CN115725754A

CN115725754A - Primer probe combination and kit for detecting three pneumonia pathogens

Info

Publication number: CN115725754A
Application number: CN202210985729.3A
Authority: CN
Inventors: 麦艳娜; 李进福; 高利飞; 朱旭瑶; 郑业焕; 付光宇
Original assignee: Autobio Diagnostics Co Ltd
Current assignee: Autobio Diagnostics Co Ltd
Priority date: 2022-08-17
Filing date: 2022-08-17
Publication date: 2023-03-03

Abstract

The invention belongs to the technical field of biological detection, and particularly discloses a primer probe combination and a kit for detecting three pneumonia pathogens. The three pneumonia pathogens are pseudomonas aeruginosa, haemophilus influenzae and escherichia coli. The primer probe and the kit can simply, conveniently and quickly detect the infection of three pathogens of the pediatric bacterial pneumonia in parallel in one reaction tube, realize the detection of three bacteria by single-tube PCR, have high sensitivity, good specificity, short detection time and accurate and reliable result, greatly reduce the pain of patients, save social resources, avoid the drug resistance of pathogenic bacteria caused by overlarge pressure of antibacterial drugs, and have great clinical practicability.

Description

Primer probe combination and kit for detecting three pneumonia pathogens

Technical Field

The invention relates to the technical field of biological detection, in particular to a primer probe combination and a kit for detecting three pneumonia pathogens.

Background

The statistical results published by the world health organization in 2019 show that the lower respiratory tract infection in the ten causes of death in the world is the fourth position in the ranking. Currently, the lower respiratory tract infection is still one of the most common diseases in clinic, and is mainly caused by pathogenic bacteria such as bacteria, viruses, fungi and the like, wherein the bacterial infection is the most common and accounts for more than 80 percent. In recent years, the nosocomial infection of Pseudomonas Aeruginosa (PA) is particularly prominent, and particularly the incidence rate of pulmonary infection is increasing, and the Pseudomonas aeruginosa is one of the important pathogenic bacteria of nosocomial infection. Haemophilus Influenzae (HI), the most toxic of the common pathogenic bacteria causing community-acquired pneumonia in children, especially Haemophilus influenzae type b, has the greatest clinical infection cases. Escherichia coli (Escherichia co1i, ec) can cause urinary tract infection, respiratory tract infection, blood infection and wound infection, wherein respiratory tract infection and urinary tract infection are common, and the infection rate of Escherichia coli is on a trend of increasing year by year.

Since respiratory bacterial infection has basically the same symptoms and signs and is manifested as fever, cough, sneeze and the like, but treatment methods for different pathogens are very different, for example, the types of antibiotics required by different bacteria are very different, some bacteria can be self-healed, some bacteria can cause serious complications to endanger life, and some bacteria can even cause rapid spread and outbreak of serious respiratory infectious diseases, so that the determination of the types of infectious pathogens as soon as possible in clinical diagnosis and treatment is very critical, and the determination of the types of infectious pathogens as soon as possible is very important for taking specific treatment measures as soon as possible, reducing drug abuse, striving time for improving the cure rate and survival rate of patients, reducing social medical burden and expenditure, and even discovering and examining novel sudden respiratory infectious pathogens as soon as possible.

The conventional detection method, namely a bacteria isolation culture method, has the defects of harsh culture conditions, high difficulty, long time consumption and the like; the immunoassay method has the defects of low sensitivity or specificity, easy missed diagnosis and the like, and brings certain difficulty to clinical treatment. In recent years, the real-time fluorescence PCR technology has been the current main diagnostic means due to the characteristics of strong specificity, high sensitivity, simple operation, time saving and the like.

However, in current clinical practice, most of the pathogens are detected by using a single target, doctors usually examine and gradually remove pathogens with high possibility according to experience, but the method is long in time and high in cost, and the pain of patients is aggravated, and the optimal time for treatment is delayed. Therefore, many times doctors can only blindly and empirically administer drugs without clear etiology diagnosis, which causes drug abuse, increases the probability of toxic and side effects and pathogen resistance, causes medical resource waste, and is not beneficial to improving the curative effect.

For this reason, scholars at home and abroad have been dedicated to developing multi-target simultaneous detection technology for many years, but few products with similar technologies have been successful at present. The reason is that the existence of many pairs of primer probes in one reaction system can cause an unimaginable complex situation:

first, it is well known that if there are several consecutive bases of complementarity between primer probes, there is a high probability that the primers will bind to each other under the action of polymerase to produce amplification extension, resulting in a large number of non-specific false positive amplification products. Since all DNA consists of only four bases, the probability that three consecutive bases are identical to other sequences is 1/4 × 1/4=1/64, and obviously, as the number of primer probes increases, the probability that different sequences overlap or complement each other increases rapidly, or even almost inevitably, so that the primer probes used for single-target detection in the past are not suitable.

The solution to this problem is to redesign the primer probes so that the difference between the primer probe sequences of each target is as large as possible, so that no complementary regions are present. This, in turn, leads to a large difference in melting temperature (TM value) between the individual primer probes. It is well known that the TM value is related to the difference in the length of the DNA fragments and the G-C/A-T content, the G-C contributing more to the TM value than to the A-T. Based on the requirement of recognition ability and amplification specificity of polymerase, the length of primer probe is limited to a small range, such as 20 to 24 nucleotides, so that the ability to modulate TM value is limited; the difference of the composition of each primer probe sequence inevitably causes great difference of G-C/A-T content, so that the respective TM values are greatly different. However, as a general theory of PCR, the annealing/extension temperature can only obtain a good amplification efficiency and specificity when approaching to the TM value, so that the difference of the TM value will cause the amplification efficiency and specificity of different targets in the same reaction system (i.e. the same temperature cycle parameter) to be inconsistent, and even easily cause false positives of some targets while causing some targets to be missed.

In addition, for many pathogens, non-pathogenic bacteria which are very close to the pathogens in the category classification exist in the human body and the external environment, and a large number of homologous sequences exist in the pathogens and the external environment, which also brings trouble to the selection of specific primer probes.

In order to solve the technical problems, the inventor conducts research and practice for many years, and the research and practice comprises the steps of repeatedly screening a plurality of high-specificity sequences as primary candidate sequences in a mass of global known pathogen sequence libraries by using a big data and computer automatic retrieval technology, then analyzing the non-specific complementary condition among sequence combinations by using a unique computer software technology, simulating an amplification process, further screening more suitable secondary candidate sequences, manually synthesizing the sequences, performing a large amount of actual tests on actual pathogens and cross-interfering bacteria specimens which may exist in the actual pathogens, and finally screening the following sequences for use in the invention. Therefore, the primer probe combination included in the invention well overcomes the problems which cannot be solved by the prior art, has substantial technical creativity, and is unique, exclusive or even unique, and is not a simple combination of the existing single-target detection primer probes.

Nevertheless, the above preferred sequences still do not completely solve the problem faced.

Disclosure of Invention

In view of this, the invention provides a primer probe combination and a kit for detecting three pneumonia pathogens of infantile pneumonia, wherein the primer probe combination can realize rapid, accurate and sensitive identification of PA/HI/Ec; meanwhile, the kit containing the primer probe has the advantages of simple and rapid operation, stable storage at 2-8 ℃ and the like.

In order to achieve the above object, the present invention provides the following technical solutions:

a primer probe combination comprising:

detecting primer pairs shown as SEQ ID NO. 1-2 and probes shown as SEQ ID NO.3 of the pseudomonas aeruginosa;

detecting primer pairs shown in SEQ ID NO. 4-5 and probes shown in SEQ ID NO.6 of Haemophilus influenzae;

detecting a primer pair shown in SEQ ID NO. 7-8 and a probe shown in SEQ ID NO.9 of Escherichia coli.

The primer probe and the kit provided by the invention can be used for simply, conveniently and quickly detecting the infection of three pathogens of the pediatric bacterial pneumonia in parallel in one reaction tube, realize the detection of the three bacteria by single-tube PCR, and have the advantages of high sensitivity, good specificity, short detection time and accurate and reliable result.

In the invention, the segment amplified by the primer pair shown in SEQ ID NO. 1-2 is shown in SEQ ID NO. 13, and the segment is a conserved sequence OprD gene of pseudomonas aeruginosa. The segment amplified by the primer pair shown in SEQ ID NO. 4-5 is shown in SEQ ID NO. 14, and the segment is omp6 gene of Haemophilus influenzae. The segment amplified by the primer pair shown in SEQ ID NO. 7-8 is shown in SEQ ID NO. 15, and the segment is the ydiJ gene of Escherichia coli. The segment amplified by the primer pair shown in SEQ ID NO. 10-11 is shown in SEQ ID NO. 16, and the segment is a beta-globin gene.

In some embodiments, the primer probe combination further comprises:

detecting primer pairs shown as SEQ ID NO. 10-11 of the internal standard gene;

the probe shown in SEQ ID NO.12 for detecting the internal standard gene.

In the invention, the 5 'end of the probe is connected with a fluorescence reporter group, and the 3' end of the probe is connected with a quenching group. Specifically, the method comprises the following steps:

the 5' end of the probe shown as SEQ ID NO.3 is connected with FAM fluorophore;

the 5' end of the probe shown as SEQ ID NO.6 is connected with a ROX fluorescent group;

the 5' end of the probe shown as SEQ ID NO.9 is connected with a CY5 fluorophore;

the 5' end of the probe shown as SEQ ID NO.12 is connected with a HEX fluorescent group.

The invention also provides application of the primer probe combination in preparing a kit for detecting pseudomonas aeruginosa, haemophilus influenzae and/or escherichia coli.

The invention also provides a multiple PCR fluorescent detection kit for detecting pseudomonas aeruginosa, haemophilus influenzae and/or escherichia coli, which comprises the primer-probe combination.

The multiplex PCR fluorescence detection kit provided by the invention further comprises one or more of Tricine, KOAc, tween20, glycerol, DMSO, betaine, naN3, dNTPs, rTth enzyme, UDG enzyme, manganese acetate, naN3 and purified water.

In some embodiments, the kit provided herein comprises 1M/L Tricine, 10M/L KOAc, 10% Tween20, 80% glycerol, 100% DMSO, 25mM dNTPs, 5u/ul rTth enzyme, 2u/ul UDG enzyme, and 25mM manganese acetate.

The invention also provides a method for simultaneously detecting pseudomonas aeruginosa, haemophilus influenzae and escherichia coli, the multiplex PCR detection kit provided by the invention is used for carrying out Realtime PCR detection on a sample, and whether the pseudomonas aeruginosa, haemophilus influenzae or escherichia coli exists in the sample is judged according to the Ct value.

In some embodiments, the method of determining is:

the probe channels shown in SEQ ID NO.3, SEQ ID NO.6 and SEQ ID NO.9 have no fluorescence value, the CT value of the probe channel shown in SEQ ID NO.12 is less than or equal to 35, and the reported detection result is negative;

the CT value of the probe channel shown in SEQ ID NO.3 is less than or equal to 34, and the report shows that the probe channel is positive for pseudomonas aeruginosa;

the CT value of the probe channel shown in SEQ ID NO.6 is less than or equal to 34, and the probe channel is reported to be positive by Haemophilus influenzae;

SEQ ID No.9, CT value of the probe channel shown is less than or equal to 33, and the report shows that the Escherichia coli is positive;

the CT values of the probe channels shown in SEQ ID NO.3 are all more than or equal to 34, but the CT value of the probe channel shown in SEQ ID NO.12 is less than or equal to 35, and the concentration of the pseudomonas aeruginosa sample is reported to be lower than the lower detection limit; the CT values of the probe channels shown in SEQ ID NO.6 are all more than or equal to 34, but the CT value of the probe channel shown in SEQ ID NO.12 is less than or equal to 35, and the concentration of the sample of the haemophilus influenzae is reported to be lower than the lower detection limit; CT values of the probe channels shown in SEQ ID NO.9 are all more than or equal to 33, but CT values of the probe channels shown in SEQ ID NO.12 are less than or equal to 35, and the concentration of the Escherichia coli sample is reported to be lower than the lower detection limit;

when the CT value of the probe channel shown in SEQ ID NO.12 is more than or equal to 35, and any one of the negative control with the CT value or the typical S amplification curve, the positive control without the CT value or the amplification curve appears, the detection result is invalid, the reason should be searched and eliminated, and the test is repeated.

In some embodiments, the sample is sputum; the Real time PCR detection system comprises: 20uL of reaction solution 1, 10uL of reaction solution 2 and 50uL of sample nucleic acid;

the reaction solution 1 includes:

the reaction solution 2 includes:

in some embodiments, the Real time PCR detection procedure comprises:

the invention adjusts the specific components, the concentration and the parameters thereof in the reaction system through the optimization of the reaction system based on the sequence combination, thereby further ensuring the excellent performance of the detection. The concrete expression is as follows: the addition of DMSO and the proper specific concentration thereof adjust the thermal conductivity and the surface tension of the reaction solution so as to ensure the uniformity of the complex amplification reaction; betaine acts as a mild DNA denaturant at this concentration, which properly attenuates the difference in contribution of G-C and A-T to the TM value in the primer probe combinations described above, so that the TM values of these primer probes tend to be consistent, thereby facilitating consistent amplification efficiency and specificity of multiple target detection under the same amplification temperature cycle. In addition, as the rTth enzyme integrating two activities of reverse transcription and DNA polymerization, the conformation of the active site for nucleic acid recognition and replication has specificity, so that the effects of manganese ions, magnesium ions and potassium ions on activating the activity of the rTth enzyme are different, namely, the effects of the three on the reverse transcription, the DNA replication, the amplification specificity and the amplification efficiency are different. Therefore, the mixture ratio and the concentration of the primer probe are specially optimized in the invention, so that the characteristics are balanced in the primer probe combination. Meanwhile, the influence of the pH value of the reaction system on the amplification specificity and the amplification efficiency of different primer probes is different, and the primer probes are matched with the primer probe combination through specific optimization.

The primer probe combination provided by the invention comprises a specific primer pair and a probe aiming at pseudomonas aeruginosa/haemophilus influenzae/escherichia coli. The primer probe combination has good specificity, and can realize rapid, accurate and sensitive identification on PA/HI/Ec by combining with a real time PCR detection method. Experiments show that the lowest detection limit of PA/HI/Ec detection of the primer probe is 500copies/ml. In addition, the kit containing the primer and the probe provided by the invention has good stability, and the reagents stored at 2-8 ℃ for 3, 6, 9 and 12 months can realize stable detection on samples.

Drawings

FIG. 1 shows an amplification plot of Pseudomonas aeruginosa in example 5;

FIG. 2 is a diagram showing an amplification of Haemophilus influenzae in example 5;

FIG. 3 shows an amplification chart of Escherichia coli in example 5;

FIG. 4 is a graph showing the amplification of Pseudomonas aeruginosa in different concentrations in example 6, wherein FIG. 4a shows the results of detection using the kit of example 1 of the present invention, and FIG. 4b shows the results of detection using a control primer probe;

FIG. 5 is a graph showing the amplification of Haemophilus influenzae in samples of different concentrations in example 6, wherein FIG. 5a shows the results of detection using the kit of example 1 of the present invention, and FIG. 5b shows the results of detection using a control primer probe;

FIG. 6 is a graph showing the amplification of Escherichia coli in samples of different concentrations in example 6, wherein FIG. 6a shows the results of detection using the kit of example 1 of the present invention, and FIG. 6b shows the results of detection using a control primer probe.

Detailed Description

The invention provides a primer probe combination and a kit for detecting three pneumonia pathogens of infantile pneumonia, the invention provides a specific embodiment, and further illustrates the technical scheme of the invention, and the specific embodiment described herein is only used for explaining the invention and is not used for limiting the invention. It should be expressly noted that all such combinations, permutations and variations are contemplated by the present invention.

The consumable and the instrument of the invention are all common products on the market.

The invention is further illustrated by the following examples:

example 1 preparation of Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli nucleic acid assay kit

The sequences of the primers and the probes in the kit are shown in the following table 1:

TABLE 1 primer, probe sequences

	Name(s)	Nucleotide sequence
			PA upstream primer	SEQ ID NO：1	TTACTTGCGGCTGGCTTTT
PA downstream primer	SEQ ID NO：2	TGGGCGCTGCTCAGAAAG
			PA probe	SEQ ID NO：3	CAGGGCACGCTCGTTAGCCTCGT
HI upstream primer	SEQ ID NO：4	CTGGTGCAATGGCAGAAGTG
			HI downstream primer	SEQ ID NO：5	TTGTGCAAGTTCTTTTACCAACG
HI probe	SEQ ID NO：6	CGATGGTGTTGGCCCAGGTTGGTAT
			Ec upstream primer	SEQ ID NO：7	TTATTGCCGGGAAAAGTGTACG
Ec downstream primer	SEQ ID NO：8	GGTGATATCGTCCACCCAGGT
			Ec probe	SEQ ID NO：9	GCCGGGAATGGTGATTACCGACG
Internal standard upstream primer	SEQ ID NO：10	AAGGTGAAGGCTCATGGCAA
			Internal standard downstream primer	SEQ ID NO：11	TGCAGCTCACTCAGTGTGGC
Internal standard probe	SEQ ID NO：12	GGTTGTCCAGGTGAGCCAGGCCATC

The kit also comprises: tricine concentration 1M/L, KOAc concentration 10M/L, tween20 10%, glycerol 80%, DMSO 100%, dNTPs concentration 25mM, rTth enzyme concentration 5u/ul, UDG enzyme concentration 2u/ul, and manganese acetate concentration 25mM.

Example 2 detection method of the kit of the present invention

The detection method of the invention is real Time PCR, the real Time PCR reaction process is (1) pre-denaturation, the Time and the length depend on the length of a target nucleic acid and the composition of a base, the temperature of the pre-denaturation is generally 90-105 ℃, the Time is generally 2-10 min, and the purpose of the pre-denaturation is to completely separate a double-stranded nucleic acid sequence into single strands; (2) Denaturation at 91-105 deg.C for 10-35 s; (3) Annealing, annealing each primer to a target sequence of Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli or an internal standard nucleic acid. The annealing temperature is usually 40-60 deg.C, the annealing time can be 10-60 s (4) extension, the primer is combined with the template to begin to synthesize new DNA double chain, the extension temperature is usually 40-80 deg.C, and the extension time can be 10 s-1 min.

The composition of each assay system is shown in table 2:

TABLE 2

TABLE 3

Fluorescence detection channel selection: (1) Selecting a FAM channel (ReporTer: FAM, quencher: none), and detecting pseudomonas aeruginosa; (2) Selecting ROX channel (ReporTer: ROX, quencher: none), and detecting Haemophilus influenzae; (3) Selecting a CY5 channel (ReporTer: CY5, quencher: none), and detecting Escherichia coli; (4) selecting a HEX channel, and detecting an internal standard; (5) ReferenCe fluorescence (PAStive ReferenCe) is set to none. The fluorescent quantitative real-time reaction conditions are shown in table 4 below.

Table 4: fluorescent quantitative real-time PCR reaction condition

After the reaction is finished, the instrument automatically stores the result, automatically analyzes the initial value, the end value and the threshold value line value of the baseline by utilizing the software of the instrument or manually adjusts the initial value, the end value and the threshold value line value, and then records the CT value and the fixed value result of the sample. The specific test results were analyzed as follows:

SEQ ID No.6, CT value of the probe channel shown is less than or equal to 34, and the result is reported to be positive by Haemophilus influenzae;

CT values of the probe channels shown in SEQ ID NO.3 are all more than or equal to 34, but CT values of the probe channels shown in SEQ ID NO.12 are less than or equal to 35, and the concentration of the pseudomonas aeruginosa sample is reported to be lower than the lower detection limit; the CT values of the probe channels shown in SEQ ID NO.6 are all more than or equal to 34, but the CT value of the probe channel shown in SEQ ID NO.12 is less than or equal to 35, and the concentration of the sample of the haemophilus influenzae is reported to be lower than the lower detection limit; CT values of the probe channels shown in SEQ ID NO.9 are all more than or equal to 33, but CT values of the probe channels shown in SEQ ID NO.12 are less than or equal to 35, and the concentration of the Escherichia coli sample is reported to be lower than the lower detection limit;

EXAMPLE 3 feasibility test of the kit of the invention

1. Limit of detection (LOD) test

(1) Preparation of a pseudomonas aeruginosa/haemophilus influenzae/escherichia coli nucleic acid detection reagent: the pseudomonas aeruginosa/haemophilus influenzae/escherichia coli nucleic acid assay was prepared by using the method of example 1.

(2) Sample extraction

5 Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli sputum samples (treated by a sputum pretreatment reagent) with different concentrations in the tube were mixed by a pipette, and nucleic acid DNA was purified by using a nucleic acid extraction and purification reagent of Zhengzhou Antu bioengineering GmbH.

(3) Sample detection

50uL of the treated specimen supernatant (nucleic acid) was added to a reaction tube for detecting nucleic acid in Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli at a concentration of 21 wells, and 50uL of purified water was added to the detection solution as a negative control, and detection was performed according to the detection method of example 2.

(4) Analysis of results

By adopting the kit prepared in the embodiment 1 and the detection method in the embodiment 2 to detect samples with various concentration gradients of the pseudomonas aeruginosa/haemophilus influenzae/escherichia coli nucleic acid detection reagent, the detection sensitivity (LOD) of the detection method is 500copies/ml for all the pseudomonas aeruginosa/haemophilus influenzae/escherichia coli. Specific data are shown in tables 5, 6 and 7.

Table 5: pseudomonas aeruginosa detection limit confirmation

Sample concentration (copies/ml)	Detecting the number of repetitions	Number of positive tests	Rate of positive detection
				2000copies/ml	21	21	100％
500copies/ml	21	20	95.24％
				250copies/ml	21	12	57.14％
125copies/ml	21	8	38.10％
				20copies/ml	21	0	0

Table 6: haemophilus influenzae detection limit confirmation

TABLE 7 confirmation of detection limits of Escherichia coli

The sample is concentratedDegree (copies/ml)	Detecting the number of repetitions	Number of positive tests	Rate of positive detection
				2000copies/ml	21	21	100％
500copies/ml	21	20	95.24％
				250copies/ml	21	12	85.71％
125copies/ml	21	7	66.67％
				20copies/ml	21	0	0％

2. Cross-reactive conditions with other diseases

(1) The preparation of the pseudomonas aeruginosa/haemophilus influenzae/escherichia coli nucleic acid detection reagent, the pseudomonas aeruginosa/haemophilus influenzae/escherichia coli nucleic acid detection reagent was prepared by the method of example 1.

(2) Cross pathogen sample extraction: a sputum sample containing enterococcus faecium, serratia marcescens, staphylococcus epidermidis, candida tropicalis, candida krusei, enterococcus faecalis, candida albicans, klebsiella oxytoca, streptococcus pyogenes, candida glabrata, proteus mirabilis, streptococcus agalactiae, enterobacter cloacae, candida parapsilosis, neisseria meningitidis, micrococcus luteus, rhodococcus equi, haemophilus parainfluenza, pseudomonas fluorescens, aeromonas hydrophila, streptococcus pneumoniae, legionella pneumophila, moraxella catarrhalis, staphylococcus aureus, methicillin-resistant Staphylococcus aureus, klebsiella pneumoniae, human metapneumovirus, influenza A virus, influenza B virus, syncytial virus, mycoplasma pneumoniae, chlamydia pneumoniae, adenovirus, methicone-resistant Staphylococcus aureus, acinetobacter baumannii, stenotrophomonas maltophilia, and Burkholderia cepacia in a tube was mixed by a pipette, and nucleic acid DNA was purified by using a nucleic acid extraction and purification reagent of Zhengzheng Hill organism.

(3) And (3) sample detection, namely adding 50uL of treated sample supernatant (nucleic acid) into a pseudomonas aeruginosa/haemophilus influenzae/escherichia coli nucleic acid detection reaction tube, simultaneously adding 50uL of purified water into a detection solution to serve as a negative control, extracting pseudomonas aeruginosa/haemophilus influenzae/escherichia coli to serve as a positive control test, and detecting according to the detection method in example 2.

(4) And (4) analyzing results: by using the kit prepared in example 1 and the detection method of example 2 to detect other pathogens than Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli, the results show that: the kit disclosed by the invention has no cross reaction on a pseudomonas aeruginosa/haemophilus influenzae/escherichia coli positive control and negative control, and has a high specificity as shown in a Hall test sample, wherein the positive control is positive and the negative control is negative, and the enterococcus faecium, serratia marcescens, staphylococcus epidermidis, candida tropicalis, candida krusei, enterococcus faecalis, candida albicans, klebsiella oxytoca, streptococcus pyogenes, candida glabrata, proteus mirabilis, streptococcus agalactiae, enterobacter cloacae, candida parapsilosis, neisseria meningitidis, micrococcus tenuis, rhodococcus equi, haemophilus parainfluenza, pseudomonas fluorescens, aeromonas hydrophila, streptococcus pneumoniae, legionella pneumophila, moraxella catarrhalis, staphylococcus aureus, methicillin-resistant staphylococcus aureus, klebsiella pneumoniae, human metapneumovirus, influenza a virus, influenza b virus, syncytial virus, mycoplasma pneumoniae, adenovirus, methicillin-resistant staphylococcus aureus, pseudomonas aeruginosa, stenotrophomonas maltophilia, and a pathogen infection of the sample.

Table 8: cross reaction experiment

3. Interference immunity

(1) Preparation of a nucleic acid detection reagent for pseudomonas aeruginosa/haemophilus influenzae/escherichia coli: the preparation method comprises the steps of preparing a reagent for detecting nucleic acid of pseudomonas aeruginosa/haemophilus influenzae/escherichia coli by adopting the method of example 1.

(2) Sample processing

Selecting a pseudomonas aeruginosa/haemophilus influenzae/escherichia coli mixed detection limit concentration sample, adding an interfering substance into the bacterial sample at the peak concentration (Cmax) of 3 times, processing the sample by adopting the cross reaction method in the example 3, and detecting according to the detection method in the example 2.

(3) Analysis of results

Experiments show that when a sample contains mucin, blood, sodium chloride, dexamethasone, histamine hydrochloride, menthol, oseltamivir, mupirocin and tobramycin, the detection sensitivity of the kit provided by the invention is not interfered, and the details are shown in Table 9.

Table 9: anti-interference experiment of exogenous substance

Name of drug	The result of the detection
		Mucins	Positive for
Blood, blood-activating agent and blood-activating agent	Positive for
		Sodium chloride	Positive for
Dexamethasone	Positive for
		Histamine hydrochloride	Positive for
Menthol crystal	Positive for
		Oseltamivir	Positive for
Mupirocin A	Positive for
		Tobramycin	Positive for

Example 4 stability assessment at 2-8 ℃ with the kit of the invention

1. Accelerated stability test

(1) Preparation of a nucleic acid detection reagent for pseudomonas aeruginosa/haemophilus influenzae/escherichia coli: pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli nucleic acid assay was prepared by using the method of example 1.

(2) Sample extraction

The sputum sample of the pseudomonas aeruginosa/haemophilus influenzae/escherichia coli with the detection limit concentration in the tube is mixed evenly by a pipette, and the nucleic acid DNA is purified by utilizing the nucleic acid extraction and purification reagent of Zhengzhou AnTu bioengineering GmbH.

(3) Sample detection

50uL of the supernatant of the specimen (i.e., the nucleic acid in the specimen) obtained by extraction was added to a reaction tube containing a reagent for detecting nucleic acid in Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli at 37 ℃ for 7, 14, and 21 days, and 20 positive specimens per target were added to the test solution as a negative control, and then the test was carried out according to the test method described in example 2.

(4) Analysis of results

Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli nucleic acid test reagents accelerated at 37 ℃ for 7, 14, and 21 days were tested by using the kit prepared in example 1 and the test method of example 2, with the data shown in Table 10.

Table 10: accelerated stability test

Acceleration (37 ℃) of the time (d)	Detecting the condition
		7	Stably detect out
14	Stable detection
		21	Stably detect out

2. Real time stability test

(1) Preparation of a pseudomonas aeruginosa/haemophilus influenzae/escherichia coli nucleic acid detection reagent: pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli nucleic acid assay was prepared by using the method of example 1.

(2) Sample extraction

(3) Sample testing

50uL of the treated specimen supernatant (nucleic acid) is added into a reaction tube of a nucleic acid detection reagent for detecting pseudomonas aeruginosa/haemophilus influenzae/escherichia coli which is transported at 2-8 ℃ for 7 days and stored at 2-8 ℃ for 3, 6, 9 and 12 months, 20 positive samples of each target are added, and 50uL of purified water is added into a detection solution to be used as a negative control, and the detection is carried out according to the detection method in the example 2.

(4) Analysis of results

The nucleic acid detection reagent for Pseudomonas aeruginosa/Haemophilus influenzae/Escherichia coli, which was transported at 2-8 ℃ for 7 days and stored at 2-8 ℃ for 3, 6, 9, 12 months, was tested by using the kit prepared in example 1 and the test method of example 2, and the data are shown in Table 11.

Table 11: real time stability test

Acceleration (2-8 ℃) of the time (mouth)	Detecting the situation
		3	Stable detection
6	Stable detection
		9	Stable detection
12	Stable detection

Example 5 negative-positive clinical sample compliance rate validation

The collected clinical samples are verified by adopting the qualified quality test kit. The nucleic acid of 10 clinical positive samples and 20 negative samples of pseudomonas aeruginosa, haemophilus influenzae and escherichia coli are verified, and negative and positive quality control substance controls are set to ensure that the detection result of the kit is credible, and the result shows that the negative and positive coincidence rate of the clinical samples is 100%. Specific data are shown in fig. 1, fig. 2 and fig. 3. The detection result of the kit is as follows:

table 12: clinical negative and positive coincidence rate test

Sample name	The result of the detection	Positive channel	Inner mark out condition
				Pseudomonas aeruginosa	Positive for	FAM	Positive for
Haemophilus influenzae (HlH)	Positive for	ROX	Positive for
				Escherichia coli	Positive for	CY5	Positive for
Negative sample	Negative of	Is composed of	Positive for

EXAMPLE 6 comparative test for sensitivity detection

Preparing reaction solution 1 and reaction solution 2, mixing, preparing systems with primer probes corresponding to other bacteria (see Table 13), and adding 50uL of sample nucleic acid corresponding to each system, wherein the concentration of the sample nucleic acid is 5 × 10 ⁶ copies/ml、5×10 ⁴ copies/ml、5×10 ³ copies/ml、5×10 ² The copies/ml are tested together on a machine. The results are shown in FIGS. 4 to 6, in which FIGS. 4a, 5a and 6a are the results of detection using the kit of example 1 of the present invention, and FIGS. 4b, 5b and 6b are the results of detection using the control primer probe.

TABLE 13 control primer, probe sequences

	Nucleotide sequence
		Control PA upstream primer	CCAGAGCTTCGTCAGCCTTG
Control PA downstream primer	AGCAGCCACTCCAAAGAAACC
		Control PA probes	TCTGACCGCTACCGAAGACGCAGC
Control HI upstream primer	CGTGCAGATGCAGTTAAAGGTTAT
		Control HI downstream primer	TGCAGGTTTTTCTTCACCGTAAG
Control HI Probe	CTGGTAAAGGTGTTGATGCTGGTAAATTAGGCAC
		Control Ec upstream primer	CCGTCTGGTCGAAAAATTAGGT
Control Ec downstream primer	ATATGCTGGGCTTTGCCATT
		Control Ec Probe	CCAGCCTGTGTTACTGCCATTTTCGC

The results are shownAs shown, 3 bacteria were detected with the system of the present invention at 4 gradient concentrations, and the system with other primer probes was at 5X 10 ² The primers/ml can not be detected, the effect is far lower than the detection effect of the invention, and the detection sensitivity of the invention is higher than that of other primer probes.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Claims

1. A primer probe combination, comprising:

detecting a primer pair shown in SEQ ID NO. 4-5 and a probe shown in SEQ ID NO.6 of Haemophilus influenzae;

2. The primer probe combination of claim 1, further comprising:

detecting primer pairs shown as SEQ ID NO. 10-11 of the internal standard gene;

the probe shown in SEQ ID NO.12 for detecting the internal standard gene.

3. The primer probe combination of claim 1 or 2, wherein the probe is linked to a fluorescent reporter at the 5 'end and a quencher at the 3' end.

4. The primer probe combination of claim 3, wherein the 5' end of the probe shown in SEQ ID No.3 is connected with FAM fluorophore;

5. Use of the primer probe combination of any one of claims 1 to 4 for the preparation of a kit for detecting Pseudomonas aeruginosa, haemophilus influenzae and/or Escherichia coli.

6. A kit for detecting pseudomonas aeruginosa, haemophilus influenzae and/or escherichia coli, comprising the primer-probe combination of claim 1 or 2.

7. The kit of claim 6, further comprising one or more of Tricine, KOAc, tween20, glycerol, DMSO, betaine, naN3, dNTPs, rTth enzyme, UDG enzyme, manganese acetate, naN3, and purified water.

8. The method for simultaneously detecting pseudomonas aeruginosa, haemophilus influenzae and escherichia coli for non-diagnostic purposes is characterized in that the kit of claim 6 or 7 is used for carrying out Real time PCR detection on a sample, and whether the pseudomonas aeruginosa, haemophilus influenzae or escherichia coli exists in the sample is judged according to a fluorescence signal.

9. The method of claim 8, wherein the sample is sputum; the Real time PCR detection system comprises: 20uL of reaction solution 1, 10uL of reaction solution 2, and 50uL of sample nucleic acid;

the reaction solution 1 includes:

the reaction solution 2 includes:

10. the method of claim 8, wherein the Real time PCR detection procedure comprises: