CN114622021A - Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof - Google Patents
Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof Download PDFInfo
- Publication number
- CN114622021A CN114622021A CN202011459459.XA CN202011459459A CN114622021A CN 114622021 A CN114622021 A CN 114622021A CN 202011459459 A CN202011459459 A CN 202011459459A CN 114622021 A CN114622021 A CN 114622021A
- Authority
- CN
- China
- Prior art keywords
- detection
- seq
- nucleotide sequence
- primer
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 148
- 244000052616 bacterial pathogen Species 0.000 title claims abstract description 21
- 238000000034 method Methods 0.000 claims abstract description 21
- 238000003908 quality control method Methods 0.000 claims abstract description 21
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 18
- 239000002773 nucleotide Substances 0.000 claims description 49
- 125000003729 nucleotide group Chemical group 0.000 claims description 49
- 238000011144 upstream manufacturing Methods 0.000 claims description 24
- 241000191967 Staphylococcus aureus Species 0.000 claims description 19
- 244000052769 pathogen Species 0.000 claims description 18
- 230000001717 pathogenic effect Effects 0.000 claims description 18
- 230000003321 amplification Effects 0.000 claims description 16
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 16
- 239000003153 chemical reaction reagent Substances 0.000 claims description 14
- 241000588813 Alcaligenes faecalis Species 0.000 claims description 13
- 241000588747 Klebsiella pneumoniae Species 0.000 claims description 13
- 241000589517 Pseudomonas aeruginosa Species 0.000 claims description 13
- 241000191963 Staphylococcus epidermidis Species 0.000 claims description 13
- 241000122973 Stenotrophomonas maltophilia Species 0.000 claims description 13
- 229940005347 alcaligenes faecalis Drugs 0.000 claims description 13
- 241000588626 Acinetobacter baumannii Species 0.000 claims description 12
- 241000194031 Enterococcus faecium Species 0.000 claims description 12
- 241000193985 Streptococcus agalactiae Species 0.000 claims description 12
- 241000193996 Streptococcus pyogenes Species 0.000 claims description 12
- 239000000243 solution Substances 0.000 claims description 7
- 239000013612 plasmid Substances 0.000 claims description 6
- 241000240376 Proteus anguinus Species 0.000 claims description 5
- 239000000463 material Substances 0.000 claims description 5
- 241000208340 Araliaceae Species 0.000 claims description 4
- 235000005035 Panax pseudoginseng ssp. pseudoginseng Nutrition 0.000 claims description 4
- 235000003140 Panax quinquefolius Nutrition 0.000 claims description 4
- 239000007984 Tris EDTA buffer Substances 0.000 claims description 4
- 238000000605 extraction Methods 0.000 claims description 4
- 235000008434 ginseng Nutrition 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 4
- 238000012360 testing method Methods 0.000 claims description 3
- 239000012634 fragment Substances 0.000 abstract description 13
- 238000007403 mPCR Methods 0.000 abstract description 12
- 108020004707 nucleic acids Proteins 0.000 abstract description 10
- 102000039446 nucleic acids Human genes 0.000 abstract description 10
- 230000035945 sensitivity Effects 0.000 abstract description 10
- 238000004458 analytical method Methods 0.000 abstract description 9
- 230000008901 benefit Effects 0.000 abstract description 7
- 230000004907 flux Effects 0.000 abstract description 6
- 230000008569 process Effects 0.000 abstract description 4
- 201000010099 disease Diseases 0.000 abstract description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 69
- 230000000052 comparative effect Effects 0.000 description 24
- 239000000523 sample Substances 0.000 description 20
- 239000000047 product Substances 0.000 description 11
- 229940007042 proteus vulgaris Drugs 0.000 description 10
- 241000588767 Proteus vulgaris Species 0.000 description 9
- 239000000203 mixture Substances 0.000 description 9
- 238000012408 PCR amplification Methods 0.000 description 6
- 230000000694 effects Effects 0.000 description 6
- 230000001580 bacterial effect Effects 0.000 description 5
- 239000007795 chemical reaction product Substances 0.000 description 5
- 238000012136 culture method Methods 0.000 description 5
- 208000015181 infectious disease Diseases 0.000 description 5
- 238000012795 verification Methods 0.000 description 5
- 238000000926 separation method Methods 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- 238000005251 capillar electrophoresis Methods 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 3
- 238000012544 monitoring process Methods 0.000 description 3
- 208000035473 Communicable disease Diseases 0.000 description 2
- 206010011409 Cross infection Diseases 0.000 description 2
- 208000022362 bacterial infectious disease Diseases 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 244000005700 microbiome Species 0.000 description 2
- 230000000405 serological effect Effects 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 206010003445 Ascites Diseases 0.000 description 1
- 208000035143 Bacterial infection Diseases 0.000 description 1
- 241000423333 Bacteroides fragilis NCTC 9343 Species 0.000 description 1
- 206010059866 Drug resistance Diseases 0.000 description 1
- 241000588697 Enterobacter cloacae Species 0.000 description 1
- 241000943303 Enterococcus faecalis ATCC 29212 Species 0.000 description 1
- 241001360526 Escherichia coli ATCC 25922 Species 0.000 description 1
- 241000606768 Haemophilus influenzae Species 0.000 description 1
- 206010048612 Hydrothorax Diseases 0.000 description 1
- 241000588748 Klebsiella Species 0.000 description 1
- 241000588915 Klebsiella aerogenes Species 0.000 description 1
- 206010024971 Lower respiratory tract infections Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 239000012807 PCR reagent Substances 0.000 description 1
- 208000002193 Pain Diseases 0.000 description 1
- 206010036790 Productive cough Diseases 0.000 description 1
- 241000588770 Proteus mirabilis Species 0.000 description 1
- 241000607715 Serratia marcescens Species 0.000 description 1
- 241000193998 Streptococcus pneumoniae Species 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000001175 cerebrospinal fluid Anatomy 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 230000001351 cycling effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 229940092559 enterobacter aerogenes Drugs 0.000 description 1
- 238000011841 epidemiological investigation Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 229940047650 haemophilus influenzae Drugs 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000008105 immune reaction Effects 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 230000000813 microbial effect Effects 0.000 description 1
- 239000002480 mineral oil Substances 0.000 description 1
- 235000010446 mineral oil Nutrition 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 230000036407 pain Effects 0.000 description 1
- 239000013610 patient sample Substances 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000007789 sealing Methods 0.000 description 1
- 238000010206 sensitivity analysis Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 210000003802 sputum Anatomy 0.000 description 1
- 208000024794 sputum Diseases 0.000 description 1
- 229940031000 streptococcus pneumoniae Drugs 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 210000002700 urine Anatomy 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention belongs to the technical field of biology, and particularly relates to a kit suitable for simultaneously detecting eleven pathogenic bacteria and a detection method thereof. By adopting the technical scheme of the invention, eleven pathogenic bacteria can be detected and identified, the method has the advantages of simple operation, accurate detection, high sensitivity and high specificity, the detection time is obviously shortened, and the detection result can be obtained within 2-3 hours. The human DNA internal reference can ensure the quality control of nucleic acid in the detection process, and avoid the problem of false negative caused by disqualified nucleic acid samples. The combination of multiplex PCR and fragment analysis ensures the detection flux and has lower cost, and is suitable for disease control centers, hospitals and other medical institutions.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a kit suitable for simultaneously detecting eleven pathogenic bacteria and a detection method thereof.
Background
According to the World Health Organization (WHO) statistical data, the proportion of patients WHO die due to infectious diseases worldwide has reached 45%. Infectious diseases lead to an increasing morbidity and mortality in developing countries. Due to the increasing international trade and the global situation of economy, various drug-resistant pathogenic bacteria are widely spread worldwide. The population of China is large, the morbidity of community infection and hospital infection is high, and the mortality rate caused by the infection is high. The direct economic loss caused by hospital infection in different areas is greatly different, and the direct economic loss caused by lower respiratory tract infection is larger. Infection brings great physiological and psychological pains to patients and also causes great economic loss to society. According to the monitoring data of the Chinese bacterial drug resistance monitoring network, 249758 bacterial strains are obtained by clinical separation of 36 hospitals (30 comprehensive hospitals and 6 children special hospitals) in 27 provincial and municipal municipalities in 2019, and the bacterial infection condition is not optimistic. Therefore, the timely diagnosis of bacterial infectious diseases is critical to their disease monitoring and effective treatment.
The currently common pathogen detection methods mainly include the following: culture method, serological detection, molecular biological detection method, etc. The culture method is still the gold standard for diagnosing pathogens such as bacteria and the like at present. However, this method has the following disadvantages: (1) the operation is complicated and fussy: the workload is huge, and a large amount of manual operation is consumed; (2) the cycle length is as follows: generally 3-7 days or longer; (3) the sensitivity is low: the detection positive rate is low and the requirement on a sample is high; (4) the detection efficiency is low: only single pathogen can be cultured, and the detection flux is low. The serological detection is carried out by utilizing the specific reaction principle of an antigen and an antibody, and the method has low sensitivity, only reflects the immune reaction condition of a human body, but cannot reflect the real infection condition of a patient, can be only used for retrospective investigation, but has little significance for early diagnosis. The molecular biology method is mainly to detect pathogen-specific target genes by a PCR method to identify pathogenic bacteria. Commonly used detection methods include real-time fluorescent quantitative PCR, RT-PCR, and the like. Although the fluorescent PCR method has high specificity, sensitivity and timeliness, it has the following disadvantages: (1) the flux is low: limited by fluorescent channels, only a few pathogens can be detected at a time; (2) the cost is high: and multiple pathogens are detected simultaneously, so the cost is high.
Therefore, it is urgently needed to develop a detection technology which is simple in operation, high in accuracy, high in flux and low in detection cost, can detect various pathogenic bacteria aiming at the same sample, can quickly and accurately detect the pathogenic bacteria, can greatly improve the detection efficiency, shorten the detection period and reduce the detection cost, has remarkable economic and social benefits, and is suitable for clinical detection, epidemic prevention, epidemiological investigation and the like.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to provide a kit for detecting various pathogenic bacteria and a detection method thereof, wherein the kit has the advantages of strong specificity, high sensitivity, high flux, simple operation and low detection cost.
In order to achieve the purpose, the invention adopts the following technical scheme:
the reagent comprises a staphylococcus aureus detection primer pair, a streptococcus pyogenes detection primer pair, a pseudomonas aeruginosa detection primer pair, an alcaligenes faecalis detection primer pair, a staphylococcus epidermidis detection primer pair, an enterococcus faecium detection primer pair, a common proteus vulgaris detection primer pair, a stenotrophomonas maltophilia detection primer pair, a streptococcus agalactiae detection primer pair, a klebsiella pneumoniae detection primer pair and an acinetobacter baumannii detection primer pair.
In one embodiment, the staphylococcus aureus detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.1 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 2.
In one embodiment, the Streptococcus pyogenes detection primer pair includes an upstream primer having a nucleotide sequence shown in SEQ ID No.3 and a downstream primer having a nucleotide sequence shown in SEQ ID No. 4.
In one embodiment, the primer pair for detecting pseudomonas aeruginosa comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.5 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 6.
In one embodiment, the pair of primers for detecting Alcaligenes faecalis comprises an upstream primer having a nucleotide sequence shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence shown in SEQ ID NO. 8.
In one embodiment, the Staphylococcus epidermidis detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.9 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 10.
In one embodiment, the enterococcus faecium detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.11 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 12.
In one embodiment, the primer pair for detecting Proteus vulgaris comprises an upstream primer having a nucleotide sequence shown as SEQ ID No.13 and a downstream primer having a nucleotide sequence shown as SEQ ID No. 14.
In one embodiment, the stenotrophomonas maltophilia detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.15 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 16.
In one embodiment, the primer pair for detecting Streptococcus agalactiae comprises an upstream primer having a nucleotide sequence shown in SEQ ID No.17 and a downstream primer having a nucleotide sequence shown in SEQ ID No. 18.
In one embodiment, the klebsiella pneumoniae detection primer pair comprises an upstream primer having a nucleotide sequence shown as SEQ ID No.19 and a downstream primer having a nucleotide sequence shown as SEQ ID No. 20.
In one embodiment, the acinetobacter baumannii detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.21 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 22.
In a second aspect of the invention, the invention provides a use of the detection reagent for preparing a detection kit for simultaneously detecting eleven pathogenic bacteria.
In a third aspect of the present invention, there is provided a detection kit for simultaneously detecting eleven pathogenic bacteria, wherein the kit comprises the detection reagent.
The kit of the invention adopts a multiple PCR technology to simultaneously detect eleven pathogenic bacteria in a single tube, and can analyze and judge the infection conditions of staphylococcus aureus, streptococcus pyogenes, pseudomonas aeruginosa, alcaligenes faecalis, staphylococcus epidermidis, enterococcus faecium, common proteus, stenotrophomonas maltophilia, streptococcus agalactiae, klebsiella pneumoniae and acinetobacter baumannii according to the amplification and detection conditions. Therefore, the design of the primer is the key of the kit of the invention.
The kit based on the invention adopts multiplex PCR technology to detect, so that other conventional reagents required by PCR can be further included in the kit, such as: master MIX, and a sample genome extraction reagent. Since the common PCR reagents can be purchased separately or configured by themselves through the market, the reagents can be assembled into the kit according to the actual needs of customers, and can be assembled into the kit for convenience.
In a PCR reaction system during detection, primers and Master MIX are common components, and the content of the components is conventional.
The PCR reaction system can be self-prepared, and can also be obtained by directly adding primers into a general PCR reaction solution which is commercially available and does not contain the primers. For example, the kit can also be added with the primer and the sample to be detected in Master MIX to obtain a PCR reaction system.
Further, the kit also comprises a human DNA internal reference amplification primer pair. The human DNA internal reference amplification primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.23 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 24.
Further, the kit can also contain a positive quality control substance. The positive quality control product is pUC57 plasmid DNA containing target pathogen specific nucleic acid fragment and ginseng specific nucleic acid fragment. Commercially available alone or built on its own according to the prior art.
Further, the kit can also contain a negative quality control product. The negative quality control product is TE buffer solution. Commercially available alone or configured by themselves in accordance with the prior art.
In a fourth aspect of the present invention, there is provided a method for using the aforementioned detection kit, comprising the steps of:
(1) extracting sample genome DNA;
(2) sample adding: respectively adding the sample genome DNA, the positive quality control product or the negative quality control product into a PCR tube provided with a PCR reaction system to obtain the corresponding sample reaction tube, the positive reaction tube or the negative reaction tube, wherein the PCR reaction system contains the detection primer pair;
(3) and (3) PCR reaction: the reaction tube is arranged on a PCR instrument, and circulation parameters are set for carrying out PCR reaction;
(4) after the PCR reaction was completed, the results were analyzed.
In the step (1), the extraction of the genomic DNA of the sample is the prior art.
Preferably, in step (3), the conditions of the PCR reaction are set as: circulating for 1 time at 98 ℃ for 10 min; circulating for 35 times at 98 deg.C for 10sec, 60 deg.C for 10sec, and 72 deg.C for 30 sec; circulating for 1 time at 72 ℃ for 5 min; cycling at 4 ℃ for 1 time.
In a third aspect of the invention, the use of the aforementioned kit in the preparation of a pathogen detection product is provided.
Compared with the prior art, the invention has the following beneficial effects:
by adopting the technical scheme of the invention, eleven pathogenic bacteria can be detected and identified, the method has the advantages of simple operation, accurate detection, high sensitivity and high specificity, the detection time is obviously shortened, and the detection result can be obtained within 2-3 hours. The human DNA internal reference can ensure the quality control of nucleic acid in the detection process, and avoid the problem of false negative caused by disqualified nucleic acid samples. The combination of multiplex PCR and fragment analysis ensures the detection flux and has lower cost, and is suitable for disease control centers, hospitals and other medical institutions.
Drawings
FIG. 1 is a diagram showing the results of capillary electrophoresis separation of Alcaligenes faecalis according to the embodiment of the present invention.
FIG. 2 is a diagram showing the result of capillary electrophoresis separation of Proteus vulgaris in the embodiment of the present invention.
FIG. 3 is a diagram showing the result of capillary electrophoresis separation of a positive control in accordance with an embodiment of the present invention.
FIG. 4 shows the results of the specificity analysis in example 3 of the present invention.
FIG. 5 shows the amplification effect of primer set 1 in comparative example 2 of the present invention.
FIG. 6 shows the amplification effect of primer set 2 in comparative example 2 of the present invention.
FIG. 7 shows the amplification effect of primer set 3 in comparative example 2 of the present invention.
Detailed Description
Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.
When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.
EXAMPLE 1 methods of making and Using a kit
Respectively synthesizing a staphylococcus aureus detection primer pair, a streptococcus pyogenes detection primer pair, a pseudomonas aeruginosa detection primer pair, an alcaligenes faecalis detection primer pair, a staphylococcus epidermidis detection primer pair, an enterococcus faecium detection primer pair, a common proteus detection primer pair, a stenotrophomonas maltophilia detection primer pair, a streptococcus agalactiae detection primer pair, a klebsiella pneumoniae detection primer pair and an acinetobacter baumannii detection primer pair, wherein the nucleotide sequences of the primers are shown in the following table 1. Each detection primer pair can be packaged independently or combined to prepare a multiplex PCR detection mixed solution. In the multiplex PCR detection mixture, the amount of each primer pair may be any conventional amount known to those skilled in the art.
That is, the kit of the present invention may contain each set of primer pairs packaged independently, or may contain a multiplex PCR detection mixture containing each set of primer pairs disposed.
Furthermore, the kit can also contain a human DNA internal reference amplification primer pair, and the nucleotide sequence of the primer pair is shown in the following table 1.
Further, the kit can also contain a positive quality control substance. The positive quality control product is pUC57 plasmid DNA containing target pathogen specific nucleic acid fragment and ginseng specific nucleic acid fragment.
Further, the kit can also contain a negative quality control product. The negative quality control product is TE buffer solution.
Further, the kit can also contain Master MIX, a sample genome extraction reagent and the like. The Master MIX is available from Invitrogen.
TABLE 1
EXAMPLE 2 evaluation of the detection Effect of the kit
In the embodiment of the invention, a specific use mode of the kit is provided, and each detection primer pair shown in a sequence in table 1, a human DNA internal reference amplification primer pair and Master MIX purchased from Invitrogen company are uniformly mixed to obtain a PCR reaction solution.
1. Collecting patient samples (samples such as sputum, urine, cerebrospinal fluid, hydrothorax, ascites, puncture fluid and the like), extracting pathogenic bacteria DNA in the samples, and obtaining the DNA sample to be detected.
2. Preparation and detection of PCR reaction system
(1) Setting a typesetting mode according to the detection requirement, adding PCR reaction liquid into an 8-tube or 96-well plate according to the typesetting, adding 17.5 mu L of each hole, respectively and sequentially adding 2.5 mu L of a negative quality control product (TE buffer solution), a DNA sample to be detected and a positive quality control product (pUC57 plasmid DNA containing a target pathogen specific nucleic acid fragment and a ginseng specific nucleic acid fragment) into the reaction holes, and covering the reaction holes.
(2) Mix well and centrifuge.
(3) And (3) carrying out reaction by using the prepared reagent.
3. Setting PCR program
(1) The PCR program was set according to the PCR machine protocol, and the PCR amplification conditions are shown in Table 2 below.
TABLE 2
(2) After the PCR amplification is finished, the PCR amplification plate/tube is centrifuged for a short time, then the tube cover is opened carefully, mineral oil is added for sealing, and a nucleic acid fragment analyzer is used for detection.
4. Analysis of results
And judging the detection result of the sample by detecting the size of the reaction product fragment. The negative control tube should have no reaction product fragments. Otherwise, the experimental result is invalid and the detection is carried out again. In the positive quality control detection reaction system, a reaction product fragment is respectively contained in the ranges of 75-80bp and shown in the following table, otherwise, the result of the experiment is invalid, and the detection is carried out again. For a sample detection reaction system, an internal reference reaction product fragment should exist within the range of 75-80bp, otherwise, the experimental result is invalid, and the detection is carried out again. If the sample detection result is positive, judging the type of the infected pathogen according to the signal intensity of the reaction product and the size of the corresponding fragment. The whole detection process is about 2-3 hours.
Referring to the experimental assay data shown in FIGS. 1-3, the corresponding fragment size values for each pathogen are shown in Table 3 below.
TABLE 3
| Pathogen species | Fragment size |
| Staphylococcus aureus | 92-97bp |
| Streptococcus pyogenes | 128-134bp |
| Pseudomonas aeruginosa | 140-146bp |
| Alcaligenes faecalis | 160-165bp |
| Staphylococcus epidermidis | 182-190bp |
| Enterococcus faecium | 241-249bp |
| Proteus vulgaris | 272-279bp |
| Stenotrophomonas maltophilia | 291-300bp |
| Streptococcus agalactiae | 322-330bp |
| Klebsiella pneumoniae | 350-361bp |
| Acinetobacter baumannii | 380-393bp |
| Human DNA internal reference | 75-80bp |
EXAMPLE 3 sensitivity and specificity analysis of the kit
And (3) sensitivity analysis:
respectively carrying out gradient dilution on nucleic acids of staphylococcus aureus, streptococcus pyogenes, pseudomonas aeruginosa, alcaligenes faecalis, staphylococcus epidermidis, enterococcus faecium, proteus vulgaris, stenotrophomonas maltophilia, streptococcus agalactiae, klebsiella pneumoniae and acinetobacter baumannii, wherein the concentrations are respectively 1 × 106copies/mL、1×105copies/mL、1×104copies/mL、1×103copies/mL、1×1023-5 samples are repeated in each gradient dilution, multiple PCR amplification and fragment analysis detection are carried out by using the same determined eleven pathogenic bacteria multiple PCR detection system in the example 2 until no signal is detected, repeated detection is carried out for 20 times in each sample, and the level of the positive detection rate of 90-95% is taken as the lowest detection lower Limit (LOD), namely the sensitivity.
The relevant pathogenic strains are as follows:
TABLE 4
The detection sensitivity of the kit of the invention is shown in the following table:
TABLE 5
| Detecting the index | LOD(copies/mL) |
| Staphylococcus aureus (Staphylococcus aureus) | 1000 |
| Streptococcus pyogenes | 1000 |
| Pseudomonas aeruginosa | 100 |
| Alcaligenes faecalis | 1000 |
| Staphylococcus epidermidis | 100 |
| |
100 |
| |
100 |
| |
100 |
| Streptococcus agalactiae | 1000 |
| Klebsiella pneumoniae | 100 |
| |
100 |
And (3) specific analysis:
the specificity of the detection method established by the invention mainly shows the specificity of the specific primer. The designed primers are analyzed by blast comparison, have high conservation and specificity, and can specifically distinguish bacteria with similar species. In order to determine the specificity of the detection method, the following ten unrelated pathogenic strains are selected as simulated interference samples, all the pathogenic strains are purchased from Guangdong province microbial strain collection center and Chinese medical strain collection center, different pathogenic strains are detected after extracting nucleic acid, the concentration is 10 ng/mu L, the total nucleic acid of each sample obtained by the steps is mixed with the same amount of human reference plasmid (pUC57) to be used as a template for multiple PCR amplification and fragment analysis, and the specificity of the design of the kit primer is verified.
The relevant pathogenic strains are as follows:
TABLE 6
| Pathogenic bacterial strains | Source |
| Streptococcus pneumoniae | ATCC49619 |
| Enterococcus faecalis | ATCC29212 |
| Proteus mirabilis | CMCC49005 |
| Serratia marcescens | ATCC 8100 |
| Escherichia coli | ATCC25922 |
| Enterobacter cloacae | ATCC13047 |
| Enterobacter aerogenes | ATCC13048 |
| Haemophilus influenzae | ATCC49766 |
| Bacteroides fragilis | ATCC25285 |
| Acid-producing Klebsiella sp | ATCC49131 |
As shown in FIG. 4, multiplex PCR and fragment analysis of total nucleic acids of ten unrelated pathogens using an equal amount of the human reference plasmid (pUC57) as a template amplified only 75bp of the human reference band, and no other amplified bands. The data show that the detection results of the kit disclosed by the invention on the microorganisms are negative, so that the kit disclosed by the invention is proved to have no cross reaction with other microorganisms, and the strong specificity of the kit for detecting pathogens is embodied.
EXAMPLE 4 application of the kit to clinical specimen testing
1. Detection method
The 100 samples tested by the culture method for detecting the gold standard bacteria by using the same reagent in the embodiment 2 of the invention comprise 10 samples of staphylococcus aureus positive samples, 8 samples of streptococcus pyogenes positive samples, 5 samples of pseudomonas aeruginosa positive samples, 1 sample of alcaligenes faecalis positive samples, 5 samples of staphylococcus epidermidis positive samples, 5 samples of enterococcus faecium positive samples, 4 samples of proteus vulgaris positive samples, 5 samples of stenotrophomonas maltophilia positive samples, 6 samples of streptococcus agalactiae positive samples, 5 samples of klebsiella pneumoniae positive samples and 12 samples of acinetobacter baumannii positive samples.
2. The result of the detection
Compared with a bacterial culture method, the kit has the advantages that the positive detection rate is 100%, the consistency is high, the condition of missed detection does not occur, and the result has statistical significance. Compared with a gold standard bacterial culture method, the detection clinical sample of the kit has no obvious difference, but has obvious advantages in the aspects of multiple detection, short operation time, simple operation and the like.
Comparative example 1
Comparative primer sets 1-12 were prepared according to the procedure of example 1, see Table 7 below.
Except that the primers shown by SEQ ID NO.1-2 in the primer set of example 1 were replaced with the primers shown by SEQ ID NO.25-26 to obtain a comparative primer set 1. A comparative primer set 2 was obtained by replacing the primers shown by SEQ ID Nos. 3 to 4 in the primer set of example 1 with the primers shown by SEQ ID Nos. 27 to 28. A comparative primer set 3 was obtained by replacing the primers shown by SEQ ID Nos. 5 to 6 in the primer set of example 1 with the primers shown by SEQ ID Nos. 29 to 30. A comparative primer set 4 was obtained by replacing the primers shown by SEQ ID Nos. 7 to 8 in the primer set of example 1 with the primers shown by SEQ ID Nos. 31 to 32. A comparative primer set 5 was obtained by replacing the primers shown by SEQ ID Nos. 9 to 10 in the primer set of example 1 with the primers shown by SEQ ID Nos. 33 to 34. A comparative primer set 6 was obtained by replacing the primers shown by SEQ ID Nos. 11 to 12 in the primer set of example 1 with the primers shown by SEQ ID Nos. 35 to 36. A comparative primer set 7 was obtained by replacing the primers shown by SEQ ID Nos. 13 to 14 in the primer set of example 1 with the primers shown by SEQ ID Nos. 37 to 38. A comparative primer set 8 was obtained by replacing the primers shown by SEQ ID NO.15 to 16 in the primer set of example 1 with the primers shown by SEQ ID NO.39 to 40. A comparative primer set 9 was obtained by replacing the primers shown by SEQ ID Nos. 17 to 18 in the primer set of example 1 with the primers shown by SEQ ID Nos. 41 to 42. A comparative primer set 10 was obtained by replacing the primers shown by SEQ ID Nos. 19 to 20 in the primer set of example 1 with the primers shown by SEQ ID Nos. 43 to 44. A comparative primer set 11 was obtained by replacing the primers shown by SEQ ID Nos. 21 to 22 in the primer set of example 1 with the primers shown by SEQ ID Nos. 45 to 46. A comparative primer set 12 was obtained by replacing the primers shown by SEQ ID Nos. 23 to 24 in the primer set of example 1 with the primers shown by SEQ ID Nos. 47 to 48. A comparative primer set 13 was obtained by replacing the primers shown by SEQ ID NO.1 to 24 in the primer set of example 1 with the primers shown by SEQ ID NO.25 to 48.
Minimum detection limit verification the minimum detection limit verification was performed according to the method of example 3. The lowest detection limit of example 3 versus the comparative example is given in table 8 below.
| Detecting the index | Example 3, LOD (copies/mL) | COMPARATIVE EXAMPLE, LOD (copies/mL) |
| Staphylococcus aureus (Staphylococcus aureus) | 1000 | 5000 |
| Streptococcus pyogenes | 1000 | 1000 |
| |
100 | 1000 |
| Alcaligenes faecalis | 1000 | 1000 |
| Staphylococcus epidermidis | 100 | 1000 |
| |
100 | 100 |
| |
100 | 1000 |
| |
100 | 1000 |
| Streptococcus agalactiae | 1000 | 1000 |
| Klebsiella pneumoniae | 100 | 1000 |
| |
100 | 100 |
As can be seen from Table 8, the kit disclosed by the invention has stronger detection capability on trace nucleic acids of staphylococcus aureus, pseudomonas aeruginosa, staphylococcus epidermidis, proteus vulgaris, stenotrophomonas maltophilia and klebsiella pneumoniae in a sample compared with a comparison ratio.
Specificity verification was performed according to the method of example 3. The results showed that the primer pairs of the comparative examples were negative in all reaction results.
As can be seen from the comparison of example 3 and the comparative example, the present disclosure can detect eleven pathogenic bacteria of Staphylococcus aureus, Streptococcus pyogenes, Pseudomonas aeruginosa, Alcaligenes faecalis, Staphylococcus epidermidis, enterococcus faecium, Proteus vulgaris, stenotrophomonas maltophilia, Streptococcus agalactiae, Klebsiella pneumoniae, Acinetobacter baumannii at one time, and has the advantages of high sensitivity, high specificity, lower minimum detection limit and wider coverage.
Comparative example 2
The comparative example takes staphylococcus aureus as an example, and shows that part of primers with undesirable effects are found in the development process. And (2) staphylococcus aureus primer sequences and screening: for 3 sets of primer combinations, the amplification effect of the primers is firstly screened by using single PCR amplification, the single detection result shows that the amplification efficiency of the primer pair 3 is low, the primer pairs 1 and 2 can basically meet the requirements of subsequent experiments (as shown in figures 5 to 7), and the primers need to be added into a multiplex PCR method for further verification. Adding the primer pairs 1 and 2 into a multiplex PCR system respectively for amplification, wherein the detection results are as follows:
primer set 1
F-1：AGCGATTGATGGTGATACGGT(SEQ ID NO.49)
R-1：TTTAGGATGCTTTGTTTCAGGTG(SEQ ID NO.50)
Primer set 2
F-2：AGCGATTGATGGTGATACGGT(SEQ ID NO.51)
R-2：AGGATGCTTTGTTTCAGGTGT(SEQ ID NO.52)
Primer set 3
F-3：AGCGATTGATGGTGATACTGT(SEQ ID NO.53)
R-3：TTTAGGATGTTTCGTTTCAGGCG(SEQ ID NO.54)
The detection result of adding the primer pair 1 into a multiplex PCR system is as follows: the amplification efficiency of the primer pair staphylococcus aureus is low, and the primer pair can be competitively inhibited with other primer pairs or the amplification efficiency of the primer pair is reduced due to primer dimer, so that the requirement of subsequent detection is influenced. Adding the primer pair 2 into a multiplex PCR system for detection, wherein the detection result is as follows: the amplification efficiency of each pathogen primer pair is basically unchanged. Comprehensively considering from multiple aspects, the selected primer pair 2 is a primer pair of staphylococcus aureus in a multiplex PCR detection system, and the system meets the detection requirement after repeated verification.
The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.
Sequence listing
<110> zhang xiang lin
<120> a kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof
<160> 54
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agcgattgat ggtgatacgg t 21
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aggatgcttt gtttcaggtg t 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgaggacttg tcgagtgtct g 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agaggaacct tctacctcca c 21
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cggagctgtc gtactcgaag 20
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cagctacgtt gtcgtcacct 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ggtgtctttg ctcaggggtt 20
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cgtatcacat aaccaacaga ca 22
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
attcagtgat tgcaagatcc aa 22
<210> 11
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aaaagaaatc gcaccggctc 20
<210> 13
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tccccaacaa cccagtgttt 20
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tgatgtagtc caggtacggg t 21
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tgcatcgacg cctacatcaa 20
<210> 17
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gctcaagtta acgatgtaaa ggca 24
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
agtcgacagc atcacacgaa 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
aaagccggcg tgtacgataa 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
cactccacca cgcctttttc 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
tccaaatcac agcgcttcaa 20
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gccataacca acacgcttca 20
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ggggaggcaa ctaggatggt g 21
<210> 24
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
atggggacag gaccatattg agg 23
<210> 25
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
agcgattgat ggtgatacgg t 21
<210> 26
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
tttaggatgc tttgtttcag gtg 23
<210> 27
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
cgtttgttaa atcaggctga aa 22
<210> 28
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
ttgcggaaat ttgaggtaag a 21
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
aggtcggagc tgtcgtactc 20
<210> 30
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
tacgttgtcg tcacctacgc 20
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
ggtaggggtg tctttgctca 20
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
ttgcggaatc atggtactgt 20
<210> 34
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
cagttactct cacaggcaac tca 23
<210> 35
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
tcgagcaatc gttgaacaag 20
<210> 36
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
ctcaatccgc ttccacctaa 20
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
caggaatgac actggctgaa 20
<210> 38
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
tgttgacgct gagattgacc 20
<210> 39
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
tagtccaggt acgggtggta 20
<210> 40
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
<210> 41
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
tgctgtttga agtgctgctt 20
<210> 42
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
tcgcatttta gatccatttg c 21
<210> 43
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
aatgtgaatg cgggtatcgt 20
<210> 44
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
ctgaatacgt ttagtcaggt cg 22
<210> 45
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
aatccaaatc acagcgcttc 20
<210> 46
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
aaccaacacg cttcacttcc 20
<210> 47
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
ggggaggcaa ctaggatggt g 21
<210> 48
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
atggggacag gaccatattg agg 23
<210> 49
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
agcgattgat ggtgatacgg t 21
<210> 50
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
tttaggatgc tttgtttcag gtg 23
<210> 51
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
agcgattgat ggtgatacgg t 21
<210> 52
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
aggatgcttt gtttcaggtg t 21
<210> 53
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
agcgattgat ggtgatactg t 21
<210> 54
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
tttaggatgt ttcgtttcag gcg 23
Claims (10)
1. A detection reagent suitable for simultaneously detecting eleven pathogenic bacteria comprises a staphylococcus aureus detection primer pair, a streptococcus pyogenes detection primer pair, a pseudomonas aeruginosa detection primer pair, an alcaligenes faecalis detection primer pair, a staphylococcus epidermidis detection primer pair, an enterococcus faecium detection primer pair, a common proteus detection primer pair, a stenotrophomonas maltophilia detection primer pair, a streptococcus agalactiae detection primer pair, a klebsiella pneumoniae detection primer pair and an acinetobacter baumannii detection primer pair.
2. The detection reagent of claim 1, further comprising any one or more of the following features: (1) the staphylococcus aureus detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2; (2) the streptococcus pyogenes detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.3 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 4; (3) the pseudomonas aeruginosa detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.5 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 6; (4) the Alcaligenes faecalis detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.7 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 8; (5) the staphylococcus epidermidis detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.9 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 10; (6) the enterococcus faecium detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.11 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 12; (7) the primer pair for detecting the common proteus comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.13 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 14; (8) the stenotrophomonas maltophilia detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.15 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 16; (9) the streptococcus agalactiae detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.17 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 18; (10) the Klebsiella pneumoniae detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.19 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 20; (11) the acinetobacter baumannii detection primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.21 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 22.
3. Use of the detection reagent according to claim 1 or 2 for the preparation of a detection kit for the simultaneous detection of eleven pathogenic bacteria.
4. A test kit for simultaneously detecting eleven pathogenic bacteria, said kit comprising the detection reagent according to claim 1 or 2.
5. The detection kit according to claim 4, wherein the kit further comprises a human DNA internal reference amplification primer pair.
6. The detection kit of claim 5, wherein the human DNA internal reference amplification primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.23 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 24.
7. The detection kit according to claim 4, wherein the kit further comprises any one or more of a positive quality control material, a negative quality control material, a universal PCR reaction solution and a sample genome extraction reagent.
8. The test kit of claim 7, comprising any one or more of the following features: (1) the positive quality control product is pUC57 plasmid DNA containing target pathogen specific nucleic acid fragment and ginseng specific nucleic acid fragment; (2) the negative quality control product is TE buffer solution.
9. The use method of the detection kit according to any one of claims 1 to 8, comprising the steps of:
(1) extracting sample genome DNA;
(2) respectively adding the sample genome DNA, the positive quality control product or the negative quality control product into a PCR tube provided with a PCR reaction system to obtain the corresponding sample reaction tube, the positive reaction tube or the negative reaction tube, wherein the PCR reaction system contains the detection primer pair in any one of claims 1 to 8;
(3) and (3) PCR reaction: the reaction tube is arranged on a PCR instrument, and circulation parameters are set for carrying out PCR reaction;
(4) after the PCR reaction was completed, the results were analyzed.
10. Use of the detection kit according to any one of claims 1 to 8 in the preparation of a pathogen detection product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011459459.XA CN114622021B (en) | 2020-12-11 | 2020-12-11 | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011459459.XA CN114622021B (en) | 2020-12-11 | 2020-12-11 | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114622021A true CN114622021A (en) | 2022-06-14 |
| CN114622021B CN114622021B (en) | 2024-04-02 |
Family
ID=81895810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011459459.XA Active CN114622021B (en) | 2020-12-11 | 2020-12-11 | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114622021B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680081A (en) * | 2018-12-29 | 2019-04-26 | 深圳市刚竹医疗科技有限公司 | Detect the nucleic acid compositions of multiple pathogens, the application method of kit and kit |
| CN110564824A (en) * | 2019-08-22 | 2019-12-13 | 领航基因科技（杭州）有限公司 | Primer, probe combination and kit for detecting human pathogenic bacteria |
| CN110714090A (en) * | 2019-12-03 | 2020-01-21 | 郑州安图生物工程股份有限公司 | Kit for detecting free nucleic acid of blood stream infection pathogen in blood plasma |
| CN111088378A (en) * | 2020-01-09 | 2020-05-01 | 中国科学院大学宁波华美医院 | Primer probe system, kit and method for detecting common pathogenic bacteria of severe pneumonia |
-
2020
- 2020-12-11 CN CN202011459459.XA patent/CN114622021B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680081A (en) * | 2018-12-29 | 2019-04-26 | 深圳市刚竹医疗科技有限公司 | Detect the nucleic acid compositions of multiple pathogens, the application method of kit and kit |
| CN110564824A (en) * | 2019-08-22 | 2019-12-13 | 领航基因科技（杭州）有限公司 | Primer, probe combination and kit for detecting human pathogenic bacteria |
| CN110714090A (en) * | 2019-12-03 | 2020-01-21 | 郑州安图生物工程股份有限公司 | Kit for detecting free nucleic acid of blood stream infection pathogen in blood plasma |
| CN111088378A (en) * | 2020-01-09 | 2020-05-01 | 中国科学院大学宁波华美医院 | Primer probe system, kit and method for detecting common pathogenic bacteria of severe pneumonia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114622021B (en) | 2024-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114898808B (en) | Method and system for predicting sensitivity of Klebsiella pneumoniae to cefepime | |
| CN112941215B (en) | Urinary system fungus infection detection system, kit and application thereof | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN109251992A (en) | A kind of LAMP primer composition object and method detecting Ye Shi lung pityrosporion ovale | |
| CN109355406B (en) | A kind of kit of the detection mycobacterium tuberculosis based on blood free nucleic acid | |
| CN114317786B (en) | Primer probe combination and kit for detecting 14 respiratory tract infection pathogenic bacteria and application of primer probe combination and kit | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| CN107523619A (en) | The PCR detection kit of drug-fast bacteria comprising mcr genes and its application | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN108318692A (en) | Kanamycins is detected based on aptamer configuration switches | |
| Yang et al. | The application analysis of multiplex real-time polymerase chain reaction assays for detection of pathogenic bacterium in peritoneal dialysis-associated peritonitis | |
| CN114622021A (en) | Kit suitable for simultaneously detecting eleven pathogenic bacteria and detection method thereof | |
| CN115873979A (en) | Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof | |
| CN115725754A (en) | Primer probe combination and kit for detecting three pneumonia pathogens | |
| CN102146467A (en) | Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis | |
| CN111455094B (en) | Composition, kit, application and method for detecting deep infection fungi | |
| CN112611876B (en) | Urine amino acid detection kit and method for aptamer-quadruplex | |
| CN103834741A (en) | Noninvasive helicobacter pylori gene detection kit and preparation and detection method thereof | |
| CN113817849A (en) | Primer group for detecting mycobacteria based on nucleic acid mass spectrometry technology and application thereof | |
| CN111334593A (en) | System for simultaneously detecting methicillin-sensitive and methicillin-resistant staphylococcus aureus and using method thereof | |
| CN114350846B (en) | Primer group and kit for combined detection of multiple pulmonary infection fungi | |
| CN117551798A (en) | PCR primer group and kit for combined detection of nine lower respiratory tract infection pathogens and application thereof | |
| CN107523620A (en) | PCR detection kit and its application comprising production NDM drug-fast bacterias | |
| JP2023020631A (en) | Method for testing systemic lupus erythematosus | |
| CN106893760B (en) | Kit for detecting urine pathogenic bacteria and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |