CN114645026B - Malate dehydrogenase MDH and encoding gene and application thereof - Google Patents

Abstract

The application discloses malate dehydrogenase MDH, and a coding gene and application thereof. The malate dehydrogenase MDH disclosed by the application is A1), A2) or A3) as follows: a1 A protein having an amino acid sequence of SEQ ID No. 3; a2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in SEQ ID No.3 in the sequence table and has the same function; a3 A fusion protein obtained by ligating a tag to the N-terminal or/and the C-terminal of A1) or A2). After the malate dehydrogenase encoding gene is over-expressed, the transgenic plant grows obviously better than a wild type plant under drought treatment conditions, and the survival rate is higher than that of a control plant without the transgene, which shows that the malate dehydrogenase encoding gene can obviously improve the drought resistance of the plant.

Description

Malate dehydrogenase MDH and encoding gene and application thereof

Technical Field

The application relates to malate dehydrogenase MDH, and a coding gene and application thereof in the technical field of biology.

Background

Corn (Zea mays l.) is a annual herb of the poaceae family, also known as corn, corn cobs, maize, pearl rice, etc., native to central and south america, a world-important food crop, widely distributed in the united states, china, brazil and other countries. As a Chinese high-yield grain crop, corn is an important feed source in animal husbandry and breeding industry, and is also one of indispensable raw materials in food, medical and health industries, chemical industries and the like. Corn also has many biological activities, such as antioxidation, anti-tumor, blood sugar reduction, immunity improvement, bacteriostasis and sterilization, etc., and has wide development and application prospects.

Corn is an important food crop whose growth and yield are affected by a variety of environmental factors. Among these, drought is one of the factors that has the greatest impact on corn yield. Therefore, by means of genetic engineering, the corn variety is improved, the drought resistance is improved, and the method has important significance for yield reduction caused by drought.

Disclosure of Invention

The application aims to solve the technical problem of how to improve the drought resistance of corn.

In order to solve the technical problems, the application firstly provides any one of the following methods:

x1) a method for cultivating a drought resistance-improving plant, comprising expressing malate dehydrogenase in a recipient plant, or improving the content of said malate dehydrogenase in a recipient plant, or improving the activity of said malate dehydrogenase in a recipient plant, to obtain a plant of interest having improved drought resistance compared to said recipient plant;

x2) a method for improving drought resistance of a plant, comprising expressing the malate dehydrogenase in a recipient plant, or improving the content of the malate dehydrogenase in the recipient plant, or improving the activity of the malate dehydrogenase in the recipient plant, so as to obtain a target plant with improved drought resistance compared with the recipient plant, and improving the drought resistance of the plant;

the malate dehydrogenase, named MDH, is A1), A2) or A3) as follows:

a1 A protein having an amino acid sequence of SEQ ID No. 3;

a2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in SEQ ID No.3 in the sequence table and has the same function;

a3 A fusion protein obtained by ligating a tag to the N-terminal or/and the C-terminal of A1) or A2).

In order to facilitate purification of the protein of A1), a tag as shown in the following table may be attached to the amino-terminus or the carboxyl-terminus of the protein consisting of the amino acid sequence shown in SEQ ID No.3 of the sequence Listing.

Table: tag sequence

The protein in A2) has 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No.3 and has the same function. The identity of 75% or more is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

The protein in A2) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

The coding gene of the protein in A2) above can be obtained by deleting one or several amino acid residues in the DNA sequence shown in SEQ ID No.2 and/or making one or several base pair missense mutations and/or ligating the coding sequences of the tags shown in the above table at the 5 'and/or 3' ends thereof. Wherein the DNA molecule shown in SEQ ID No.2 encodes the protein shown in SEQ ID No. 3.

Among the above methods, the methods of X1) and X2) can be carried out by introducing a gene encoding MDH into the recipient plant and allowing the gene to be expressed.

The coding gene may be b 11) or b 12) or b 13) or b 14) or b 15) as follows:

b11 A cDNA molecule or a DNA molecule of SEQ ID No.2 in the sequence table;

b12 A cDNA molecule or a DNA molecule shown in SEQ ID No.2 of the sequence Listing;

b13 A DNA molecule shown in SEQ ID No.1 of the sequence table;

b14 A cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in b 11) or b 12) or b 13) and encoding MDH;

b15 Under stringent conditions with a nucleotide sequence defined by b 11) or b 12) or b 13) or b 14), and a cDNA molecule or genomic DNA molecule encoding MDH.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence of the MDH of the present application may be easily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of the MDH of the present application are derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application as long as they encode MDH and have a protein function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID No.3 of the present application. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

In the above method, the stringent conditions may be as follows: 50℃in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in2 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; the method can also be as follows: hybridization was performed in a solution of 6 XSSC, 0.5% SDS at 65℃and then washed once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; the method can also be as follows: 2×Hybridization and washing the membrane 2 times at 68℃in a solution of SSC,0.1% SDS for 5min each time, and hybridization and washing the membrane 2 times at 68℃in a solution of 0.5 XSSC, 0.1% SDS for 15min each time; the method can also be as follows: hybridization and washing of membranes were performed at 65℃in 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

In the above method, the coding gene may be modified as follows before being introduced into the recipient plant to achieve better expression effect:

1) Modification and optimization are carried out according to actual needs so as to enable the genes to be expressed efficiently; for example, the codon of the coding gene of the present application may be changed to conform to plant preferences while maintaining the amino acid sequence thereof according to the codon preferred by the recipient plant; during the optimization process, it is preferable to maintain a certain GC content in the optimized coding sequence to best achieve high level expression of the introduced gene in the plant, wherein the GC content may be 35%, more than 45%, more than 50% or more than about 60%;

2) Modifying the gene sequence adjacent to the initiation methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants;

3) Ligating to promoters expressed by various plants to facilitate expression thereof in plants; the promoter may include constitutive, inducible, chronologically regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space of expression requirements and will also depend on the target species; for example, a tissue or organ specific expression promoter, depending on the desired time period of development of the receptor; although many promoters derived from dicots have been demonstrated to be functional in monocots and vice versa, it is desirable to select dicot promoters for expression in dicots and monocot promoters for expression in monocots;

4) The expression efficiency of the gene of the application can be improved by connecting with a proper transcription terminator; e.g., tml derived from CaMV, E9 derived from rbcS; any available terminator known to function in plants may be ligated to the gene of the present application;

5) Enhancer sequences such as intron sequences (e.g., derived from Adhl and bronzel) and viral leader sequences (e.g., derived from TMV, MCMV and AMV) are introduced.

The recombinant expression vector may be introduced into plant cells by conventional biotechnological methods using Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998,Method for Plant Molecular Biology VIII,Academy Press,New York,pp.411-463;Geiserson and Corey,1998,Plant Molecular Biology (2 nd Edition)).

The plant of interest is understood to include not only the first generation plants in which the malate dehydrogenase or gene encoding it has been altered, but also the progeny thereof. For the plant of interest, the gene may be propagated in that species, or may be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The plants of interest include seeds, calli, whole plants and cells.

In the above method, the recipient plant may be M1) or M2) or M3):

m1) monocotyledonous or dicotyledonous plants;

m2) a gramineous plant;

m3) corn.

Any of the following applications of MDH or substances regulating MDH activity or content also falls within the scope of the present application:

d1 Regulating drought resistance of the plant;

d2 Preparing a product for regulating and controlling drought resistance of plants;

d3 Improving drought resistance of plants;

d4 Preparing a product for improving drought resistance of plants;

d5 Cultivating drought-resistance-improving plants;

d6 Preparing and cultivating the plant product with improved drought resistance.

Any of the following applications of the biological material related to MDH also falls within the scope of the present application:

d1 Regulating drought resistance of the plant;

d2 Preparing a product for regulating and controlling drought resistance of plants;

d3 Improving drought resistance of plants;

d4 Preparing a product for improving drought resistance of plants;

d5 Cultivating drought-resistance-improving plants;

d6 Preparing and cultivating a plant product with improved drought resistance;

the biomaterial is any one of the following B1) to B7):

b1 A nucleic acid molecule encoding MDH;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line comprising the nucleic acid molecule of B1) or a transgenic plant cell line comprising the expression cassette of B2);

b6 A transgenic plant tissue comprising the nucleic acid molecule of B1) or a transgenic plant tissue comprising the expression cassette of B2);

b7 A transgenic plant organ comprising the nucleic acid molecule of B1) or a transgenic plant organ comprising the expression cassette of B2).

In the above applications, the nucleic acid molecule of B1) may be B11) or B12) or B13) or B14) as follows:

b11 A cDNA molecule or a DNA molecule of SEQ ID No.2 in the sequence table;

b12 A cDNA molecule or a DNA molecule shown in SEQ ID No.2 of the sequence Listing;

b13 A DNA molecule shown in SEQ ID No.1 of the sequence table;

b14 A cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in b 11) or b 12) or b 13) and encoding the drought-resistance related protein according to claim 1;

b15 Hybridization under stringent conditions with a nucleotide sequence defined in b 11) or b 12) or b 13) or b 14), and a cDNA molecule or genomic DNA molecule encoding a drought-resistance related protein according to claim 1.

In the above applications, the expression cassette of B2) containing a nucleic acid molecule encoding MDH refers to a DNA capable of expressing MDH in a host cell, and the DNA may include not only a promoter for promoting the transcription of its gene but also a terminator for terminating the transcription of its gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present application include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoters from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5, 057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (China patent 200710099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin, and soybean beta-cone (Beachy et al (1985) EMBO J. 4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., odell et al (I) ⁹⁸⁵ ) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Gen. Genet,262:141; proudroot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al(1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.17:7891; joshi et al (1987) Nucleic Acid Res., 15:9627).

Recombinant vectors containing the MDH encoding gene expression cassette can be constructed using existing expression vectors.

In the above applications, the vector may be a plasmid, cosmid, phage or viral vector. The vector may specifically be a pBCXUN vector.

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacterium may be an agrobacterium, such as agrobacterium EHA105.

In the above applications, none of the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs include propagation material.

In the above application, the plant may be M1) or M2) or M3):

m1) monocotyledonous or dicotyledonous plants;

m2) a gramineous plant;

m3) corn.

MDH also falls within the scope of the present application.

The biological material also belongs to the protection scope of the application.

After the malate dehydrogenase encoding gene is overexpressed in corn, the transgenic plants have lighter wilting degree than the control degree under drought treatment conditions, and the survival rate is higher than that of the control plants without transgenes, which indicates that the overexpression of the gene can obviously improve the drought resistance of plants. The application successfully obtains drought-resistant plants, has short time and strong purposiveness compared with the traditional breeding mode, provides gene resources for cultivating and improving new drought-resistant plant varieties, and provides theoretical basis for elucidating the molecular mechanism of MDH in plant drought stress signal response.

Drawings

FIG. 1 is a phenotype after drought treatment. OE represents MDH-OE1.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents, instruments and the like used in the examples described below are commercially available unless otherwise specified. The quantitative tests in the following examples were all set up in triplicate and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

The pBCXUN vector is an expression vector obtained by replacing the HYG gene (hptII, hygromycin resistance gene) of the pCXUN vector (GenBank: FJ905215.1, 06-JUL-2009) with the Bar gene (encoding phosphinothricin acetyltransferase) (nucleotides 284-835 in MG719235.1, 02-OCT-2018) and keeping the other nucleotides of pCXUN unchanged.

Example 1 Malate dehydrogenase MDH can improve drought resistance of corn

In this example, it was found that a malate dehydrogenase MDH derived from maize B73 can improve drought resistance of maize, the amino acid sequence of which is shown as SEQ ID No.3 in the sequence table, in maize B73, the genome sequence of MDH is shown as SEQ ID No.1 in the sequence table, and the MDH contains an exon (i.e., CDS sequence thereof) which is nucleotide No. 601-1794 of SEQ ID No.1, i.e., SEQ ID No.2.

1. Construction of recombinant vectors

The MDH coding gene shown in SEQ ID No.2 of the sequence list is inserted into a pBCXUN vector to obtain a recombinant vector pBCXUN-MDH, and sequencing verification is carried out. In the recombinant vector pBCXUN-MDH, the Ubi promoter drives the expression of the foreign DNA molecule to obtain MDH protein.

2. Construction of transgenic maize

The pBCXUN-MDH obtained in the step 1 is introduced into an agrobacterium EHA105 strain to obtain recombinant strain EHA105/pBCXUN-MDH. Recombinant strain EHA105/pBCXUN-MDH single colony is inoculated in 2-3mL of liquid culture medium containing 100 mu g/mL kanamycin and 50 mu g/mL rifampicin, shake-cultured overnight at 28 ℃, transferred to a large amount of liquid culture medium containing 100 mu g/mL kanamycin and 50 mu g/mL rifampicin for the next day, shake-cultured, collected after transferring for several times, resuspended to OD ₆₀₀ Between 0.8 and 1.0, a recombinant Agrobacterium suspension was obtained. And (3) infecting young embryos of corn B73 scraped under aseptic conditions by using the obtained recombinant agrobacterium suspension, and then obtaining seedlings by inducing callus and screening herbicide glufosinate, and identifying to obtain transgenic plants. And obtaining a T3 generation after the transgenic plants are subjected to selfing propagation, and carrying out subsequent experiments.

Identification of transgenic plants: PCR amplification of genomic DNA of plants is performed by using primer pairs consisting of UbiP-seq (corresponding to the Ubi promoter) and NosR-seq (corresponding to the Nos terminator), so that plants with specific amplification products can be obtained as transgenic plants, and plants with specific amplification products cannot be obtained as non-transgenic plants. The primer sequences used were as follows:

UbiP-seq：TTTTAGCCCTGCCTTCATACGC；

NosR-seq：AGACCGGCAACAGGATTCAATC。

one of the transgenic inbred lines is MDH-OE1.

3. Drought resistance identification of transgenic corn

Corn to be tested: MDH-OE1, maize B73 (CK).

The detection steps are as follows: adding 140g of soil into each small basin, adding water into a tray, putting 4T 3 generation seeds or corn B73 seeds into each small basin, covering 50ml of soil, pouring out the residual water in the tray after the water is absorbed, removing one seedling with the worst growth vigor about three days after emergence, adding 1L of water into the tray, pouring out the water after the water is absorbed, starting drought treatment, continuing to not water for 20 days, observing the drought treatment phenotype of Control (CK) and transgenic corn, then recovering normal watering and culturing for 7 days, and then counting the survival rate. 8 pots of each maize were replicated.

Transgenic corn grew better than the control and leaf wilting less than the control (fig. 1); the survival rates of MDH-OE1 and corn B73 are respectively 100 percent and 41.7 percent, and the survival rate of MDH-OE1 is obviously higher than that of corn B73, which indicates that the transgenic corn has better drought resistance than the control.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> Chinese university of agriculture

<120> malate dehydrogenase MDH, and coding gene and application thereof

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 2394

<212> DNA

<213> corn (Zea mays L.)

<400> 1

gccctctacg gctctgcccc aacgagcccc aggggagcca ggaaaaggag ccgtcaaaag 60

ccgccgccga ggagagcgcg cagggtaacg aagcaccatc tcctctcctt gcccttcttc 120

gattaggttg gatcccagcc gccgtcgctg caggtgggat ctcctccgtt tttgcttcct 180

ctcagtcgtt ccttcgctcg ggccgtgtgt agatctgcac gttccctgta gaattctcct 240

ggtcggttcc attcctctcc gtcatattct cagtagatac tacgtttcat gccttgtccg 300

ggtattagat tatgcttcga aaggcaattt ggtctaggtg tgtagctcga tttgttagtg 360

atggcaaata ggaatggtgg cctcattttc aatagagttg gcaagtcagg caagttaggg 420

aactcaatca tatgatctat tttgttgaac gattcacgtt atagatcacc tgcttgatac 480

acgtttcatt cttggctctt actgcttcta aatccagttc ttcaagatat cctctgtctt 540

gaattatctt ctgcctcacc tgcatatgtg cctgacggaa ctttgttgct gcagtcaggc 600

atggcatcaa ccgttacctt caacccagtg agcgcccaag ctgcgctgat ccaaaagcca 660

aggaaccttg gagccataag ctatgctggc ttaaagatgc cggcatctgt tagctctggc 720

tcagagtcgt cattcctggg ctggaatgca tcccttcggg cagctgttac tccaaggatt 780

gtgcccaaga caaagtctgg atctcagata tctccacagg catcttacaa ggtggcagtg 840

ctgggtgctg ccggtggcat cggtcaaccc ttgggcctgt tggttaagat gtctcctctg 900

gtgtccgagc tgcatctgta tgatattgct aatgtcaagg gagttgctgc agatctcagc 960

cactgcaaca cgcctgctca ggttcttgac ttcactggac cctcagagtt agccaactgc 1020

ttgaaaggtg tggatgtcgt tgtcatccct gccggggtcc caaggaagcc tgggatgact 1080

cgcgatgacc tttttaacat caacgcaagc atcgtcaaga cacttgttga ggctgttgca 1140

gacagttgcc cagaggcgtt catccatatc atcagcaacc cggtgaattc cacggtgcca 1200

attgcagctg aggttctgaa gcagaagggt gtctacaatc ccaagaagct tttcggggtt 1260

accaccctgg atgttgtcag ggccaacaca tttgtggcgc agaagaagaa ccttaagctc 1320

atcgatgttg atgtcccagt tgttggtggc catgctggaa tcacaattct gccactgtta 1380

tcgaagacca ggccatctgt caccttcaca gatgaggaaa ctgaggagct gacaaagagg 1440

atacagaatg ccgggacaga ggtggtggat gccaaggctg gtgctgggtc tgctaccctg 1500

tccatggcct atgccgctgc cagattcgtt gagtcttctc tccgtgcgct ggctggcgat 1560

ccggatgttt atgagtgcac atttgttcag tctgagataa ctgacctgcc attcttcgca 1620

tcaagagtca agttgggcaa gaatggtgtt gagtccgtca tttctgccga cctccaggga 1680

atgactgagt atgaggccaa ggcacttgag gcgctgaagg ccgagttgaa ggcaagcatt 1740

gagaagggta ttgctttcgt gaacaaacag cgggaagctg ctgcatctgt ttgaggcgaa 1800

gcaagtgaaa cagaaggaac aatcgtcttg aatggctttt aagttttgca gcctagagtt 1860

ttttgttgtc ggcatgtagg aagatgttcc agatggttgc tgtttgtttc taattgctac 1920

atgggggctg aacatccatc ccccaagtta tcgccggttt ctgaaccagg ccttatttac 1980

acataaattt tgccccttct gtatcgtggt tctgtttgta gcttgttgga gtctacaaac 2040

tacaaagagg ctaataaacc acttttattg gaagtgatcc ttgtcatgtt tgcattgtcg 2100

tatttcctgc tgttcggcag gaaagccctg gcttcattgc ctactaaagt tattatcttt 2160

tttttttcat gggtaattgt ctcattggtt gagcaatcct agtcgaattt ggtggtgtta 2220

gaccttgatg gtgacgatgg gagacatgga tggctggaag gttgcatttg tttcggtaga 2280

ttcggacttc acaaaaaaag aatttggttg ttctgtgtct gctgtcctgt tttctgcttg 2340

gaagtcagcc aggcgattct gttttaggga taacagtggg gcggctttag gtca 2394

<210> 2

<211> 1194

<212> DNA

<213> corn (Zea mays L.)

<400> 2

atggcatcaa ccgttacctt caacccagtg agcgcccaag ctgcgctgat ccaaaagcca 60

aggaaccttg gagccataag ctatgctggc ttaaagatgc cggcatctgt tagctctggc 120

tcagagtcgt cattcctggg ctggaatgca tcccttcggg cagctgttac tccaaggatt 180

gtgcccaaga caaagtctgg atctcagata tctccacagg catcttacaa ggtggcagtg 240

ctgggtgctg ccggtggcat cggtcaaccc ttgggcctgt tggttaagat gtctcctctg 300

gtgtccgagc tgcatctgta tgatattgct aatgtcaagg gagttgctgc agatctcagc 360

cactgcaaca cgcctgctca ggttcttgac ttcactggac cctcagagtt agccaactgc 420

ttgaaaggtg tggatgtcgt tgtcatccct gccggggtcc caaggaagcc tgggatgact 480

cgcgatgacc tttttaacat caacgcaagc atcgtcaaga cacttgttga ggctgttgca 540

gacagttgcc cagaggcgtt catccatatc atcagcaacc cggtgaattc cacggtgcca 600

attgcagctg aggttctgaa gcagaagggt gtctacaatc ccaagaagct tttcggggtt 660

accaccctgg atgttgtcag ggccaacaca tttgtggcgc agaagaagaa ccttaagctc 720

atcgatgttg atgtcccagt tgttggtggc catgctggaa tcacaattct gccactgtta 780

tcgaagacca ggccatctgt caccttcaca gatgaggaaa ctgaggagct gacaaagagg 840

atacagaatg ccgggacaga ggtggtggat gccaaggctg gtgctgggtc tgctaccctg 900

tccatggcct atgccgctgc cagattcgtt gagtcttctc tccgtgcgct ggctggcgat 960

ccggatgttt atgagtgcac atttgttcag tctgagataa ctgacctgcc attcttcgca 1020

tcaagagtca agttgggcaa gaatggtgtt gagtccgtca tttctgccga cctccaggga 1080

atgactgagt atgaggccaa ggcacttgag gcgctgaagg ccgagttgaa ggcaagcatt 1140

gagaagggta ttgctttcgt gaacaaacag cgggaagctg ctgcatctgt ttga 1194

<210> 3

<211> 397

<212> PRT

<213> corn (Zea mays L.)

<400> 3

Met Ala Ser Thr Val Thr Phe Asn Pro Val Ser Ala Gln Ala Ala Leu

1 5 10 15

Ile Gln Lys Pro Arg Asn Leu Gly Ala Ile Ser Tyr Ala Gly Leu Lys

20 25 30

Met Pro Ala Ser Val Ser Ser Gly Ser Glu Ser Ser Phe Leu Gly Trp

35 40 45

Asn Ala Ser Leu Arg Ala Ala Val Thr Pro Arg Ile Val Pro Lys Thr

50 55 60

Lys Ser Gly Ser Gln Ile Ser Pro Gln Ala Ser Tyr Lys Val Ala Val

65 70 75 80

Leu Gly Ala Ala Gly Gly Ile Gly Gln Pro Leu Gly Leu Leu Val Lys

85 90 95

Met Ser Pro Leu Val Ser Glu Leu His Leu Tyr Asp Ile Ala Asn Val

100 105 110

Lys Gly Val Ala Ala Asp Leu Ser His Cys Asn Thr Pro Ala Gln Val

115 120 125

Leu Asp Phe Thr Gly Pro Ser Glu Leu Ala Asn Cys Leu Lys Gly Val

130 135 140

Asp Val Val Val Ile Pro Ala Gly Val Pro Arg Lys Pro Gly Met Thr

145 150 155 160

Arg Asp Asp Leu Phe Asn Ile Asn Ala Ser Ile Val Lys Thr Leu Val

165 170 175

Glu Ala Val Ala Asp Ser Cys Pro Glu Ala Phe Ile His Ile Ile Ser

180 185 190

Asn Pro Val Asn Ser Thr Val Pro Ile Ala Ala Glu Val Leu Lys Gln

195 200 205

Lys Gly Val Tyr Asn Pro Lys Lys Leu Phe Gly Val Thr Thr Leu Asp

210 215 220

Val Val Arg Ala Asn Thr Phe Val Ala Gln Lys Lys Asn Leu Lys Leu

225 230 235 240

Ile Asp Val Asp Val Pro Val Val Gly Gly His Ala Gly Ile Thr Ile

245 250 255

Leu Pro Leu Leu Ser Lys Thr Arg Pro Ser Val Thr Phe Thr Asp Glu

260 265 270

Glu Thr Glu Glu Leu Thr Lys Arg Ile Gln Asn Ala Gly Thr Glu Val

275 280 285

Val Asp Ala Lys Ala Gly Ala Gly Ser Ala Thr Leu Ser Met Ala Tyr

290 295 300

Ala Ala Ala Arg Phe Val Glu Ser Ser Leu Arg Ala Leu Ala Gly Asp

305 310 315 320

Pro Asp Val Tyr Glu Cys Thr Phe Val Gln Ser Glu Ile Thr Asp Leu

325 330 335

Pro Phe Phe Ala Ser Arg Val Lys Leu Gly Lys Asn Gly Val Glu Ser

340 345 350

Val Ile Ser Ala Asp Leu Gln Gly Met Thr Glu Tyr Glu Ala Lys Ala

355 360 365

Leu Glu Ala Leu Lys Ala Glu Leu Lys Ala Ser Ile Glu Lys Gly Ile

370 375 380

Ala Phe Val Asn Lys Gln Arg Glu Ala Ala Ala Ser Val

385 390 395

Claims (6)

1. The method comprises the following steps:

x1) a method for cultivating drought-resistance-improved corn, comprising the steps of expressing malate dehydrogenase in a recipient corn, or improving the content of the malate dehydrogenase in the recipient corn, or improving the activity of the malate dehydrogenase in the recipient corn, so as to obtain target corn with improved drought resistance compared with the recipient corn;

x2) the method for improving the drought resistance of the corn comprises the steps of enabling the malate dehydrogenase to be expressed in a recipient corn, or improving the content of the malate dehydrogenase in the recipient corn, or improving the activity of the malate dehydrogenase in the recipient corn, so as to obtain the target corn with improved drought resistance compared with the recipient corn, and improving the drought resistance of the corn;

the malate dehydrogenase is A1) or A2) as follows:

a1 A protein shown in SEQ ID No. 3;

a2 A fusion protein obtained by ligating a tag to the N-terminal or/and the C-terminal of A1).

2. The method according to claim 1, characterized in that: x1) and X2) is achieved by introducing into the recipient maize a gene encoding the malate dehydrogenase of claim 1 and allowing the gene to be expressed.

3. The method according to claim 2, characterized in that: the coding gene is b 11) or b 12) or b 13) as follows:

b11 A cDNA molecule or a DNA molecule shown as SEQ ID No.2 in a sequence table;

b12 A cDNA molecule or a DNA molecule shown in SEQ ID No.2 of the sequence Listing;

b13 A DNA molecule shown in SEQ ID No.1 of the sequence Listing.

4. The use of any one of the following malate dehydrogenases of claim 1:

d1 Improving drought resistance of corn;

d2 Preparing a product for improving drought resistance of corn;

d3 Cultivating drought-resistant corn;

d4 Preparing and cultivating the maize product with improved drought resistance.

5. Use of any of the following biological materials in relation to the malate dehydrogenase of claim 1:

d1 Improving drought resistance of corn;

d2 Preparing a product for improving drought resistance of corn;

d3 Cultivating drought-resistant corn;

d4 Preparing and cultivating a corn product with improved drought resistance;

the biomaterial is any one of the following B1) to B7):

b1 A nucleic acid molecule encoding the malate dehydrogenase of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic maize cell line containing the nucleic acid molecule of B1) or a transgenic maize cell line containing the expression cassette of B2);

b6 A transgenic corn tissue comprising the nucleic acid molecule of B1) or a transgenic corn tissue comprising the expression cassette of B2);

b7 A transgenic maize organ comprising the nucleic acid molecule of B1) or a transgenic maize organ comprising the expression cassette of B2).

6. The use according to claim 5, characterized in that: b1 The nucleic acid molecule is b 11) or b 12) or b 13) as follows:

b11 A cDNA molecule or a DNA molecule shown as SEQ ID No.2 in a sequence table;

b12 A cDNA molecule or a DNA molecule shown in SEQ ID No.2 of the sequence Listing;

b13 A DNA molecule shown in SEQ ID No.1 of the sequence Listing.