curve group is shown in figure 1, and the A picture shows the analysis result of the reaction system of the experimental group (containing 1% of low melting point agarose); b is the result analysis of the reaction system in the experimental group (containing 5% low melting point agarose); the result analysis of the reaction system in the control group (liquid reaction system) is shown in the graph C; as can be seen, the PCR dissolution curves of the groups have no significant difference, which indicates that the low-melting-point agarose does not influence the PCR reaction characteristics; panel D shows that non-specific amplification did not occur in the negative group.

Sequence listing

<110> Beijing Zhonghuoda scientific and technological development center (limited partnership)

<120> a method for preventing aerosol contamination by PCR

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 42

<212> DNA

<213> Artificial sequence

<400> 1

cttagtttct caagccctta gcaccaaatt ctctgagatc agctcttcct tcagttacac 60

tgagcatttc ccctctgcag tgatggagaa gggagaactc ttattttttc tcatgagcat 120

ctctggggct gttttcctta gataaataag tggttctatt taatgtgaag cctgttttat 180

gaacaggatg aatgtggtat atattcagaa taactaatgt ttggaagttg ttttgttttg 240

ctaaaacaaa gttttagcaa acgatttttt ttttcaaatt tgtgtcttct gttctcaaag 300

catctctgat gtaagagata atgcgccacg atgggcatca gaagacctca gctcaaatcc 360

cagttctgcc agctatgagc tgtgtggcac caacaggtgt cctgttctcc cagggtctcc 420

cttttcccat ttgaaatata aaaaataaca attcctgcct tcacgtgttt ttttaggggg 480

ttaaatggta aaggtgttta tatctgctaa ggtaatttac ttgatatatg tttggttatt 540

gaagatatat gagttatgtt agctatttca tgtttaggct gctgtatttt tagtaggcta 600

t 601

Claims

1. A method for preventing aerosol contamination of PCR products, comprising the steps of:

2) adding a template into the solid-state PCR reaction system for PCR amplification to prevent aerosol pollution of PCR products;

the method for solidifying the liquid PCR reaction system into the solid state comprises the steps of adding low-melting-point agarose into the liquid PCR reaction system;

adding low-melting-point agarose into a liquid PCR reaction system comprises adding a low-melting-point agarose aqueous solution into the liquid PCR reaction system, and standing and solidifying;

the mass volume percentage of the low-melting-point agarose in the solid-state PCR reaction system is 1% or 5%.