CN114622021B - Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof - Google Patents
Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof Download PDFInfo
- Publication number
- CN114622021B CN114622021B CN202011459459.XA CN202011459459A CN114622021B CN 114622021 B CN114622021 B CN 114622021B CN 202011459459 A CN202011459459 A CN 202011459459A CN 114622021 B CN114622021 B CN 114622021B
- Authority
- CN
- China
- Prior art keywords
- detection
- seq
- nucleotide sequence
- sequence shown
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 153
- 244000052616 bacterial pathogen Species 0.000 title claims abstract description 23
- 238000000034 method Methods 0.000 claims abstract description 24
- 238000003908 quality control method Methods 0.000 claims abstract description 22
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 18
- 239000002773 nucleotide Substances 0.000 claims description 48
- 125000003729 nucleotide group Chemical group 0.000 claims description 48
- 238000006243 chemical reaction Methods 0.000 claims description 31
- 238000011144 upstream manufacturing Methods 0.000 claims description 24
- 230000001717 pathogenic effect Effects 0.000 claims description 19
- 230000003321 amplification Effects 0.000 claims description 18
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 18
- 241000191967 Staphylococcus aureus Species 0.000 claims description 17
- 239000003153 chemical reaction reagent Substances 0.000 claims description 17
- 244000052769 pathogen Species 0.000 claims description 16
- 241000588813 Alcaligenes faecalis Species 0.000 claims description 13
- 241000588747 Klebsiella pneumoniae Species 0.000 claims description 13
- 241000589517 Pseudomonas aeruginosa Species 0.000 claims description 13
- 241000191963 Staphylococcus epidermidis Species 0.000 claims description 13
- 241000122973 Stenotrophomonas maltophilia Species 0.000 claims description 13
- 229940005347 alcaligenes faecalis Drugs 0.000 claims description 13
- 241000588626 Acinetobacter baumannii Species 0.000 claims description 12
- 241000194031 Enterococcus faecium Species 0.000 claims description 12
- 241000193985 Streptococcus agalactiae Species 0.000 claims description 12
- 241000193996 Streptococcus pyogenes Species 0.000 claims description 12
- 239000013612 plasmid Substances 0.000 claims description 6
- 238000002360 preparation method Methods 0.000 claims description 6
- 238000012360 testing method Methods 0.000 claims description 6
- 241000588769 Proteus <enterobacteria> Species 0.000 claims description 5
- 239000000243 solution Substances 0.000 claims description 5
- 239000007984 Tris EDTA buffer Substances 0.000 claims description 4
- 238000000605 extraction Methods 0.000 claims description 4
- 238000007403 mPCR Methods 0.000 abstract description 16
- 239000012634 fragment Substances 0.000 abstract description 13
- 238000004458 analytical method Methods 0.000 abstract description 10
- 108020004707 nucleic acids Proteins 0.000 abstract description 10
- 102000039446 nucleic acids Human genes 0.000 abstract description 10
- 230000035945 sensitivity Effects 0.000 abstract description 10
- 230000008901 benefit Effects 0.000 abstract description 6
- 230000004907 flux Effects 0.000 abstract description 6
- 201000010099 disease Diseases 0.000 abstract description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 4
- 230000008569 process Effects 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 69
- 230000000052 comparative effect Effects 0.000 description 25
- 239000000523 sample Substances 0.000 description 20
- 241000588767 Proteus vulgaris Species 0.000 description 9
- 239000000203 mixture Substances 0.000 description 9
- 229940007042 proteus vulgaris Drugs 0.000 description 9
- 239000000047 product Substances 0.000 description 7
- 239000007795 chemical reaction product Substances 0.000 description 5
- 238000012136 culture method Methods 0.000 description 5
- 230000000694 effects Effects 0.000 description 5
- 208000015181 infectious disease Diseases 0.000 description 5
- 230000001580 bacterial effect Effects 0.000 description 4
- 238000000926 separation method Methods 0.000 description 4
- 238000012795 verification Methods 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 3
- 238000005251 capillar electrophoresis Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 244000005700 microbiome Species 0.000 description 3
- 238000012544 monitoring process Methods 0.000 description 3
- 208000035143 Bacterial infection Diseases 0.000 description 2
- 208000035473 Communicable disease Diseases 0.000 description 2
- 206010011409 Cross infection Diseases 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 208000022362 bacterial infectious disease Diseases 0.000 description 2
- 239000012295 chemical reaction liquid Substances 0.000 description 2
- 230000001351 cycling effect Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 2
- 230000036541 health Effects 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000008520 organization Effects 0.000 description 2
- 230000000405 serological effect Effects 0.000 description 2
- 206010003445 Ascites Diseases 0.000 description 1
- 241000193830 Bacillus <bacterium> Species 0.000 description 1
- 241000606124 Bacteroides fragilis Species 0.000 description 1
- 206010059866 Drug resistance Diseases 0.000 description 1
- 241000588697 Enterobacter cloacae Species 0.000 description 1
- 241000943303 Enterococcus faecalis ATCC 29212 Species 0.000 description 1
- 241001360526 Escherichia coli ATCC 25922 Species 0.000 description 1
- 241000606768 Haemophilus influenzae Species 0.000 description 1
- 206010048612 Hydrothorax Diseases 0.000 description 1
- 241000588915 Klebsiella aerogenes Species 0.000 description 1
- 241000588749 Klebsiella oxytoca Species 0.000 description 1
- 206010024971 Lower respiratory tract infections Diseases 0.000 description 1
- 239000012807 PCR reagent Substances 0.000 description 1
- 208000002193 Pain Diseases 0.000 description 1
- 206010036790 Productive cough Diseases 0.000 description 1
- 241000588770 Proteus mirabilis Species 0.000 description 1
- 241000607715 Serratia marcescens Species 0.000 description 1
- 241000193998 Streptococcus pneumoniae Species 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000004166 bioassay Methods 0.000 description 1
- 125000002091 cationic group Chemical group 0.000 description 1
- 210000001175 cerebrospinal fluid Anatomy 0.000 description 1
- 230000006957 competitive inhibition Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 230000009977 dual effect Effects 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 229940092559 enterobacter aerogenes Drugs 0.000 description 1
- 238000011841 epidemiological investigation Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 229940047650 haemophilus influenzae Drugs 0.000 description 1
- 230000008105 immune reaction Effects 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 239000002480 mineral oil Substances 0.000 description 1
- 235000010446 mineral oil Nutrition 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 230000036407 pain Effects 0.000 description 1
- 230000036961 partial effect Effects 0.000 description 1
- 239000013610 patient sample Substances 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000010206 sensitivity analysis Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 210000003802 sputum Anatomy 0.000 description 1
- 208000024794 sputum Diseases 0.000 description 1
- 229940031000 streptococcus pneumoniae Drugs 0.000 description 1
- 210000002700 urine Anatomy 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly relates to a kit and a detection method thereof suitable for simultaneously detecting eleven pathogenic bacteria. By adopting the technical scheme of the invention, eleven pathogenic bacteria can be detected and identified, and the method has the advantages of simple operation, accurate detection, high sensitivity and high specificity, obviously shortens the detection time and can realize the detection result within 2-3 hours. The internal reference of human DNA can ensure the quality control of nucleic acid in the detection process, and avoid the problem of false negative caused by disqualification of nucleic acid samples. The multiplex PCR and the fragment analysis method are combined, so that the detection flux is ensured, the cost is low, and the method is suitable for disease control centers, hospitals and other medical institutions.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a kit and a detection method thereof suitable for simultaneously detecting eleven pathogenic bacteria.
Background
According to world health organization (World Health Organization, WHO) statistics, the proportion of patients dying from infectious diseases worldwide to patients dying from diseases has reached 45%. In developing countries, infectious diseases lead to an increasing incidence and mortality. Due to the increasing international trade traffic and the global economic situation, various pathogenic bacteria resistant to drugs are widely spread worldwide. The incidence rate of community infection and hospital infection is high, and the death rate caused by infection is also high. The direct economic losses caused by hospital infection in different areas are greatly different, and the direct economic losses caused by lower respiratory tract infection are relatively large. The infection brings great physiological and psychological dual pains to patients and also causes great economic loss to society. According to the monitoring data of the Chinese bacterial drug resistance monitoring network, 249758 strains of bacteria are obtained by clinical separation of 27 provincial autonomous regions 36 trimethyl hospitals (30 comprehensive hospitals and 6 special children hospitals) in China in 2019, and bacterial infection conditions are not optimistic. Thus, timely diagnosis of bacterial infections is critical for their disease monitoring and effective treatment.
The currently commonly used method for detecting pathogenic bacteria mainly comprises the following steps: culture methods, serological assays, molecular biological assays, and the like. Culture methods are still currently the gold standard for pathogen diagnosis of bacteria and the like. However, this method has the following disadvantages: (1) complex and cumbersome operation: the workload is huge, and a large amount of manual operation is consumed; (2) a long period: generally, it takes 3 to 7 days or more; (3) low sensitivity: the detection positive rate is low and the requirement on a sample is high; (4) low detection efficiency: only a single pathogen can be cultivated, and the detection flux is low. The serological detection is carried out by utilizing the specific reaction principle of antigen and antibody, and the method has low sensitivity, only reflects the immune reaction condition of human body, but can not reflect the real infection condition of patients, can be only used for retrospective investigation, and has little significance for early diagnosis. The molecular biology method mainly detects pathogen specific target genes to identify pathogenic bacteria by a PCR method. Common detection methods include real-time fluorescent quantitative PCR, RT-PCR, and the like. Although the fluorescent PCR method has high specificity, sensitivity and timeliness, the following disadvantages also exist: (1) low flux: limited by the fluorescent channel, only a few pathogens can be detected at a time; (2) high cost: and multiple pathogens are detected simultaneously, so that the cost is high.
Therefore, development and operation are needed, the accuracy is high, the flux is high, the detection cost is low, and the detection technology for detecting various pathogenic bacteria aiming at the same sample is realized, so that the pathogenic bacteria can be rapidly and accurately detected, the detection efficiency can be greatly improved, the detection period is shortened, the detection cost is reduced, and the method has obvious economic and social benefits and is suitable for clinical detection, epidemic prevention, epidemiological investigation and the like.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention aims to provide a kit for detecting various pathogenic bacteria and a detection method thereof, wherein the kit has the advantages of strong specificity, high sensitivity, high flux, simple operation and low detection cost.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
in a first aspect of the invention, there is provided a detection reagent suitable for simultaneous detection of eleven pathogenic bacteria, the reagent comprising a staphylococcus aureus detection primer pair, a streptococcus pyogenes detection primer pair, a pseudomonas aeruginosa detection primer pair, an alcaligenes faecalis detection primer pair, a staphylococcus epidermidis detection primer pair, an enterococcus faecium detection primer pair, a proteus vulgaris detection primer pair, a stenotrophomonas maltophilia detection primer pair, a streptococcus agalactiae detection primer pair, a klebsiella pneumoniae detection primer pair, and an acinetobacter baumannii detection primer pair.
In one embodiment, the staphylococcus aureus detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2.
In one embodiment, the streptococcus pyogenes detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.3 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 4.
In one embodiment, the pseudomonas aeruginosa detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.5 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 6.
In one embodiment, the alcaligenes faecalis detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.7 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 8.
In one embodiment, the staphylococcus epidermidis detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.9 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 10.
In one embodiment, the enterococcus faecium detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.11 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 12.
In one embodiment, the general Proteus detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.13 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 14.
In one embodiment, the stenotrophomonas maltophilia detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.15 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 16.
In one embodiment, the streptococcus agalactiae detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.17 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 18.
In one embodiment, the klebsiella pneumoniae detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.19 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 20.
In one embodiment, the acinetobacter baumanii detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.21 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 22.
In a second aspect of the invention, there is provided the use of a detection reagent as described above for the preparation of a detection kit for simultaneous detection of eleven pathogenic bacteria.
In a third aspect of the present invention, there is provided a detection kit for simultaneously detecting eleven pathogenic bacteria, the kit comprising the detection reagent described above.
The kit of the invention adopts a multiplex PCR technology to detect eleven pathogenic bacteria simultaneously in a single tube, and can analyze and judge the infection conditions of staphylococcus aureus, streptococcus pyogenes, pseudomonas aeruginosa, alcaligenes faecalis, staphylococcus epidermidis, enterococcus faecium, general proteus, stenotrophomonas maltophilia, streptococcus agalactiae, klebsiella pneumoniae and acinetobacter baumannii according to the amplification and detection conditions. Thus, the design of the primers is critical to the kits of the invention.
The kit according to the invention is tested by multiplex PCR technology, so that the kit can also comprise other conventional reagents required for PCR, such as: master MIX, sample genome extraction reagents. Because the common PCR reagents can be purchased independently or configured by themselves through a market approach, which reagents are specifically required to be assembled into the kit can be configured according to the actual needs of customers, and the reagents can be assembled into the kit for convenience.
In the PCR reaction system during detection, the primer and the Master MIX are common components, and the content of the primer and the Master MIX is also conventional.
The PCR reaction system can be configured by itself, and can also be obtained by directly adding primers into commercial general PCR reaction liquid without the primers. For example, the PCR reaction system can be obtained by adding the primer and the sample to be detected in the Master MIX in the kit.
Further, the kit also comprises a human DNA internal reference amplification primer pair. The human DNA internal reference amplification primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.23 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 24.
Further, the kit may further comprise a positive quality control. The positive quality control product is pUC57 plasmid DNA containing target pathogen specific nucleic acid fragments and human internal reference specific nucleic acid fragments. Can be purchased separately or constructed by itself according to the prior art.
Further, the kit may further comprise a negative quality control. The negative quality control product is TE buffer solution. Either commercially available alone or self-configurable according to the prior art.
In a fourth aspect of the present invention, there is provided a method for using the aforementioned detection kit, comprising the steps of:
(1) Extracting genomic DNA of a sample;
(2) Sample adding: respectively adding sample genome DNA, positive quality control product or negative quality control product into PCR tubes filled with a PCR reaction system to obtain corresponding sample reaction tubes, positive reaction tubes or negative reaction tubes, wherein the PCR reaction system contains the detection primer pair;
(3) And (3) PCR reaction: the reaction tube is arranged on a PCR instrument, and circulation parameters are set for carrying out PCR reaction;
(4) After the completion of the PCR reaction, the results were analyzed.
In step (1), the genomic DNA of the sample is extracted as in the prior art.
Preferably, in step (3), the conditions of the PCR reaction are set as follows: cycling for 1 time at 98 ℃ for 10 min; 98℃for 10sec, 60℃for 10sec, 72℃for 30sec, and 35 cycles; cycling for 1 time at 72 ℃ for 5 min; 4 ℃ infinity cycle 1 time.
In a third aspect of the invention, there is provided the use of the aforementioned kit in the preparation of a pathogen detection product.
Compared with the prior art, the invention has the following beneficial effects:
by adopting the technical scheme of the invention, eleven pathogenic bacteria can be detected and identified, and the method has the advantages of simple operation, accurate detection, high sensitivity and high specificity, obviously shortens the detection time and can realize the detection result within 2-3 hours. The internal reference of human DNA can ensure the quality control of nucleic acid in the detection process, and avoid the problem of false negative caused by disqualification of nucleic acid samples. The multiplex PCR and the fragment analysis method are combined, so that the detection flux is ensured, the cost is low, and the method is suitable for disease control centers, hospitals and other medical institutions.
Drawings
FIG. 1 is a graph showing the results of capillary electrophoresis separation of Alcaligenes faecalis in an embodiment of the present invention.
FIG. 2 is a diagram showing the results of capillary electrophoresis separation of Proteus vulgaris in an embodiment of the present invention.
FIG. 3 is a graph showing the results of capillary electrophoresis separation of positive quality control according to an embodiment of the present invention.
FIG. 4 shows the results of the specific analysis in example 3 of the present invention.
FIG. 5 shows the amplification effect of primer set 1 in comparative example 2 of the present invention.
FIG. 6 shows the amplification effect of primer set 2 in comparative example 2 of the present invention.
FIG. 7 shows the amplification effect of primer set 3 in comparative example 2 of the present invention.
Detailed Description
Before the embodiments of the invention are explained in further detail, it is to be understood that the invention is not limited in its scope to the particular embodiments described below; it is also to be understood that the terminology used in the examples of the invention is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the invention.
Where numerical ranges are provided in the examples, it is understood that unless otherwise stated herein, both endpoints of each numerical range and any number between the two endpoints are significant both in the numerical range. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, materials used in the embodiments, any methods, devices, and materials of the prior art similar or equivalent to those described in the embodiments of the present invention may be used to practice the present invention according to the knowledge of one skilled in the art and the description of the present invention.
Example 1 preparation and methods of use of the kit
The nucleotide sequences of the staphylococcus aureus detection primer pair, the streptococcus pyogenes detection primer pair, the pseudomonas aeruginosa detection primer pair, the alcaligenes faecalis detection primer pair, the staphylococcus epidermidis detection primer pair, the enterococcus faecium detection primer pair, the proteus vulgaris detection primer pair, the stenotrophomonas maltophilia detection primer pair, the streptococcus agalactiae detection primer pair, the klebsiella pneumoniae detection primer pair and the acinetobacter baumannii detection primer pair are shown in the table 1 below. Each detection primer pair can be packaged independently or combined to prepare a multiplex PCR detection mixed solution. The amount of each primer pair in the multiplex PCR detection mixture may be a conventional amount known to those skilled in the art.
That is, the kit of the present invention may contain each set of the primer pairs packed independently, or may contain a multiplex PCR detection mixture containing each set of the primer pairs.
Further, the kit may further comprise a pair of human DNA internal reference amplification primers, the nucleotide sequences of which are shown in Table 1 below.
Further, the kit may further comprise a positive quality control. The positive quality control product is pUC57 plasmid DNA containing target pathogen specific nucleic acid fragments and human internal reference specific nucleic acid fragments.
Further, the kit may further comprise a negative quality control. The negative quality control product is TE buffer solution.
Further, the kit may further contain Master MIX, sample genome extraction reagents, and the like. The Master MIX is commercially available from Invitrogen corporation.
TABLE 1
Example 2 evaluation of detection Effect of kit
The embodiment of the invention provides a specific use mode of the kit, and each detection primer pair shown in the sequence in the table 1, a human DNA internal reference amplification primer pair and Master MIX purchased from Invitrogen are uniformly mixed to obtain a PCR reaction solution.
1. And collecting patient samples (samples such as sputum, urine, cerebrospinal fluid, hydrothorax, ascites, puncture fluid and the like), and extracting pathogenic bacteria DNA in the samples to obtain a DNA sample to be detected.
2. Preparation and detection of PCR reaction system
(1) Setting typesetting mode according to detection requirement, adding PCR reaction liquid into 8-joint tube or 96-well plate according to typesetting, adding 17.5 μl each well, sequentially adding 2.5 μl negative quality control (TE buffer), DNA sample to be detected and positive quality control (pUC 57 plasmid DNA containing target pathogen specific nucleic acid fragment and internal reference specific nucleic acid fragment) into the reaction well, and covering.
(2) Thoroughly mixed and centrifuged.
(3) The prepared reagent reacts.
3. Setting PCR program
(1) The PCR procedure was set up according to the instructions of the PCR apparatus, and the amplification conditions for the PCR reaction are shown in Table 2 below.
TABLE 2
(2) After the PCR amplification, the PCR amplification plate/tube was centrifuged briefly, and then the tube cap was carefully opened, sealed with mineral oil, and detected using a nucleic acid fragment analyzer.
4. Analysis of results
And judging the sample detection result by detecting the fragment size of the reaction product. The negative control should be free of reaction product fragments. Otherwise, the experimental result is invalid and the detection is repeated. In the cationic quality control detection reaction system, a reaction product fragment exists in the range of 75-80bp and shown in the table below, otherwise, the experimental result is invalid and detection is carried out again. For a sample detection reaction system, an internal reference reaction product fragment should exist within the range of 75-80bp, otherwise, the experimental result is invalid and the detection is carried out again. If the sample detection result is positive, judging the type of the infected pathogen according to the signal intensity of the reaction product and the size of the corresponding fragment. The whole detection procedure is about 2-3 hours.
Referring to the experimental detection data shown in fig. 1 to 3, the corresponding fragment size values for each pathogen are shown in table 3 below.
TABLE 3 Table 3
| Pathogen species | Fragment size |
| Staphylococcus aureus | 92-97bp |
| Streptococcus pyogenes | 128-134bp |
| Pseudomonas aeruginosa | 140-146bp |
| Alcaligenes faecalis | 160-165bp |
| Staphylococcus epidermidis | 182-190bp |
| Enterococcus faecium | 241-249bp |
| Proteus vulgaris | 272-279bp |
| Pseudomonas maltophilia | 291-300bp |
| Streptococcus agalactiae | 322-330bp |
| Klebsiella pneumoniae | 350-361bp |
| Acinetobacter baumannii | 380-393bp |
| Human DNA internal reference | 75-80bp |
Example 3 sensitivity and specificity analysis of the kit
Sensitivity analysis:
respectively subjecting nucleic acids of Staphylococcus aureus, streptococcus pyogenes, pseudomonas aeruginosa, alcaligenes faecalis, staphylococcus epidermidis, enterococcus faecium, proteus vulgaris, bacillus stenotrophomonas maltophilia, streptococcus agalactiae, klebsiella pneumoniae and Acinetobacter baumannii to gradient dilution at concentration of 1×10 6 copies/mL、1×10 5 copies/mL、1×10 4 copies/mL、1×10 3 copies/mL、1×10 2 The samples of 3-5 copies per gradient dilution were repeated with 10copies/mL, and multiplex PCR amplification and fragment analysis were performed using the same well-defined eleven pathogenic bacteria multiplex PCR detection system as in example 2 until no signal was detected, 20 repeated detections were performed per copy, at 90-95% positiveThe level of the detection rate is taken as the lowest detection lower Limit (LOD), namely the sensitivity.
The relevant pathogenic strains were as follows:
TABLE 4 Table 4
The detection sensitivity of the kit of the invention is shown in the following table:
TABLE 5
| Detection index | LOD(copies/mL) |
| Staphylococcus aureus | 1000 |
| Streptococcus pyogenes | 1000 |
| Pseudomonas aeruginosa | 100 |
| Alcaligenes faecalis | 1000 |
| Staphylococcus epidermidis | 100 |
| Enterococcus faecium | 100 |
| Proteus vulgaris | 100 |
| Pseudomonas maltophilia | 100 |
| Streptococcus agalactiae | 1000 |
| Klebsiella pneumoniae | 100 |
| Acinetobacter baumannii | 100 |
Specificity analysis:
the specificity of the detection method established by the invention mainly shows the specificity of the specific primer. The designed primers are subjected to blast comparison and analysis, have high conservation and specificity, and can specifically distinguish bacteria with similar species. In order to determine the specificity of the detection method, the following ten unrelated pathogenic strains are selected as simulated interference samples, all pathogenic strains are purchased from the Guangdong province microorganism strain collection center and the China medical culture collection center, the different pathogenic strains are detected after nucleic acid extraction, the concentration is 10 ng/mu L, the total nucleic acid of each sample obtained in the above is mixed with an equivalent amount of human internal reference plasmid (pUC 57) as a template for multiplex PCR amplification and fragment analysis, and the specificity of the primer design of the kit is verified.
The relevant pathogenic strains were as follows:
TABLE 6
| Pathogenic strain | Source |
| Streptococcus pneumoniae | ATCC49619 |
| Enterococcus faecalis | ATCC29212 |
| Proteus mirabilis (Fr.) Sing | CMCC49005 |
| Serratia marcescens | ATCC 8100 |
| Escherichia coli | ATCC25922 |
| Enterobacter cloacae | ATCC13047 |
| Enterobacter aerogenes | ATCC13048 |
| Haemophilus influenzae | ATCC49766 |
| Bacteroides fragilis (L.) pers | ATCC25285 |
| Klebsiella oxytoca | ATCC49131 |
As a result, as shown in FIG. 4, multiplex PCR and fragment analysis of total nucleic acids of ten unrelated pathogens with the same amount of the human internal reference plasmid (pUC 57) as a template can amplify only 75bp of the human internal reference band without other amplified bands. From the data, the detection results of the kit provided by the invention on the microorganisms are negative, and the fact that the kit provided by the invention has no cross reaction with other microorganisms is proved, so that the kit is high in pathogen detection specificity.
Example 4 application of the kit to clinical sample testing
1. Detection method
The 100 samples tested by the same reagent detection "gold standard" bacterial culture method in the embodiment 2 of the invention comprise 10 samples of staphylococcus aureus positive, 8 samples of streptococcus pyogenes positive, 5 samples of pseudomonas aeruginosa positive, 1 sample of alcaligenes faecalis positive, 5 samples of staphylococcus epidermidis positive, 5 samples of enterococcus faecium positive, 4 samples of general proteus positive, 5 samples of stenotrophomonas maltophilia positive, 6 samples of streptococcus agalactiae positive, 5 samples of klebsiella pneumoniae positive and 12 samples of acinetobacter baumannii positive.
2. Detection result
Compared with the bacterial culture method, the kit has the advantages of 100 percent of positive detection rate, high consistency, no detection omission, and statistically significant results. Compared with a gold standard bacterial culture method, the clinical sample detection kit has no obvious difference, but has obvious advantages in the aspects of multiple detection, short operation time, simple operation and the like.
Comparative example 1
Comparative primer sets 1-12 were prepared as in example 1, see Table 7 below.
The difference was only that the primers shown in SEQ ID NOS.1-2 in the primer set of example 1 were replaced with the primers shown in SEQ ID NOS.25-26 to obtain a comparative primer set 1. A comparative primer set 2 was obtained by replacing the primers shown in SEQ ID NOS.3-4 in the primer set of example 1 with the primers shown in SEQ ID NOS.27-28. A comparative primer set 3 was obtained by replacing the primers shown in SEQ ID NOS.5-6 in the primer set of example 1 with the primers shown in SEQ ID NOS.29-30. A comparative primer set 4 was obtained by replacing the primers shown in SEQ ID NOS.7-8 in the primer set of example 1 with the primers shown in SEQ ID NOS.31-32. A comparative primer set 5 was obtained by replacing the primers shown in SEQ ID NOS.9-10 in the primer set of example 1 with the primers shown in SEQ ID Ns.33-34. A comparative primer set 6 was obtained by replacing the primers shown in SEQ ID NOS.11-12 in the primer set of example 1 with the primers shown in SEQ ID NOS.35-36. A comparative primer set 7 was obtained by replacing the primers shown in SEQ ID NOS.13-14 in the primer set of example 1 with the primers shown in SEQ ID NOS.37-38. A comparative primer set 8 was obtained by replacing the primers shown in SEQ ID NOS.15-16 in the primer set of example 1 with the primers shown in SEQ ID NOS.39-40. A comparative primer set 9 was obtained by replacing the primers shown in SEQ ID NOS.17-18 in the primer set of example 1 with the primers shown in SEQ ID NOS.41-42. A comparative primer set 10 was obtained by replacing the primers shown in SEQ ID NOS.19-20 in the primer set of example 1 with the primers shown in SEQ ID NOS.43-44. A comparative primer set 11 was obtained by replacing the primers shown in SEQ ID NOS.21-22 in the primer set of example 1 with the primers shown in SEQ ID NOS.45-46. A comparative primer set 12 was obtained by replacing the primers shown in SEQ ID NOS.23-24 in the primer set of example 1 with the primers shown in SEQ ID NOS.47-48. A comparative primer set 13 was obtained by replacing the primers shown in SEQ ID NOS.1-24 in the primer set of example 1 with the primers shown in SEQ ID NOS.25-48.
Minimum detection limit verification the minimum detection limit verification was performed according to the method of example 3. The lowest limit of detection for example 3 compared with the comparative example is shown in table 8 below.
| Detection index | Example 3 LOD (copies/mL) | Comparative example, LOD (copies/mL) |
| Staphylococcus aureus | 1000 | 5000 |
| Streptococcus pyogenes | 1000 | 1000 |
| Pseudomonas aeruginosa | 100 | 1000 |
| Alcaligenes faecalis | 1000 | 1000 |
| Staphylococcus epidermidis | 100 | 1000 |
| Enterococcus faecium | 100 | 100 |
| Proteus vulgaris | 100 | 1000 |
| Pseudomonas maltophilia | 100 | 1000 |
| Streptococcus agalactiae | 1000 | 1000 |
| Klebsiella pneumoniae | 100 | 1000 |
| Acinetobacter baumannii | 100 | 100 |
As can be seen from Table 8, the kit of the present disclosure has a stronger detection ability than the comparative examples for trace amounts of nucleic acids of Staphylococcus aureus, pseudomonas aeruginosa, staphylococcus epidermidis, proteus vulgaris, pseudomonas maltophilia, klebsiella pneumoniae in the sample.
Specificity verification was performed according to the method of example 3. The results showed that the results of the reactions for the primer pairs of the comparative examples were all negative.
As can be seen from a comparison of example 3 and comparative example, the present disclosure can detect eleven pathogenic bacteria of Staphylococcus aureus, streptococcus pyogenes, pseudomonas aeruginosa, alcaligenes faecalis, staphylococcus epidermidis, enterococcus faecium, proteus vulgaris, pseudomonas maltophilia, streptococcus agalactiae, klebsiella pneumoniae, acinetobacter baumannii at one time, with high sensitivity, high specificity, lower minimum detection limit, and wider coverage.
Comparative example 2
The comparative example is exemplified by Staphylococcus aureus, and shows primers that were found to have an undesirable partial effect during the development process. Staphylococcus aureus primer sequences and screening: for the primer combination of 3 groups, the primer amplification effect is firstly screened by single PCR amplification, and the single detection result shows that the primer pair 3 has lower amplification efficiency, and the primer pairs 1 and 2 can basically meet the requirement of the subsequent experiment (shown in fig. 5-7) and need to be added into a multiplex PCR method for further verification. The primer pairs 1 and 2 are respectively added into a multiplex PCR system for amplification, and the detection results are as follows:
primer pair 1
F-1：AGCGATTGATGGTGATACGGT(SEQ ID NO.49)
R-1：TTTAGGATGCTTTGTTTCAGGTG(SEQ ID NO.50)
Primer pair 2
F-2：AGCGATTGATGGTGATACGGT(SEQ ID NO.51)
R-2：AGGATGCTTTGTTTCAGGTGT(SEQ ID NO.52)
Primer pair 3
F-3：AGCGATTGATGGTGATACTGT(SEQ ID NO.53)
R-3：TTTAGGATGTTTCGTTTCAGGCG(SEQ ID NO.54)
Primer pair 1 was added to multiplex PCR system detection results: the amplification efficiency of the primer pair staphylococcus aureus becomes low, and the primer pair is possibly reduced due to competitive inhibition with other primer pairs or primer dimer, so that the subsequent detection requirement is influenced. Primer pair 2 was added to multiplex PCR system detection results: the amplification efficiency of each pathogenic primer pair is not changed basically. From multiple aspects and comprehensive consideration, the primer pair 2 is selected as a primer pair of staphylococcus aureus in a multiplex PCR detection system, and the system is repeatedly verified to meet the detection requirement.
The above embodiments are merely illustrative of the principles of the present invention and its effectiveness, and are not intended to limit the invention. Modifications and variations may be made to the above-described embodiments by those skilled in the art without departing from the spirit and scope of the invention. Accordingly, it is intended that all equivalent modifications and variations of the invention be covered by the claims, which are within the ordinary skill of the art, be within the spirit and scope of the present disclosure.
Sequence listing
<110> Zhang Xianglin
<120> a kit suitable for simultaneous detection of eleven pathogenic bacteria and detection method thereof
<160> 54
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
agcgattgat ggtgatacgg t 21
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
aggatgcttt gtttcaggtg t 21
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tgaggacttg tcgagtgtct g 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
agaggaacct tctacctcca c 21
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cggagctgtc gtactcgaag 20
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
cgatgcttcc ggtgaaggt 19
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
cagctacgtt gtcgtcacct 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
ggtgtctttg ctcaggggtt 20
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
cgtatcacat aaccaacaga ca 22
<210> 10
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
attcagtgat tgcaagatcc aa 22
<210> 11
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
ggaattgaag cgcgcgaaa 19
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
aaaagaaatc gcaccggctc 20
<210> 13
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
ttaggcggtc cagccaaag 19
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
tccccaacaa cccagtgttt 20
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
tgatgtagtc caggtacggg t 21
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
tgcatcgacg cctacatcaa 20
<210> 17
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
gctcaagtta acgatgtaaa ggca 24
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
agtcgacagc atcacacgaa 20
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
aaagccggcg tgtacgataa 20
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
cactccacca cgcctttttc 20
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
tccaaatcac agcgcttcaa 20
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
gccataacca acacgcttca 20
<210> 23
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
ggggaggcaa ctaggatggt g 21
<210> 24
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
atggggacag gaccatattg agg 23
<210> 25
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
agcgattgat ggtgatacgg t 21
<210> 26
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
tttaggatgc tttgtttcag gtg 23
<210> 27
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
cgtttgttaa atcaggctga aa 22
<210> 28
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
ttgcggaaat ttgaggtaag a 21
<210> 29
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
aggtcggagc tgtcgtactc 20
<210> 30
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
gatgcttccg gtgaaggtg 19
<210> 31
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
tacgttgtcg tcacctacgc 20
<210> 32
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
ggtaggggtg tctttgctca 20
<210> 33
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 33
ttgcggaatc atggtactgt 20
<210> 34
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 34
cagttactct cacaggcaac tca 23
<210> 35
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 35
tcgagcaatc gttgaacaag 20
<210> 36
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 36
ctcaatccgc ttccacctaa 20
<210> 37
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 37
caggaatgac actggctgaa 20
<210> 38
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 38
tgttgacgct gagattgacc 20
<210> 39
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 39
tagtccaggt acgggtggta 20
<210> 40
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 40
cctacatcaa gggcaacct 19
<210> 41
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 41
tgctgtttga agtgctgctt 20
<210> 42
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 42
tcgcatttta gatccatttg c 21
<210> 43
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 43
aatgtgaatg cgggtatcgt 20
<210> 44
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 44
ctgaatacgt ttagtcaggt cg 22
<210> 45
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 45
aatccaaatc acagcgcttc 20
<210> 46
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 46
aaccaacacg cttcacttcc 20
<210> 47
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 47
ggggaggcaa ctaggatggt g 21
<210> 48
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 48
atggggacag gaccatattg agg 23
<210> 49
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 49
agcgattgat ggtgatacgg t 21
<210> 50
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 50
tttaggatgc tttgtttcag gtg 23
<210> 51
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 51
agcgattgat ggtgatacgg t 21
<210> 52
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 52
aggatgcttt gtttcaggtg t 21
<210> 53
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 53
agcgattgat ggtgatactg t 21
<210> 54
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 54
tttaggatgt ttcgtttcag gcg 23
Claims (9)
1. A detection reagent suitable for simultaneously detecting eleven pathogenic bacteria, wherein the reagent comprises a staphylococcus aureus detection primer pair, a streptococcus pyogenes detection primer pair, a pseudomonas aeruginosa detection primer pair, an alcaligenes faecalis detection primer pair, a staphylococcus epidermidis detection primer pair, an enterococcus faecium detection primer pair, a general proteus detection primer pair, a stenotrophomonas maltophilia detection primer pair, a streptococcus agalactiae detection primer pair, a klebsiella pneumoniae detection primer pair and an acinetobacter baumannii detection primer pair;
the detection reagent further includes any one or more of the following features: (1) The staphylococcus aureus detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2; (2) The streptococcus pyogenes detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.3 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 4; (3) The pseudomonas aeruginosa detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.5 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 6; (4) The alcaligenes faecalis detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.7 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 8; (5) The staphylococcus epidermidis detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.9 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 10; (6) The enterococcus faecium detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.11 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 12; (7) The general Proteus detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.13 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 14; (8) The stenotrophomonas maltophilia detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.15 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 16; (9) The streptococcus agalactiae detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.17 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 18; (10) The klebsiella pneumoniae detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.19 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 20; (11) The acinetobacter baumannii detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.21 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 22.
2. Use of a detection reagent according to claim 1 for the preparation of a detection kit for simultaneous detection of eleven pathogenic bacteria.
3. A test kit for simultaneous detection of eleven pathogenic bacteria, said kit comprising the test reagent of claim 1.
4. The test kit of claim 3, further comprising a pair of human DNA internal reference amplification primers.
5. The kit according to claim 4, wherein the human DNA internal reference amplification primer pair comprises an upstream primer having a nucleotide sequence shown in SEQ ID NO.23 and a downstream primer having a nucleotide sequence shown in SEQ ID NO. 24.
6. The test kit according to claim 3, wherein the kit further comprises any one or more of a positive quality control, a negative quality control, a universal PCR reaction solution, and a sample genome extraction reagent.
7. The test kit of claim 6, comprising any one or more of the following features: (1) The positive quality control product is pUC57 plasmid DNA containing target pathogen specific nucleic acid fragments and human internal reference specific nucleic acid fragments; the negative quality control product (2) is TE buffer solution.
8. The method of using a detection kit according to any one of claims 2 to 7 for non-diagnostic purposes, comprising the steps of:
(1) Extracting genomic DNA of a sample;
(2) Respectively adding sample genome DNA, positive quality control product or negative quality control product into PCR tubes filled with a PCR reaction system to obtain corresponding sample reaction tubes, positive reaction tubes or negative reaction tubes, wherein the PCR reaction system contains the detection primer pair in any one of claims 1-7;
(3) And (3) PCR reaction: the reaction tube is arranged on a PCR instrument, and circulation parameters are set for carrying out PCR reaction;
(4) After the completion of the PCR reaction, the results were analyzed.
9. The use of a detection kit according to any one of claims 2 to 7 for the preparation of a pathogen detection product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011459459.XA CN114622021B (en) | 2020-12-11 | 2020-12-11 | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011459459.XA CN114622021B (en) | 2020-12-11 | 2020-12-11 | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114622021A CN114622021A (en) | 2022-06-14 |
| CN114622021B true CN114622021B (en) | 2024-04-02 |
Family
ID=81895810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011459459.XA Active CN114622021B (en) | 2020-12-11 | 2020-12-11 | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114622021B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680081A (en) * | 2018-12-29 | 2019-04-26 | 深圳市刚竹医疗科技有限公司 | Detect the nucleic acid compositions of multiple pathogens, the application method of kit and kit |
| CN110564824A (en) * | 2019-08-22 | 2019-12-13 | 领航基因科技（杭州）有限公司 | Primer, probe combination and kit for detecting human pathogenic bacteria |
| CN110714090A (en) * | 2019-12-03 | 2020-01-21 | 郑州安图生物工程股份有限公司 | Kit for detecting free nucleic acid of blood stream infection pathogen in blood plasma |
| CN111088378A (en) * | 2020-01-09 | 2020-05-01 | 中国科学院大学宁波华美医院 | Primer probe system, kit and method for detecting common pathogenic bacteria of severe pneumonia |
-
2020
- 2020-12-11 CN CN202011459459.XA patent/CN114622021B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680081A (en) * | 2018-12-29 | 2019-04-26 | 深圳市刚竹医疗科技有限公司 | Detect the nucleic acid compositions of multiple pathogens, the application method of kit and kit |
| CN110564824A (en) * | 2019-08-22 | 2019-12-13 | 领航基因科技（杭州）有限公司 | Primer, probe combination and kit for detecting human pathogenic bacteria |
| CN110714090A (en) * | 2019-12-03 | 2020-01-21 | 郑州安图生物工程股份有限公司 | Kit for detecting free nucleic acid of blood stream infection pathogen in blood plasma |
| CN111088378A (en) * | 2020-01-09 | 2020-05-01 | 中国科学院大学宁波华美医院 | Primer probe system, kit and method for detecting common pathogenic bacteria of severe pneumonia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114622021A (en) | 2022-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107964565A (en) | A kind of nucleic acid mass spectrometry method for being used to detect 10 kinds of clinical infection encountered pathogenic bacterias | |
| CN113512602B (en) | Blood stream infection pathogen multiple gene detection system and kit and application thereof | |
| CN107245531B (en) | Diarrhea pathogen multiple gene detection system and kit and application thereof | |
| CN112941215B (en) | Urinary system fungus infection detection system, kit and application thereof | |
| CN102899414A (en) | Superbacterium gene NDM and KPC duplex fluorescence quantitative polymerase chain reaction (PCR) detection method and kit | |
| CN110669852A (en) | Kit for detecting high-toxicity non-mucus Klebsiella pneumoniae | |
| CN107523619A (en) | The PCR detection kit of drug-fast bacteria comprising mcr genes and its application | |
| CN111763767A (en) | Central nervous system infection pathogen detection kit and application thereof | |
| CN107083446B (en) | Diarrhea pathogenic bacteria multiple gene detection system and kit and application thereof | |
| CN101144775A (en) | Bacteria real-time fluorescence quantitative polymerase chain reaction detection reagent kit and its uses | |
| CN109355406B (en) | A kind of kit of the detection mycobacterium tuberculosis based on blood free nucleic acid | |
| Cao et al. | The preparation and clinical application of diagnostic DNA microarray for the detection of pathogens in intracranial bacterial and fungal infections | |
| CN114317786A (en) | Primer-probe combination for detecting 14 respiratory tract infection pathogenic bacteria, kit and application thereof | |
| CN114622021B (en) | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof | |
| Yang et al. | The application analysis of multiplex real-time polymerase chain reaction assays for detection of pathogenic bacterium in peritoneal dialysis-associated peritonitis | |
| CN110669853A (en) | Method for detecting toxicity of non-mucus type klebsiella pneumoniae | |
| CN115725754A (en) | Primer probe combination and kit for detecting three pneumonia pathogens | |
| CN103834741B (en) | A kind of without wound helicobacter pylori gene detecting kit and preparation and determination methods method thereof | |
| CN115873979A (en) | Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof | |
| CN102146467A (en) | Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis | |
| Wang et al. | Establishment and clinical application of a RPA-LFS assay for detection of capsulated and non-capsulated haemophilus influenzae | |
| CN108203738A (en) | A kind of kit for being used to detect 1 type of human T-cell lymphotropic virus | |
| CN107523620A (en) | PCR detection kit and its application comprising production NDM drug-fast bacterias | |
| CN114350846B (en) | Primer group and kit for combined detection of multiple pulmonary infection fungi | |
| CN117551798A (en) | PCR primer group and kit for combined detection of nine lower respiratory tract infection pathogens and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |