CN114645026A - Malate dehydrogenase MDH and coding gene and application thereof - Google Patents

Abstract

The invention discloses a malate dehydrogenase MDH, and a coding gene and application thereof. The malate dehydrogenase MDH disclosed by the invention is A1), A2) or A3): A1) a protein having the amino acid sequence of SEQ ID No. 3; A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown by SEQ ID No.3 in the sequence table and has the same function; A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2). After the malic dehydrogenase coding gene is over-expressed, the transgenic plant under the drought treatment condition grows obviously better than the wild type, and the survival rate is higher than that of a control plant without the transgene, so that the drought resistance of the plant can be obviously improved.

Description

Malate dehydrogenase MDH and coding gene and application thereof

Technical Field

The invention relates to malate dehydrogenase MDH and a coding gene and application thereof in the field of biotechnology.

Background

Corn (Zea mays L.) is an annual herbaceous plant of the grass family, also known as corn, corn cobs, maize, pearl rice, and the like, native to central and south america, is a world-important food crop, widely distributed in the united states, china, brazil, and other countries. As a high-yield food crop in china, corn is an important feed source in animal husbandry and breeding industry, and is also one of indispensable raw materials for food, medical health, chemical industry and the like. The corn also has a plurality of biological activities, such as oxidation resistance, tumor resistance, blood sugar reduction, immunity improvement, bacteriostasis, sterilization and the like, and has wide development and application prospects.

Corn, an important food crop, is affected in its growth and yield by a variety of environmental factors. Among them, drought is one of the factors that most affect the yield of corn. Therefore, the method improves the corn variety and improves the drought resistance by means of genetic engineering, and has important significance for yield reduction caused by drought.

Disclosure of Invention

The invention aims to solve the technical problem of how to improve the drought resistance of the corn.

In order to solve the above technical problem, the present invention first provides any one of the following methods:

x1) a method for cultivating a drought-resistance-enhanced plant, comprising expressing malate dehydrogenase in a recipient plant, or enhancing the malate dehydrogenase content in a recipient plant, or enhancing the malate dehydrogenase activity in a recipient plant, to obtain a target plant with enhanced drought resistance as compared to said recipient plant;

x2), comprising the steps of enabling the malic dehydrogenase to be expressed in a receptor plant, or increasing the content of the malic dehydrogenase in the receptor plant, or increasing the activity of the malic dehydrogenase in the receptor plant, so as to obtain a target plant with drought resistance improved compared with the receptor plant, and realize the improvement of the drought resistance of the plant;

the malate dehydrogenase is MDH, and is A1), A2) or A3) as follows:

A1) a protein having the amino acid sequence of SEQ ID No. 3;

A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown by SEQ ID No.3 in the sequence table and has the same function;

A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2).

In order to facilitate the purification of the protein of A1), the amino terminus or the carboxy terminus of the protein consisting of the amino acid sequence shown in SEQ ID No.3 of the sequence Listing may be attached with the tags shown in the following table.

Table: sequence of tags

The protein A2) is a protein having identity of 75% or more than 75% with the amino acid sequence of the protein shown in SEQ ID No.3 and having the same function. The identity of 75% or more than 75% is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

The protein of A2) above may be artificially synthesized, or may be obtained by synthesizing the coding gene and then performing biological expression.

The gene encoding the protein of A2) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in SEQ ID No.2, and/or by carrying out missense mutation of one or several base pairs, and/or by attaching a coding sequence of the tag shown in the above table to the 5 'end and/or 3' end thereof. Wherein, the DNA molecule shown in SEQ ID No.2 encodes the protein shown in SEQ ID No. 3.

The above method, X1) and X2) can be carried out by introducing a gene encoding MDH into the recipient plant and allowing the gene to be expressed.

The encoding gene can be b11) or b12) or b13) or b14) or b 15):

b11) the coding sequence is cDNA molecule or DNA molecule of SEQ ID No.2 in the sequence table;

b12) a cDNA molecule or DNA molecule shown in SEQ ID No.2 in a sequence table;

b13) DNA molecule shown as SEQ ID No.1 in the sequence table;

b14) a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in b11) or b12) or b13) and encoding MDH;

b15) a cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in b11) or b12) or b13) or b14) and encodes an MDH.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence of the MDH of the present invention can be easily mutated by a person of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence of the MDH of the present invention are derived from and identical to the nucleotide sequence of the present invention as long as they encode the MDH and have a protein function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No. 3. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

In the above method, the stringent conditions may be as follows: 50 ℃ in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in2 XSSC, 0.1% SDS at 50 ℃; it can also be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing at 50 ℃ in 1 XSSC, 0.1% SDS; it can also be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA at 50 deg.CRinsing in 0.5 XSSC, 0.1% SDS; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; it can also be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; can also be: hybridization in a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; can also be: hybridization and washing of membranes 2 times, 5min each, at 68 ℃ in a solution of 2 XSSC, 0.1% SDS, and hybridization and washing of membranes 2 times, 15min each, at 68 ℃ in a solution of 0.5 XSSC, 0.1% SDS; can also be: 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃ and washing the membrane.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above method, the coding gene may be modified as follows and then introduced into the recipient plant to achieve better expression effect:

1) modifying and optimizing according to actual needs to enable the gene to be efficiently expressed; for example, the codon of the encoding gene of the present invention may be changed to conform to the preference of a recipient plant while maintaining the amino acid sequence thereof; during the optimization, it is desirable to maintain a GC content in the optimized coding sequence to best achieve high expression levels of the introduced gene in plants, wherein the GC content can be 35%, more than 45%, more than 50%, or more than about 60%;

2) modifying the sequence of the gene adjacent to the initiating methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants;

3) linking with promoters expressed by various plants to facilitate the expression of the promoters in the plants; such promoters may include constitutive, inducible, time-regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space requirements of expression, and will also depend on the target species; for example, tissue or organ specific expression promoters, depending on the stage of development of the desired receptor; although many promoters derived from dicots have been demonstrated to be functional in monocots and vice versa, desirably, dicot promoters are selected for expression in dicots and monocot promoters for expression in monocots;

4) the expression efficiency of the gene of the present invention can also be improved by linking to a suitable transcription terminator; tml from CaMV, E9 from rbcS; any available terminator which is known to function in plants may be linked to the gene of the invention;

5) enhancer sequences, such as intron sequences (e.g., from Adhl and bronzel) and viral leader sequences (e.g., from TMV, MCMV, and AMV) were introduced.

The recombinant expression vector can be introduced into Plant cells by using conventional biotechnological methods such as Ti plasmid, Plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach,1998, Method for Plant Molecular Biology VIII, academic Press, New York, pp.411-463; Geiserson and Corey,1998, Plant Molecular Biology (2nd Edition)).

Said plant of interest is understood to comprise not only said malate dehydrogenase or the first generation plant in which the gene encoding it has been altered, but also the progeny thereof. For the plant of interest, the gene may be propagated in the species, or transferred into other varieties of the same species, including commercial varieties in particular, using conventional breeding techniques. The plant of interest includes seeds, callus, whole plants and cells.

In the above method, the recipient plant may be M1) or M2) or M3):

m1) monocotyledonous or dicotyledonous plants;

m2) gramineous plants;

m3) maize.

The following applications of MDH or the substance for regulating the activity or content of MDH also belong to the protection scope of the invention:

D1) regulating and controlling the drought resistance of the plant;

D2) preparing a product for regulating and controlling the drought resistance of plants;

D3) the drought resistance of the plants is improved;

D4) preparing a product for improving the drought resistance of plants;

D5) cultivating drought-resistant improvement plants;

D6) preparing and cultivating plant products with improved drought resistance.

Any of the following uses of the MDH-related biomaterials is also within the scope of the present invention:

D1) regulating and controlling the drought resistance of the plant;

D2) preparing a product for regulating and controlling the drought resistance of plants;

D3) the drought resistance of the plants is improved;

D4) preparing products for improving the drought resistance of plants;

D5) cultivating drought-resistant improvement plants;

D6) preparing and cultivating drought-resistant plant products;

the biomaterial is any one of the following B1) to B7):

B1) a nucleic acid molecule encoding MDH;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) said nucleic acid molecule, or a recombinant microorganism containing B2) said expression cassette, or a recombinant microorganism containing B3) said recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing B1) the nucleic acid molecule or a transgenic plant organ containing B2) the expression cassette.

In the above application, the nucleic acid molecule of B1) may be B11) or B12) or B13) or B14):

b11) the coding sequence is cDNA molecule or DNA molecule of SEQ ID No.2 in the sequence table;

b12) a cDNA molecule or DNA molecule shown as SEQ ID No.2 in a sequence table;

b13) DNA molecule shown as SEQ ID No.1 in the sequence table;

b14) a cDNA molecule or a genomic DNA molecule having 75% or more identity with the nucleotide sequence defined by b11) or b12) or b13) and encoding the drought-resistant related protein as claimed in claim 1;

b15) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence defined by b11) or b12) or b13) or b14) under strict conditions and codes for the drought-resistant related protein in claim 1.

In the above application, the expression cassette containing the nucleic acid molecule encoding MDH according to B2) refers to a DNA capable of expressing MDH in a host cell, and the DNA may include not only a promoter for promoting gene transcription thereof but also a terminator for terminating gene transcription thereof. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter of cauliflower mosaic virus 35S; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al (1999) Plant Physiol 120: 979-992); chemically inducible promoter from tobacco, pathogenesis-related 1(PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128(CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators includeBut are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., Odell et al (I)⁹⁸⁵) Nature 313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev.,5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; ballad et al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

The recombinant vector containing the MDH coding gene expression cassette can be constructed by using the existing expression vector.

In the above application, the vector may be a plasmid, a cosmid, a phage, or a viral vector. The vector may specifically be a pBCXUN vector.

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacteria can be Agrobacterium, such as Agrobacterium EHA 105.

In the above application, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation material.

In the above application, the plant may be M1), M2) or M3):

m1) monocotyledonous or dicotyledonous plants;

m2) gramineous plants;

m3) maize.

MDH also belongs to the protection scope of the invention.

The biological material also belongs to the protection scope of the invention.

After the malic dehydrogenase coding gene is over-expressed in the corn, the wilting degree of the transgenic plant under the drought treatment condition is lighter than the control degree, and the survival rate is higher than that of the non-transgenic control plant, which shows that the over-expression of the gene can obviously improve the drought resistance of the plant. The method successfully obtains the drought-resistant plant, has short time and strong purpose compared with the traditional breeding mode, provides gene resources for cultivating and improving new varieties of the drought-resistant plant, and provides theoretical basis for clarifying the molecular mechanism of MDH in plant drought stress signal response.

Drawings

FIG. 1 shows the phenotype after drought treatment. OE denotes MDH-OE 1.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

The pBCXUN vector is an expression vector obtained by replacing the HYG gene (hptII, hygromycin resistance gene) of the pCXUN vector (GenBank: FJ905215.1, 06-JUL-2009) with the Bar gene (encoding phosphinothricin acetyltransferase) (GenBank: nucleotide 284-835 of MG719235.1, 02-OCT-2018) and keeping the other nucleotides of pCXUN unchanged.

Example 1 malate dehydrogenase MDH to improve drought resistance of corn

In this example, it was found that a malate dehydrogenase MDH derived from maize B73 can improve drought resistance of maize, the amino acid sequence of which is shown as SEQ ID No.3 in the sequence table, and in maize B73, the genomic sequence of the MDH is SEQ ID No.1 in the sequence table, contains an exon (i.e., CDS sequence) which is nucleotide 601-1794 of SEQ ID No.1, i.e., SEQ ID No. 2.

1. Construction of recombinant vectors

The MDH coding gene shown in SEQ ID No.2 of the sequence table is inserted into a pBCXUN vector to obtain a recombinant vector pBCXUN-MDH, and sequencing verification is carried out. In the recombinant vector pBCXUN-MDH, the expression of an exogenous DNA molecule is driven by a Ubi promoter to obtain an MDH protein.

2. Construction of transgenic maize

And (3) introducing the pBCXUN-MDH obtained in the step (1) into an agrobacterium EHA105 strain to obtain a recombinant strain EHA 105/pBCXUN-MDH. Inoculating recombinant strain EHA105/pBCXUN-MDH single colony in 2-3mL liquid culture medium containing 100. mu.g/mL kanamycin and 50. mu.g/mL rifampicin, shake culturing at 28 deg.C overnight, inoculating to liquid culture medium containing 100. mu.g/mL kanamycin and 50. mu.g/mL rifampicin, shake culturing for several times, collecting thallus, and resuspending to OD₆₀₀Between 0.8 and 1.0, recombinant Agrobacterium suspensions were obtained. And infecting young embryos of corn B73 which are scraped out under the aseptic condition by using the obtained recombinant agrobacterium tumefaciens suspension, inducing the young embryos to have callus, screening herbicide glufosinate-glufosinate to obtain seedlings, and identifying to obtain transgenic plants. Transgenic plants are obtained by self-crossing and seed-breeding T3 generation for subsequent experiments.

Identification of transgenic plants: the PCR amplification is carried out on the genome DNA of the plant by adopting a primer pair consisting of Ubi P-seq (corresponding to the Ubi promoter) and NosR-seq (corresponding to the Nos terminator), the plant which can obtain a specific amplification product is a transgenic plant, and the plant which can not obtain the specific amplification product is a non-transgenic plant. The primer sequences used were as follows:

UbiP-seq：TTTTAGCCCTGCCTTCATACGC；

NosR-seq：AGACCGGCAACAGGATTCAATC。

one of the transgenic inbred lines is MDH-OE 1.

3. Drought resistance identification of transgenic corn

Corn to be detected: MDH-OE1, maize B73 (CK).

The detection steps are as follows: adding 140g of soil into each small pot, adding water into a tray, placing 4T 3 generation seeds or corn B73 seeds into each small pot, covering 50ml of soil, pouring off the residual water in the tray after full water absorption, removing one seedling with the worst growth vigor about three days after seedling emergence, adding 1L of water into the tray, pouring off the water after full water absorption, starting drought treatment, continuously not watering for 20 days, observing the drought treatment phenotype of Control (CK) and transgenic corn, then recovering normal watering and culturing for 7 days, and counting the survival rate. Each corn was replicated in 8 pots.

The growth condition of the transgenic corn is better than that of the control, and the leaf wilting degree is lower than that of the control (figure 1); the survival rates of the MDH-OE1 and the corn B73 are 100% and 41.7% respectively, and the survival rate of the MDH-OE1 is obviously higher than that of the corn B73, which indicates that the transgenic corn has better drought resistance than a control.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> university of agriculture in China

<120> malate dehydrogenase MDH, and coding gene and application thereof

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 2394

<212> DNA

<213> corn (Zea mays L.)

<400> 1

gccctctacg gctctgcccc aacgagcccc aggggagcca ggaaaaggag ccgtcaaaag 60

ccgccgccga ggagagcgcg cagggtaacg aagcaccatc tcctctcctt gcccttcttc 120

gattaggttg gatcccagcc gccgtcgctg caggtgggat ctcctccgtt tttgcttcct 180

ctcagtcgtt ccttcgctcg ggccgtgtgt agatctgcac gttccctgta gaattctcct 240

ggtcggttcc attcctctcc gtcatattct cagtagatac tacgtttcat gccttgtccg 300

ggtattagat tatgcttcga aaggcaattt ggtctaggtg tgtagctcga tttgttagtg 360

atggcaaata ggaatggtgg cctcattttc aatagagttg gcaagtcagg caagttaggg 420

aactcaatca tatgatctat tttgttgaac gattcacgtt atagatcacc tgcttgatac 480

acgtttcatt cttggctctt actgcttcta aatccagttc ttcaagatat cctctgtctt 540

gaattatctt ctgcctcacc tgcatatgtg cctgacggaa ctttgttgct gcagtcaggc 600

atggcatcaa ccgttacctt caacccagtg agcgcccaag ctgcgctgat ccaaaagcca 660

aggaaccttg gagccataag ctatgctggc ttaaagatgc cggcatctgt tagctctggc 720

tcagagtcgt cattcctggg ctggaatgca tcccttcggg cagctgttac tccaaggatt 780

gtgcccaaga caaagtctgg atctcagata tctccacagg catcttacaa ggtggcagtg 840

ctgggtgctg ccggtggcat cggtcaaccc ttgggcctgt tggttaagat gtctcctctg 900

gtgtccgagc tgcatctgta tgatattgct aatgtcaagg gagttgctgc agatctcagc 960

cactgcaaca cgcctgctca ggttcttgac ttcactggac cctcagagtt agccaactgc 1020

ttgaaaggtg tggatgtcgt tgtcatccct gccggggtcc caaggaagcc tgggatgact 1080

cgcgatgacc tttttaacat caacgcaagc atcgtcaaga cacttgttga ggctgttgca 1140

gacagttgcc cagaggcgtt catccatatc atcagcaacc cggtgaattc cacggtgcca 1200

attgcagctg aggttctgaa gcagaagggt gtctacaatc ccaagaagct tttcggggtt 1260

accaccctgg atgttgtcag ggccaacaca tttgtggcgc agaagaagaa ccttaagctc 1320

atcgatgttg atgtcccagt tgttggtggc catgctggaa tcacaattct gccactgtta 1380

tcgaagacca ggccatctgt caccttcaca gatgaggaaa ctgaggagct gacaaagagg 1440

atacagaatg ccgggacaga ggtggtggat gccaaggctg gtgctgggtc tgctaccctg 1500

tccatggcct atgccgctgc cagattcgtt gagtcttctc tccgtgcgct ggctggcgat 1560

ccggatgttt atgagtgcac atttgttcag tctgagataa ctgacctgcc attcttcgca 1620

tcaagagtca agttgggcaa gaatggtgtt gagtccgtca tttctgccga cctccaggga 1680

atgactgagt atgaggccaa ggcacttgag gcgctgaagg ccgagttgaa ggcaagcatt 1740

gagaagggta ttgctttcgt gaacaaacag cgggaagctg ctgcatctgt ttgaggcgaa 1800

gcaagtgaaa cagaaggaac aatcgtcttg aatggctttt aagttttgca gcctagagtt 1860

ttttgttgtc ggcatgtagg aagatgttcc agatggttgc tgtttgtttc taattgctac 1920

atgggggctg aacatccatc ccccaagtta tcgccggttt ctgaaccagg ccttatttac 1980

acataaattt tgccccttct gtatcgtggt tctgtttgta gcttgttgga gtctacaaac 2040

tacaaagagg ctaataaacc acttttattg gaagtgatcc ttgtcatgtt tgcattgtcg 2100

tatttcctgc tgttcggcag gaaagccctg gcttcattgc ctactaaagt tattatcttt 2160

tttttttcat gggtaattgt ctcattggtt gagcaatcct agtcgaattt ggtggtgtta 2220

gaccttgatg gtgacgatgg gagacatgga tggctggaag gttgcatttg tttcggtaga 2280

ttcggacttc acaaaaaaag aatttggttg ttctgtgtct gctgtcctgt tttctgcttg 2340

gaagtcagcc aggcgattct gttttaggga taacagtggg gcggctttag gtca 2394

<210> 2

<211> 1194

<212> DNA

<213> corn (Zea mays L.)

<400> 2

atggcatcaa ccgttacctt caacccagtg agcgcccaag ctgcgctgat ccaaaagcca 60

aggaaccttg gagccataag ctatgctggc ttaaagatgc cggcatctgt tagctctggc 120

tcagagtcgt cattcctggg ctggaatgca tcccttcggg cagctgttac tccaaggatt 180

gtgcccaaga caaagtctgg atctcagata tctccacagg catcttacaa ggtggcagtg 240

ctgggtgctg ccggtggcat cggtcaaccc ttgggcctgt tggttaagat gtctcctctg 300

gtgtccgagc tgcatctgta tgatattgct aatgtcaagg gagttgctgc agatctcagc 360

cactgcaaca cgcctgctca ggttcttgac ttcactggac cctcagagtt agccaactgc 420

ttgaaaggtg tggatgtcgt tgtcatccct gccggggtcc caaggaagcc tgggatgact 480

cgcgatgacc tttttaacat caacgcaagc atcgtcaaga cacttgttga ggctgttgca 540

gacagttgcc cagaggcgtt catccatatc atcagcaacc cggtgaattc cacggtgcca 600

attgcagctg aggttctgaa gcagaagggt gtctacaatc ccaagaagct tttcggggtt 660

accaccctgg atgttgtcag ggccaacaca tttgtggcgc agaagaagaa ccttaagctc 720

atcgatgttg atgtcccagt tgttggtggc catgctggaa tcacaattct gccactgtta 780

tcgaagacca ggccatctgt caccttcaca gatgaggaaa ctgaggagct gacaaagagg 840

atacagaatg ccgggacaga ggtggtggat gccaaggctg gtgctgggtc tgctaccctg 900

tccatggcct atgccgctgc cagattcgtt gagtcttctc tccgtgcgct ggctggcgat 960

ccggatgttt atgagtgcac atttgttcag tctgagataa ctgacctgcc attcttcgca 1020

tcaagagtca agttgggcaa gaatggtgtt gagtccgtca tttctgccga cctccaggga 1080

atgactgagt atgaggccaa ggcacttgag gcgctgaagg ccgagttgaa ggcaagcatt 1140

gagaagggta ttgctttcgt gaacaaacag cgggaagctg ctgcatctgt ttga 1194

<210> 3

<211> 397

<212> PRT

<213> corn (Zea mays L.)

<400> 3

Met Ala Ser Thr Val Thr Phe Asn Pro Val Ser Ala Gln Ala Ala Leu

1 5 10 15

Ile Gln Lys Pro Arg Asn Leu Gly Ala Ile Ser Tyr Ala Gly Leu Lys

20 25 30

Met Pro Ala Ser Val Ser Ser Gly Ser Glu Ser Ser Phe Leu Gly Trp

35 40 45

Asn Ala Ser Leu Arg Ala Ala Val Thr Pro Arg Ile Val Pro Lys Thr

50 55 60

Lys Ser Gly Ser Gln Ile Ser Pro Gln Ala Ser Tyr Lys Val Ala Val

65 70 75 80

Leu Gly Ala Ala Gly Gly Ile Gly Gln Pro Leu Gly Leu Leu Val Lys

85 90 95

Met Ser Pro Leu Val Ser Glu Leu His Leu Tyr Asp Ile Ala Asn Val

100 105 110

Lys Gly Val Ala Ala Asp Leu Ser His Cys Asn Thr Pro Ala Gln Val

115 120 125

Leu Asp Phe Thr Gly Pro Ser Glu Leu Ala Asn Cys Leu Lys Gly Val

130 135 140

Asp Val Val Val Ile Pro Ala Gly Val Pro Arg Lys Pro Gly Met Thr

145 150 155 160

Arg Asp Asp Leu Phe Asn Ile Asn Ala Ser Ile Val Lys Thr Leu Val

165 170 175

Glu Ala Val Ala Asp Ser Cys Pro Glu Ala Phe Ile His Ile Ile Ser

180 185 190

Asn Pro Val Asn Ser Thr Val Pro Ile Ala Ala Glu Val Leu Lys Gln

195 200 205

Lys Gly Val Tyr Asn Pro Lys Lys Leu Phe Gly Val Thr Thr Leu Asp

210 215 220

Val Val Arg Ala Asn Thr Phe Val Ala Gln Lys Lys Asn Leu Lys Leu

225 230 235 240

Ile Asp Val Asp Val Pro Val Val Gly Gly His Ala Gly Ile Thr Ile

245 250 255

Leu Pro Leu Leu Ser Lys Thr Arg Pro Ser Val Thr Phe Thr Asp Glu

260 265 270

Glu Thr Glu Glu Leu Thr Lys Arg Ile Gln Asn Ala Gly Thr Glu Val

275 280 285

Val Asp Ala Lys Ala Gly Ala Gly Ser Ala Thr Leu Ser Met Ala Tyr

290 295 300

Ala Ala Ala Arg Phe Val Glu Ser Ser Leu Arg Ala Leu Ala Gly Asp

305 310 315 320

Pro Asp Val Tyr Glu Cys Thr Phe Val Gln Ser Glu Ile Thr Asp Leu

325 330 335

Pro Phe Phe Ala Ser Arg Val Lys Leu Gly Lys Asn Gly Val Glu Ser

340 345 350

Val Ile Ser Ala Asp Leu Gln Gly Met Thr Glu Tyr Glu Ala Lys Ala

355 360 365

Leu Glu Ala Leu Lys Ala Glu Leu Lys Ala Ser Ile Glu Lys Gly Ile

370 375 380

Ala Phe Val Asn Lys Gln Arg Glu Ala Ala Ala Ser Val

385 390 395

Claims (10)

1. Any one of the following methods:

x1), comprising the steps of enabling a receptor plant to express malate dehydrogenase, or increasing the content of the malate dehydrogenase in the receptor plant, or increasing the activity of the malate dehydrogenase in the receptor plant, so as to obtain a target plant with improved drought resistance compared with the receptor plant;

x2), comprising the steps of enabling the malic dehydrogenase to be expressed in a receptor plant, or increasing the content of the malic dehydrogenase in the receptor plant, or increasing the activity of the malic dehydrogenase in the receptor plant, so as to obtain a target plant with drought resistance improved compared with the receptor plant, and realize the improvement of the drought resistance of the plant;

the malate dehydrogenase is A1), A2) or A3) as follows:

A1) a protein having the amino acid sequence of SEQ ID No. 3;

A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.3 in the sequence table and has the same function;

A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2).

2. The method of claim 1, wherein: x1) and X2) by introducing into the recipient plant a gene encoding the malate dehydrogenase enzyme of claim 1 and allowing the encoding gene to be expressed.

3. The method of claim 2, wherein: the coding gene is b11) or b12) or b13) or b14) or b 15):

b11) the coding sequence is cDNA molecule or DNA molecule of SEQ ID No.2 in the sequence table;

b12) a cDNA molecule or DNA molecule shown as SEQ ID No.2 in a sequence table;

b13) DNA molecule shown as SEQ ID No.1 in the sequence table;

b14) a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in b11) or b12) or b13) and encoding a malate dehydrogenase enzyme according to claim 1;

b15) a cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions with a nucleotide sequence defined in b11) or b12) or b13) or b14) and encodes a malate dehydrogenase enzyme as claimed in claim 1.

4. A method according to any one of claims 1-3, characterized in that: the recipient plant is M1) or M2) or M3):

m1) monocotyledonous or dicotyledonous plants;

m2) gramineous plants;

m3) maize.

5. Use of a malate dehydrogenase as claimed in claim 1 or of a substance which modulates the activity or content of a malate dehydrogenase as claimed in claim 1, in any one of the following applications:

D1) regulating and controlling the drought resistance of the plant;

D2) preparing a product for regulating and controlling the drought resistance of plants;

D3) the drought resistance of the plants is improved;

D4) preparing a product for improving the drought resistance of plants;

D5) cultivating drought-resistant improvement plants;

D6) preparing and cultivating plant products with improved drought resistance.

6. Use of a biomaterial according to claim 1 associated with malate dehydrogenase as any one of:

D1) regulating and controlling the drought resistance of the plant;

D2) preparing a product for regulating and controlling the drought resistance of plants;

D3) improving the drought resistance of the plants;

D4) preparing a product for improving the drought resistance of plants;

D5) cultivating drought-resistant improvement plants;

D6) preparing and cultivating drought-resistant plant products;

the biomaterial is any one of the following B1) to B7):

B1) a nucleic acid molecule encoding a malate dehydrogenase as claimed in claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) said nucleic acid molecule, or a recombinant microorganism containing B2) said expression cassette, or a recombinant microorganism containing B3) said recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing B1) the nucleic acid molecule or a transgenic plant organ containing B2) the expression cassette.

7. Use according to claim 6, characterized in that: B1) the nucleic acid molecule is b11) or b12) or b13) or b14) as follows:

b11) the coding sequence is cDNA molecule or DNA molecule of SEQ ID No.2 in the sequence table;

b12) a cDNA molecule or DNA molecule shown as SEQ ID No.2 in a sequence table;

b13) DNA molecule shown as SEQ ID No.1 in the sequence table;

b14) a cDNA molecule or a genomic DNA molecule having 75% or more identity with the nucleotide sequence defined by b11) or b12) or b13) and encoding the drought-resistant related protein as claimed in claim 1;

b15) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence defined by b11) or b12) or b13) or b14) under strict conditions and codes for the drought-resistant related protein in claim 1.

8. Use according to any one of claims 5 to 7, characterized in that: the plant is M1) or M2) or M3):

m1) monocotyledonous or dicotyledonous plants;

m2) gramineous plants;

m3) maize.

9. A malate dehydrogenase as claimed in claim 1.

10. The biomaterial of claim 6 or 7.

Images