CN114606197A

CN114606197A - MDCK-KOslc35b2 cell line suitable for adenovirus vector proliferation and application thereof

Info

Publication number: CN114606197A
Application number: CN202210179221.4A
Authority: CN
Inventors: 韩丽; 王晓萍; 张安定; 叶贵珊
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-02-25
Filing date: 2022-02-25
Publication date: 2022-06-10

Abstract

The invention discloses an MDCK-KOslc35b2 cell line suitable for adenovirus vector proliferation and application thereof, wherein seven bases TCTGACT are continuously lacked on a second segment of exon sequence of an slc35b2 gene on a chromosome No. 12 in the whole genome of the cell line; the second exon sequence of the slc35b2 gene on the other chromosome of chromosome 12 is continuously missing seventeen bases GGTCCCTCTGACTTCGC. The expression of SLC35B2 is completely deleted in a canine kidney epithelial cell line MDCK, the sulfation of related protein tyrosine in cells is influenced after the deletion, and the regulation of DNA damage repair and mitochondrial homeostasis caused by the intracellular environment is disturbed. Is favorable for the large-scale proliferation of adenovirus in nucleus, improves the yield of virus, reduces the production cost of the adenovirus vector vaccine in clinic and is favorable for the development of recombinant adenovirus vector vaccine.

Description

MDCK-KOslc35b2 cell line suitable for adenovirus vector proliferation and application thereof

Technical Field

The invention relates to molecular biology, in particular to a MDCK-KOslc35b2 cell line suitable for adenovirus vector proliferation and application thereof.

Background

The recombinant adenovirus vector is a replication-defective adenovirus vector system, can bear exogenous genes, and is applied to vaccine development as a gene delivery vector. Human Adenovirus vector type 5 (Adenovir 5, Ad5), whose genome is 36Kb long linear double-stranded DNA, is the most commonly used Adenovirus vector for clinical vaccines. In recent years, adenovirus vectors have been widely used in research of candidate vaccines for ebola virus, Human Immunodeficiency Virus (HIV), influenza virus, plasmodium falciparum, mycobacterium tuberculosis, hepatitis c virus, and the like. A recombinant novel Coronavirus vaccine Ad5-nCoV which is independently developed in China and based on a human adenovirus type 5 virus vector is clinically applied to prevention of 2019 Coronavirus diseases (Coronavir disease 2019, COVID-19) epidemic disease.

However, the pre-existing immunity of the body against the adenovirus vector always hinders the development and application of the vaccine. Canine Adenovirus (CAV) is one of the most pathogenic viruses in the mammalian adenovirus genus, and is classified into two types, namely, canine adenovirus-1 (CAV-1) and canine adenovirus-2 (CAV-2). The canine adenovirus CAV-2 has high species specificity, can infect and enter a human body but cannot replicate, avoids the problem of pre-existing immunity of the human body to a certain extent, and shows good development prospect of adenovirus vector vaccine vectors. Meanwhile, CAV-2 can also be used as an oral vaccine carrier to hopefully solve the problem of wild animal immunity.

It follows that CAV-2 is not only an important candidate vector for gene delivery in humans, but is also a very valuable vaccine vector tool for animals. Therefore, the research of increasing the multiplication titer of the CAV-2 virus to reduce the cost of the vaccine is particularly important for the development of recombinant adenovirus vector vaccines.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an MDCK-KOslc35b2 cell line suitable for adenovirus vector proliferation and application thereof, and the invention carries out targeted mutation on the slc35b2 gene of a cell by utilizing the characteristics of specific targeting and high-efficiency cutting rate of a CRISPR technology so as to achieve the effect of gene function inactivation; the cell is transformed at the genome level, so that the double chromosomes are mutated, and the obtained slc35b2 gene functional inactivation cell line capable of being inherited stably is obtained. The cell line has the effect of improving the proliferation of the adenovirus vector, and is beneficial to improving the titer of the adenovirus vector so as to achieve the effects of improving the production efficiency of clinical adenovirus vector vaccines and the like.

In order to achieve the purpose, the invention designs an MDCK-KOslc35B2 cell line suitable for propagation of adenovirus vectors, wherein the whole genome of the cell line is provided with an SLC35B2 Gene positioned on a 12 th chromosome, the whole genome of the cell line is provided with an SLC35B2 Gene on a 12 th chromosome, wherein the second exon Gene sequence (the second exon Gene sequence is shown as SEQ ID NO. 1) lacks seven bases of TCTGACT continuously, and the seven bases of TCTGACT are positioned between the sites of 12857085-12857093 on an SLC35B2 Gene sequence (the SLC35B2 Gene sequence is registered in NCBI with the accession number of Gene ID: 481819);

the second exon sequence of the SLC35B2 gene on the other chromosome of chromosome 12 is continuously lack of seventeen bases GGTCCCTCTGACTTCGC, and the seventeen bases GGTCCCTCTGACTTCGC are positioned between the sites of 12857081-12857099 on the SLC35B2 gene sequence (the MDCK-KOslc35B2 cell line is lack of SLC35B2 gene, so that the gene cannot be correctly expressed, thereby achieving the aim of knocking out the SLC35B2 gene).

The invention also provides a method for constructing the MDCK-KOslc35b2 cell line suitable for the proliferation of the adenovirus vector, which comprises the following steps:

1) constructing an MDCK cell line stably expressing Cas9 protein;

2) constructing a mutant plasmid lentiGuide-sgRNA slc35b2 targeting the second exon of slc35b 2;

3) lentiGuide-sgRNA slc35b2 lentivirus production targeting slc35b 2;

4) construction of Mixed cells containing mutation in slc35b2 Gene

5) screening of an MDCK-KOslc35b2 cell line with functional inactivation of slc35b 2.

Further, in the step 1), the MDCK cell line stably expressing the Cas9 protein is constructed as follows:

a. the 293FT cells are paved into a 6-well plate, 293FT cells are co-transfected by lentivirus-packaged plasmids pMD2.G, psPAX2 and lentiTiCA 9-Blast (in the transfection process, pMD2.G can form a virus envelope, psPAX2 can express gag and pol for virus packaging, and lentiCas9-Blast plasmids not only contain packaging signals and long terminal repetitive sequences which are packaged into pseudovirus particles, but also contain Cas9 protein and Blasticidin resistance screening genes), cells are collected and cultured after transfection, centrifugation is carried out, and supernatant is taken as a solution containing the lentivirus particles;

b. paving MDCK cells into a 12-hole plate, adding Blasticidin antibiotics with different concentrations, screening out the lowest concentration capable of killing all cells within 3 days, and determining the concentration as the sensitive concentration of the MDCK cells screened in the later period;

c. MDCK was plated in 6-well plates and, when adherent, was plated in a culture medium to lentiviral suspension volume ratio of 1: adding 1 into a 6-pore plate, culturing cells, periodically replacing fresh complete culture medium, adding Blasticidin antibiotics according to the sensitive concentration of MDCK cells, screening positive cells, paving 1 cell/pore into a 96-pore plate, selecting cells growing rapidly under the sensitive concentration of Blasticidin antibiotics, and expanding to obtain the MDCK cell line for stably expressing Cas 9.

Still further, in the step 2), the construction method of the mutant plasmid lentiGuide-sgRNAslc35b2 targeting the second exon of slc35b2 is as follows:

a. the sgRNA sequence targeted for mutation was designed based on the sequence located on canine chromosome 12 (the sequence of chromosome 12 was entered at NCBI with the accession number Gene ID:481819) (i.e., the second exon sequence of slc35b 2) and was GCTCAGACCGCGAAGTCAGA;

b. two ends of the sgRNA sequence of the targeted mutation are supplemented with adhesive ends cut by BsmBI, and the synthetic sequence is as follows:

d-slc35b2-sgRNA-F:5’-CACCGCTCAGACCGCGAAGTCAGA-3’，

d-slc35b2-sgRNA-R:5’-AAACTCTGACTTCGCGGTCTGAGC-3’；

c. carrying out phosphorylation annealing on sequences d-slc35b2-sgRNA-F and d-slc35b2-sgRNA-R to form a double chain, namely an slc35b2-sgRNA double chain of a targeting slc35b2 second exon containing BsmBI enzyme cutting sites;

d. BsmBI is used for double enzyme digestion of lentiGuide-Puro plasmid vector, and lentiGuide-Puro fragment is obtained by recovery; connecting an slc35b2-sgRNA double chain of a targeting slc35b2 second exon with the recovered lentiGuide-Puro fragment to obtain a connecting product;

e. after the ligation product is transformed into an escherichia coli competent cell, a mutant plasmid lentiGuide-sgRNA slc35b2 is obtained.

Still further, in the step 2), the step c, the phosphorylation annealing reaction system is:

the reaction is carried out at 37 ℃ for 30min, at 95 ℃ for 5min, at 85 ℃ ramp 2 ℃/s 30Cycle, at 25 ℃ ramp 0.1 ℃/s 90 Cycle.

Still further, in the step 3), lentiGuide-sgRNA slc35b2 lentivirus targeted to slc35b2 was produced as follows:

the 293FT cells were plated in 6-well plates and the lentivirus-packaged plasmids pMD2.G, psPAX2, lentiGuide-sgRNA slc35b2 were co-transfected into cells; after transfection, cell culture is collected, centrifugation is carried out, and the supernatant is obtained again, namely suspension containing lentivirus-sgRNA slc35b 2.

Still further, in the step 4), the method for screening the slc35b2 mutant MDCK cells is as follows

a. Transferring the MDCK cells obtained in step 1) into a 6-well plate so that the volume ratio of complete medium to cell suspension containing lentivirus-sgRNA slc35b2 is 1:1, adding the mixture into a 6-pore plate, periodically changing a fresh complete culture medium after culturing cells for 24 hours, adding puromycin antibiotic to screen positive cells according to the sensitive concentration of MDCK cells to puromycin antibiotic, and obtaining mixed cells containing the gene mutation of slc35b 2;

still further, in the step 5), the method for screening and identifying the MDCK-KO slc35b2 cell line with the function of the slc35b2 inactivated is as follows:

spreading the mixed cells containing the mutation of the slc35b2 gene into a 96-well plate according to 1 cell/well, screening monoclonal cells by using a limiting dilution method, and selecting the wells of the single cell clone for amplification culture; and growing the monoclonal cells; this was the MDCK-KO slc35b2 cell line.

The invention also provides application of the MDCK-KOslc35b2 cell line suitable for adenovirus vector proliferation in preparation of an adenovirus vector vaccine.

The principle of the invention is as follows:

1. the SLC35B2 gene selected by the invention is a nucleotide sulfate gene, the coded protein is 3 '-adenosine phosphate-5' -phosphate sulfate (PAPS) transport protein 1, which is a specific PAPS transport protein existing in a Golgi apparatus membrane and is also called PAPST 1. In the normal physiological growth and development process of the organism, cell protein, polysaccharide and the like form organic sulfate with biological activity under the catalysis of the sulfate transferase, and participate in a plurality of important biological processes of the organism. During the process of sulfate group transfer, the golgi membrane transporter (PAPST1) transfers PAPS from the cytoplasm into the golgi lumen, delivering sulfate groups for sulfation of substrates such as proteins, polysaccharides, etc. There are studies showing that silencing SLC35B2 inhibits PAPS uptake by golgi vesicles in canine kidney epithelial cells (MDCKs), resulting in inhibition of chondroitin sulfate CS synthesis while increasing heparin sulfate HS synthesis.

2. The invention utilizes the characteristics of specific targeting and high-efficiency cutting rate of CRISPR technology to carry out targeted mutation on the slc35b2 gene of the cell, thereby achieving the effect of gene function inactivation; the cell is transformed at the genome level, so that the double chromosomes are mutated, and the obtained slc35b2 gene functional inactivation cell line capable of being inherited stably is obtained. The cell line has the effect of improving the proliferation of the adenovirus vector, and is beneficial to improving the titer of the adenovirus vector so as to achieve the effects of improving the production efficiency of clinical adenovirus vector vaccines and the like.

The invention has the beneficial effects that:

the expression of SLC35B2 is completely deleted in a canine kidney epithelial cell line MDCK, and SLC35B2 is used as a sulfate group transporter, so that sulfation of related protein tyrosine in cells is influenced after deletion, and the regulation of DNA damage repair and mitochondrial homeostasis by an intracellular environment is disturbed. Under the condition of adenovirus infection, the deletion of SLC35B2 gene obviously delays the death of infected cell, is favorable for the mass proliferation of adenovirus in nucleus, improves the yield of virus, reduces the production cost of adenovirus vector vaccine in clinic and is favorable for the development of recombinant adenovirus vector vaccine.

Drawings

FIG. 1 is a lentiCas9-Blast vector map;

FIG. 2 is a map of a psPAX2 vector;

FIG. 3 is a pMD2.G vector map;

FIG. 4 is a vector map of lentiGuide-Puro;

FIG. 5 is a lentiGuide-sgRNA slc35b2 plasmid map;

FIG. 6 is a plasmid map of pRetrox-Tet-3G retroviral vector;

FIG. 7 is a pRetrox-c slc35b2-flag retroviral plasmid map;

figure 8 is detection of Cas9 protein expression in cells;

in the figure, the first lane is a detection result of MDCK cells, and the second lane is a detection result graph of Cas9-MDCK cells;

FIG. 9 is a diagram showing the sequencing result of plasmid lentiGuide-sgRNA slc35b2 obtained after construction of sgRNA targeting slc35b2 into lentiGuide-Puro vector;

FIG. 10 is a map of the MDCK-KO slc35b2 cell line slc35b2 sequence T7E 1;

in the figure, lane 1 is the MDCK-WT cell slc35b2 gene target band without T7E1enzyme digestion control,

lane 2 shows the T7E1 band of the gene of SLC35b2 of MDCK-WT cells,

lane 3 is the suspected mutant cell slc35b2 gene target band not digested with T7E1, and lane 4 is the suspected mutant cell slc35b2 gene target band digested with T7E 1;

FIG. 11 is a graph of the sequencing results of mutations in the sequence of SLC35b2 in MDCK-KO SLC35b2 cells;

FIG. 12 is a diagram of Western Blot for detecting the expression of SLC35B2 gene of MDCK-KO + c SLC35B2 cell line;

FIG. 13 is a diagram of the proliferation of adenovirus CAV-2 on MDCK-KOslc35b2, MDCK-KO + c slc35b2 and MDCK-WT cells,

in the figure, 24h, 48h and 72h are the infection time of CAV-2 on the cells;

FIG. 14 is a graph showing the results of measurement of viral titer of adenovirus CAV-2 propagated on MDCK-KOslc35b2, MDCK-KO + c slc35b2 and MDCK-WT cells.

Detailed Description

The present invention is described in further detail below with reference to specific examples so as to be understood by those skilled in the art.

The following materials and materials were used as examples

1. Cell and plasmid genes

Human embryonic kidney cell line (MDCK) was supplied by Hemanschumann Biotech, Inc., 293FT cells were purchased from Clontech. The lentiCas9-Blast (FIG. 1), psPAX2 plasmid (FIG. 2), pMD2.G plasmid (FIG. 3), lentiGuide-Puro (FIG. 4), pRetrox-Tet-3G (FIG. 6) plasmids were all purchased from Addgene.

2. Commonly used biological reagents

DMEM medium was purchased from Gibco, fetal bovine serum was purchased from PAN Biotech, Germany, Phanta Super-Fidelity DNA Polymerase, DNA Maker DL2000, DNA Maker DL5000 was purchased from Nanjing Novozam Biotech, BsmBI I restriction Enzyme, T7E1Enzyme was purchased from NEB, gel recovery kit, plasmid extraction kit and endotoxin removal kit were purchased from TIANGEN, Blastidin, Puromycin were purchased from Sigma, G418 was purchased from Thermo Fisher.

3. Main instruments and equipment desk type low temperature high speed centrifuge (Eppendorf 5404R), XP gene amplification instrument TC-XP-D (Hangzhou Bori science and technology Co., Ltd.), electric heating constant temperature water bath DK-S22 type (Shanghai Jing hong experiment equipment Co., Ltd.), SCW-CZ-650 type clean bench (Suzhou hong rui purification science and technology Co., Ltd.), vertical double door low temperature preservation box BCD-610W (Boxihua household appliances Co., Ltd.), DHP-9162 type constant temperature incubator (Shanghai Fuma experiment equipment Co., Ltd.), model DYY-6C type nucleic acid electrophoresis apparatus (Beijing Henixing Biotechnology Co., Ltd.), UV-1000 type desk type ultraviolet analyzer (Shanghai Jia Ji Co., Ltd.), HDL clean bench (Beijing Donggao Harer instruments Co., Ltd.), MODEIX 70-S8F2 (OLPUYMS OPTICAL JA PAN), vertical preservation box-86L (Qinghai island super low temperature apparatus 626), centrifuge 542r (eppendorf), gel imaging system, biosafety cabinet, general optical microscope type, constant temperature water bath DK-80 type (shanghai essence macro experimental facilities, ltd.), constant temperature incubator ZHWY-2012C (shanghai wisdom city analytical instruments, ltd.).

EXAMPLE 1 construction of MDCK-KOslc35b2 cell line suitable for adenovirus vector propagation

1. Construction of MDCK cell line stably expressing Cas9 protein

a. Preparation of a solution containing Lentiviral particles

293FT cells were plated in 6-well plates and lentivirus-packaged plasmids pmd2.g, psPAX2, lentiCas9-Blast were plated in mass ratio 2:3:5, transfecting cells according to the total amount of the plasmid of 3 mu g (in the transfection process, pMD2.G can form a viral envelope, psPAX2 can express gag and pol for virus packaging, lentiCas9-Blast plasmid not only contains a packaging signal of pseudovirion, a long terminal repetitive sequence, but also contains Cas9 protein and a Blast resistance selection gene), changing the liquid after 8 hours of transfection, collecting cell culture supernatants of 48 hours of transfection and 72 hours of transfection, and taking the supernatant as a solution containing the lentivirus particles after 4 ℃, 12,000 rpm and 10 minutes of centrifugation.

Determination of the minimum Blasticidin antibiotic killing concentration in MDCK cells

The MDCK cells are paved into a 12-well plate, the Blasticidin antibiotics with different concentrations are added, 3 times of repetition are carried out, the lowest concentration capable of killing all the cells within 3 days is selected, the concentration is determined as the sensitive concentration of the MDCK cells in the later stage screening, and the sensitive concentration of the MDCK cells tested in the experiment is 8.0 mu g/ml.

Table 1: minimal lethal concentration of Blastidin on normal MDCK cells

Note that: -: cell 0% dead, +: cells were approximately 20% dead, + +: cells were approximately 40% dead, and +++: cells are approximately 60% dead, and ++++: cells are approximately 80% dead, and ++++: cells were 100% dead.

Bleastidin antibiotic screening Cas9 expression positive cells MDCK was plated in 6-well plates and allowed to adhere to the plates in a volume ratio of medium to lentiviral suspension of 1:1, adding the mixture into a 6-well plate, culturing cells for 24 hours, and replacing fresh complete culture medium. To the lentiviral-infected MDCK cells and uninfected MDCK cells, 8 μ g/ml of blicidin antibiotic was added to select positive cells, the medium was changed every two days and antibiotics were added, and when all of the lentiviral-infected MDCK cells were dead, the infected well-surviving cells were trypsinized and passaged into T25 cell flasks for proliferation. This cell is a suspected Cas9 expression positive cell. And (3) paving the cells into a 96-well plate according to 1 cell/well, and selecting the cells which grow rapidly under 8 mu g/ml of Blasticidin antibiotics for expansion, so as to obtain the cell line suspected of positive Cas9 expression.

Cell line total proteins suspected of being correct were extracted using lysates and protein concentrations were determined using G250. 8% SDS-PAGE gel was prepared, and about 100. mu.g of protein was added and electrophoresed at 80V and 120V for 30min and 90min, respectively. After the electrophoresis was completed, the membrane was wet-transferred for 90min under 100V conditions. Blocking with 2% BSA Blocking Buffer with gentle shaking at room temperature for 60min, cutting the membrane into two parts according to the size of Cas9 protein and the size of beta-Actin protein, adding respective primary anti-Cas 9(7A9-3A3) Mouse mAb and beta-Actin (13E5) Rabbit mAb, and incubating at room temperature for 120 min. After washing the membrane 3 times with TBS containing 0.05% Tween-20, secondary antibodies Anti-Mouse IgG (whole-molecule) -Peroxidase and Anti-Rabbit IgG (whole-molecule) -Peroxidase were added, respectively, and incubated with gentle shaking at room temperature for 60 min. The membrane was washed 5 times with TBST to wash away excess antibody and developed with ECL chemiluminescence kit. The cells corresponding to the sample with positive color development result are the MDCK cell line Cas9-MDCK stably expressing Cas9 (FIG. 8).

2. Construction of mutant plasmid lentiGuide-sgRNA slc35b2 targeting second exon of slc35b2

(1) Design and synthesis of sgRNA sequence of second exon of targeted slc35b2 gene

a. The sgrna sequence of GCTCAGACCGCGAAGTCAGA was designed for targeted mutation based on the sequence located at 481819 on canine chromosome 12 (chromosome 12 sequence entered at NCBI with accession number Gene ID:481819), the second exon sequence of slc35b 2.

d-slc35b2-sgRNA-F:5’-CACCGCTCAGACCGCGAAGTCAGA-3’，

d-slc35b2-sgRNA-R:5’-AAACTCTGACTTCGCGGTCTGAGC-3’；

(2) sgRNA lentiviral vector construction carrying targeting slc35b2

c. And (3) reacting the sequences d-slc35b2-sgRNA-F and d-slc35b2-sgRNA-R at 37 ℃ for 30min, reacting at 95 ℃ for 5min, carrying out gradient cooling phosphorylation annealing at-95-25 ℃ (-0.3 ℃/s, and maintaining the temperature for 1min every 5 ℃) to carry out phosphorylation and annealing, thus obtaining the mutant mut-slc35b2 of the second exon of the targeted slc35b 2.

d. lentiGuide-Puro was reacted at 55 ℃ for 12 hours in the following system, followed by agarose gel electrophoresis to recover a 8299bp fragment.

e. The mutant mut-slc35b2 targeting the second exon of slc35b2 was ligated with the recovered lentiGuide-Puro fragment as follows and reacted at 16 ℃ for 12 h.

f. After the ligation product was transformed into E.coli competent cells, ampicillin-resistant plates were coated, and positive clones were selected. Design of primers based on lentiGuide-Puro vector sequence

sgRNACX-P1：5’-ATACGATACAAGGCTGTTAGAGAG-3’，

sgRNACX-P2：5’-CTGTCCCTGTAATAAACCCGAAAA-3’；

The sequences were determined separately (FIG. 9), and the plasmid corresponding to the expected series was the sgRNA lentiviral plasmid lentiGuide-sgRNA slc35b2 targeting slc35b 2.

3. lentiGuide-sgRNA slc35b2 lentivirus production targeting slc35b2

(1) Packaging of lentiviral lentiGuide-sgRNA slc35b2 targeting slc35b2

The 293FT cells were plated in 6-well plates, and cells were transfected with lentivirus-packaged plasmids pMD2.G, psPAX2, lentiGuide-sgRNA slc35b2 at a ratio of 2:3:5, and a total plasmid amount of 3. mu.g; after 8 hours of transfection, the medium was changed, and cell culture supernatants were collected for 48 hours and 72 hours of transfection at 4^℃And centrifuging for 10 minutes at 12000 r/min, and collecting supernatant to obtain a solution containing lentivirus lentiGuide-sgRNA slc35b 2.

(2) Cas9-MDCK cell puromycin antibiotic minimum kill concentration screen

Cas9-MDCK cells are paved into a 6-well plate, puromycin antibiotics with different concentrations are added, 3 times of repetition are carried out, the lowest concentration capable of killing all cells within 7 days is screened, the concentration is determined as the sensitive concentration of the late screening Cas9-MDCK cells, and the sensitive concentration of the Cas9-MDCK cells tested in the experiment is 2.0 mu g/ml.

Table 2: minimum lethal concentration of puromycin on Cas9-MDCK cells

(3) Construction of Mixed cells containing mutation in slc35b2 Gene

Transferring the Cas9-MDCK cells obtained in the step 1 into a 6-well plate, so that the volume ratio of complete culture medium and collected lentivirus lentiGuide-sgRNA slc35b2 is 1:1, adding the mixture into a 6-well plate, culturing cells for 24 hours, and replacing fresh complete culture medium.

Cas9-MDCK cells infected with lentivirus lentiGuide-sgRNA SLC35B2 and Cas9-MDCK cells not infected with lentivirus are respectively paved into 6-well plates, 2 mug/ml puromycin antibiotic is added according to the sensitive concentration of the Cas9-MDCK cells to puromycin antibiotic to screen positive cells, and after all the cells in the uninfected group die, the surviving cells in the infected group are passaged, namely mixed cells suspected to contain SLC35B2 gene mutation.

4. T7E1 is utilized to detect whether gene mutation exists in Cas9-MDCK cells infected with lentivirus lentiGuide-sgRNA slc35b2

And respectively extracting genomes of the mixed cell and the MDCK wild-type cell, designing primers slc35b2-genome-F and slc35b2-genome-R according to the genome sequence of slc35b2, amplifying the genome sequence of the second exon of the slc35b2 gene, and carrying out agarose gel electrophoresis to recover a target fragment with the size of 651 bp.

slc35b2-genome-F：5'-AAGCCCTTTCCAGAGTCATGGACG-3'，

slc35b2-genome-R：5'-AAAGAGGCAAAAACAAGACAGCAA-3'

The recovery products of the wild type and the mutant fragment are reacted for 30min at 37 ℃, 5min at 95 ℃ and subjected to gradient cooling phosphorylation annealing at 95-25 ℃ (-0.3 ℃/s, and the temperature is maintained for 1min at 5 ℃ every time).

And reacting the denatured and slowly annealed fragments at 37 ℃ for 1h to perform T7E1enzyme digestion reaction, carrying out electrophoresis on reaction products in agarose gel with the concentration of 2%, and obtaining cells corresponding to samples capable of generating bands of 377bp and 274bp after cutting, namely mixed cells of the slc35b2 mutant MDCK cells and wild types. (FIG. 10).

Screening and identification of the functional-inactivated MDCK cell line MDCK-KOslc35b2 in slc35b2

The cell line with the mutation of the slc35b2 gene was subjected to single cloning by the limiting dilution method, the cells were plated into a 96-well plate at 1 cell/well, and the wells of the single cell clone were selected for expansion culture. Selecting a strain of the proliferated monoclonal cells to extract a genome, amplifying a genome fragment in which a second exon of an slc35b2 gene is positioned by using primers slc35b 2-gene-F and slc35b 2-gene-R, recovering, reacting at 16 ℃ for 12 hours, connecting the fragment to a pMD-18T Vector, and sequencing by using universal primers M13R-48 and M13F-47; sequencing results show that 20 single clones of the SLC35B2 gene are in the PAM region, and mutations exist in two cases, seven bases TCTGACT are deleted between the sites of 12857085-12857093 on the SLC35B2 gene sequence, so that the gene cannot be correctly expressed; seventeen bases GGTCCCTCTGACTTCGC are deleted between the 12857081-1285799 sites on the gene sequence of the second segment of the SLC35B2 gene on the other chromosome, so that the gene cannot be correctly expressed, and the aim of knocking out the SLC35B2 gene is fulfilled (figure 11); the MDCK-KOslc35b2 cell line with the function of slc35b2 inactivated is determined.

Example 2 construction of the slc35b2 Gene complementation cell line MDCK-KO + c slc35b2

To verify that the phenotype of CAV-2 in delaying cell death in an MDCK-KO slc35b2 infected cell line was indeed caused by the knockout of the slc35b2 gene, an slc35b2 complementation cell line was constructed on the basis of this knockout cell line, and whether the cell death phenotype could be recovered by infection with CAV-2 was observed.

Construction of an slc35b2 Gene complementing plasmid

The construction strategy is to amplify a target sequence slc35b2 by taking a dog liver as a template, adding a restriction enzyme site BamHI GGATCC at the front end of the target sequence, adding a Kozak sequence GCCACC before an initiation codon ATG to enhance the translation efficiency of eukaryotic genes, and adding a Flag tag and a restriction enzyme site EcoRI GAATTC before a termination codon at the tail end of the target sequence. Amino acids near NGG at the position of the sgRNA are mutated into synonymous amino acids, and an slc35b2 gene complementing sequence c slc35b 21341 bp is obtained. BamHI and EcoRI are used for double digestion of pRetrox-Tet-3G vector, 7372bp vector band is recovered, and a target band and the vector band are connected to construct pRetrox-c slc35b2-flag retrovirus plasmid.

SLC35B2-TB-F1：

5'-CGGGATCCGCCACCATGGACGCCAGGTGGTGGGCAGTGG-3'；

SLC35B2-TB-R1：5'-GCGAAGTCAGgGGcACCTCGTCAGA-3'；

SLC35B2-TB-F2：5'-TCTGACGAGGTgCCcCTGACTTCGC-3'；

SLC35B2-TB-R2：5'-CGGAATTCTCACTTATCGTCGTCATCCTTGTAATCAACTT TTTGCACAGGGGACTCC-3'；

Digestion and recovery of pRetrox-Tet3G vector

Enzyme digestion reaction system

The fragment and vector enzyme digestion connection system is as follows:

enzyme digestion connecting system

Ligation was carried out overnight at 4 ℃. And (3) selecting bacteria, identifying and sequencing to obtain pRetrox-c slc35b2-flag retrovirus plasmid.

Packaging of pRetrox-c slc35b2-flag retrovirus

Inoculating GP2-293 cells to a 6-well plate, transfecting pRetrox-c slc35b2-flag and VSVG plasmids in GP2-293 when the cell density reaches 70%, and transfecting the total amount of the plasmids according to 3 mu g according to the proportion of 1: 1; and (2) transfecting by using a transfection reagent Polyethyleneimine (PEI), changing the liquid after 8 hours of transfection, collecting cell culture supernatants of 48 hours and 72 hours of transfection, centrifuging at 4 ℃ at 12000 r/min for 10 minutes, collecting the supernatants, and filtering by using a 0.45 mu m filter to obtain the solution containing the retrovirus pRetrox-c slc35b 2-flag.

MDCK cell G418 antibiotic minimum kill concentration screening

The MDCK cells are paved into a 6-well plate, G418 antibiotics with different concentrations are added, 3 times of repetition are carried out, the lowest concentration capable of killing all the cells within 7 days is selected, the concentration is set as the sensitive concentration of the MDCK cells in later-stage screening, and the sensitive concentration of the MDCK cells tested in the experiment is 400 mu G/ml.

Table 3: minimum lethal concentration of G418 on MDCK cells

Note that: -: cell 0% dead, +: cells are approximately 20% dead, + +: cells were approximately 40% dead, and +++: cells are approximately 60% dead, and ++++: cells are approximately 80% dead, and ++++: cells were 100% dead.

4. Infection with retroviruses

MDCK-KO slc35b2 cells were seeded into 6-well plates, and when the cell density reached 80%, the harvested retrovirus was mixed with MDCK-KO slc35b2 cell culture medium at a volume ratio of 1:1 and inoculated into the wells, while a no-infection control was set. At 24h of retroviral infection, the medium of the infected group and the medium of the uninfected group are changed to the medium containing G418 with the final concentration of 400 mug/mL, the fresh medium is changed every 24h and the new G418 is added, and the cell states of the infected group and the control group are observed.

Western Blot for detecting SLC35B2 gene expression of cell line

When all the cells in the control group died, the surviving cells in the infected group were digested, a portion of the cells were lysed with SDS to prepare Western Blot samples, and the expression of the target gene in the cell line was detected by Western Blot (FIG. 12).

Example 3 Canine adenovirus infection and Virus titer determination Using the functionally inactivated SLC35b2 MDCK-KOSLC35b2 cell line and the slC35b2 Gene complementing cell line MDCK-KO + c slC35b2

1. Production of propagated adenovirus suspensions from different cell lines

Culturing MDCK-KOslc35b2, MDCK-KO + c slc35b2 and MDCK-WT until the growth log phase, discarding the old culture medium, washing with pancreatin, adding appropriate amount of pancreatin, sterilizing in 37 deg.C incubator for about 5min, discarding pancreatin, adding appropriate amount of serum-free DMEM culture medium, resuspending, and diluting to 5 × 10⁵And each/mL cell suspension is prepared and the processed CAV-2 virus suspension is connected to a 12-hole cell culture plate according to the proportion of 1000:1 and then is placed in a cell culture box for culture, each group is subjected to three-hole repetition and three time point repetition, after the cells are attached to the wall for 3 hours, the supernatant is discarded, and a DMEM maintenance culture medium containing 2% fetal calf serum is replaced to continuously place the cells in the cell culture box for observation.

After 24h, observation is carried out, and no obvious cytopathic effect occurs in the three groups of cells; the lesion is obviously strengthened along with the prolonging of the infection time to 48 hours; after 72h infection, MDCK-WT and MDCK-KO + c slc35b2 have a great deal of cell death and shedding, and MDCK-KOslc35b2 cytopathic effect is obviously slight compared with the other two groups, and a great deal of cells have normal morphology and good adherence (figure 13). Respectively reserving 200 mu L of cell suspension at 24h, 48h and 72h after infection, collecting cell precipitate, repeatedly freezing and thawing at-80 ℃ and normal temperature for three times, centrifuging at 12000rpm at 4 ℃ for 10min, and collecting supernatant, namely virus suspension obtained by proliferation of different cell lines.

2. Comparison of the titer of virus suspensions produced by different cell lines

MDCK-WT cells grown in log phase were counted by digestion and diluted to 2X 10⁵Spreading the cells/mL into a 96-well plate, removing the culture medium after the cells adhere to the wall for 3h, inoculating a virus stock solution used for infection and a supernatant collected at the time point into MDCK-WT cells in a manner of dilution and inoculation in a multiple ratio, and respectively determining the virus content.

The results showed that CAV-2 had the highest virus titer for 72h on MDCK-KOslc35b2 cells and that the highest virus titer on MDCK-KOslc35b2 cells was about 10-fold higher than that of MDCK-WT cells (FIG. 14). The MDCK-KOslc35b2 cell line constructed by the method is more suitable for the proliferation of the canine adenovirus vector, and the proliferation titer can be improved by about 10 times. The cell can improve the proliferation titer of the adenovirus vector, save the production cost and further improve the production efficiency.

Table 4: cell supernatant virus content determination

Positive pore ratio of cell

10^-1

10^-2

10^-3

10^-4

10^-5

10^-6

Reed-MuenchTCID₅₀

MDCK-WT 0H

4/8

0/8

1

MDCK-WT 24H

8/8

4/8

0/8

3

MDCK-WT 48H

8/8

2/8

0/8

4.75

MDCK-WT 72H

8/8

6/8

2/8

0/8

4.5

MDCK-KOslc35b2 0H

4/8

0/8

1

MDCK-KOslc35b2 24H

8/8

4/8

0/8

4

MDCK-KOslc35b2 48H

8/8

2/8

0/8

4.75

MDCK-KOslc35b2 72H

8/8

2/8

5.75

MDCK-KO+c slc35b2 0H

4/8

0/8

1

MDCK-KO+c slc35b2 24H

8/8

4/8

0/8

3

MDCK-KO+c slc35b2 48H

8/8

0/8

4.5 10^-4.5/0.1ml

MDCK-KO+c slc35b2 72H

8/8

0/8

4.5 10^-4.5/0.1ml

Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> construction and application of MDCK-KO slc35b2 gene function inactivation cell line suitable for adenovirus vector proliferation

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 155

<212> DNA

<213> dog (Pas)

<400> 1

gcaggggtct ctgcttcccc ctggtgaaaa cttgtgtgtt tggcaatgag cccaaggcct 60

ctgacgaggt ccctctgact tcgcggtctg agcctgcgga gaccactccc acttggcaag 120

ccctgaagct gctcttctgt gctgcggggc tccag 155

<210> 2

<211> 651

<212> DNA

<213> dog (Pas)

<400> 2

aagccctttc cagagtcatg gacgcagctg tggttcttcc gctttttggt gaacgctgct 60

ggctatgcca gctttatggt ccccggctac ctgatggtgc agtacttcag gcggaagaac 120

tacctggaga caggtatgtc cagaaagggt ggggtcagtg cgccaggtcc gttttttgag 180

tgctggccag cgctccaaag agggaggtag cttggagagg gagggaggga gggaggcctg 240

aaggcctgac ggggaggtgc tggggaggag agaagatctt gaccttgtgt gcttttttta 300

ggcaggggtc tctgcttccc cctggtgaaa acttgtgtgt ttggcaatga gcccaaggcc 360

tctgacgagg tccctctgac ttcgcggtct gagcctgcgg agaccactcc cacttggcaa 420

gccctgaagc tgctcttctg tgctgcgggg ctccaggtag gtaggcaggt gggcttcgct 480

tctctccctg ggttgggtcc tggtggacca agggactgtg tagaaccagt tttcacccca 540

ccagccccaa cagtttgcta gctagtgtgg cccccctcct cccaggggca cgcggtacca 600

tcatcttctg agaagtgggt ggaggaattg ctgtcttgtt tttgcctctt t 651

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctcagaccg cgaagtcaga 20

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

caccgctcag accgcgaagt caga 24

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aaactctgac ttcgcggtct gagc 24

Claims

1. An MDCK-KOslc35b2 cell line suitable for the propagation of adenoviral vectors, wherein: the SLC35B2 gene in the whole genome of the cell line is located on chromosome 12, and seven bases TCTGACT are continuously lacked on the second exon sequence of the SLC35B2 gene on one chromosome 12 in the whole genome of the cell line, and are located between the sites of 12857085 and 12857093 on the SLC35B2 gene sequence;

the second exon sequence of the SLC35B2 gene on the other chromosome at position 12 lacks seventeen bases GGTCCCTCTGACTTCGC in succession, and the seventeen bases GGTCCCTCTGACTTCGC are located between the sites 12857081-12857099 on the SLC35B2 gene sequence.

2. A method for constructing the MDCK-KOslc35b2 cell line suitable for adenoviral vector propagation according to claim 1, wherein the MDCK-KOslc 2 cell line comprises: the method comprises the following steps:

1) constructing a MDCK cell line stably expressing Cas9 protein;

3) lentiGuide-sgRNA slc35b2 lentivirus production targeting slc35b 2;

4) construction of mixed cells containing a mutation in slc35b2 gene;

3. The construction method according to claim 2, wherein: in the step 1), the construction method of the MDCK cell line stably expressing the Cas9 protein is as follows:

a. the 293FT cells are paved into a 6-well plate, plasmid pMD2.G, psPAX2 and lentiCas9-Blast packaged by lentivirus are co-transfected into the 293FT cells, the cells are collected and cultured after transfection, centrifugation is carried out, and the supernatant is the solution containing the lentivirus particles;

c. MDCK was plated in 6-well plates and, when adherent, was plated in a culture medium to lentiviral suspension volume ratio of 1: adding 1 to a 6-well plate, culturing cells, periodically replacing fresh complete culture medium, adding Blasticidin antibiotics according to the sensitive concentration of MDCK cells to screen positive cells, paving 1 cell/well in a 96-well plate, selecting cells growing rapidly under the sensitive concentration of Blasticidin antibiotics to expand, and obtaining the MDCK cell line for stably expressing Cas 9.

4. The construction method according to claim 2, characterized in that: in the step 2), the construction method of the mutant plasmid lentiGuide-sgRNAslc35b2 targeting the second exon of slc35b2 is as follows:

a. according to a sequence located on chromosome 12 of a dog, a sgRNA sequence with targeted mutation is designed and is GCTCAGACCGCGAAGTCAGA;

d-slc35b2-sgRNA-F:5’-CACCGCTCAGACCGCGAAGTCAGA-3’，

d-slc35b2-sgRNA-R:5’-AAACTCTGACTTCGCGGTCTGAGC-3’；

c. phosphorylation annealing is carried out on sequences d-slc35b2-sgRNA-F and d-slc35b2-sgRNA-R to form a double chain, namely, the double chain of the slc35b2-sgRNA of the targeting slc35b2 second exon containing BsmBI enzyme cutting site;

d. BsmBI is used for double digestion of lentiGuide-Puro plasmid vector, and lentiGuide-Puro fragments are obtained by recovery; connecting an slc35b2-sgRNA double chain of a targeting slc35b2 second exon with the recovered lentiGuide-Puro fragment to obtain a connecting product;

5. The construction method according to claim 4, wherein: in the step 2) and the step c, the phosphorylation annealing reaction system is as follows:

reacting at 37 ℃ for 30min, reacting at 95 ℃ for 5min, and carrying out gradient cooling phosphorylation annealing at 95-25 ℃.

6. The construction method according to claim 2, wherein: in the step 3), the lentiGuide-sgRNA slc35b2 lentivirus targeting slc35b2 is produced as follows:

7. The construction method according to claim 2, wherein: in the step 4), the screening method of the slc35b2 mutant MDCK cells is as follows

a. Transferring the MDCK cells obtained in step 1) into a 6-well plate so that the volume ratio of complete medium to cell suspension containing lentivirus-sgRNA slc35b2 is 1:1, adding the mixture into a 6-well plate, periodically replacing a fresh complete culture medium after culturing the cells for 24 hours, and adding puromycin antibiotics to screen positive cells according to the sensitive concentration of MDCK cells to puromycin antibiotics, namely the mixed cells containing the gene mutation of slc35b 2.

8. The construction method according to claim 2, wherein: in the step 5), the method for screening and identifying the MDCK-KO slc35b2 cell line with the function of the slc35b2 inactivated is as follows:

spreading the mixed cells containing the mutation of the slc35b2 gene into a 96-well plate according to 1 cell/well, screening monoclonal cells by using a limiting dilution method, and selecting the wells of the single cell clone for amplification culture; and growing the monoclonal cells; this is the MDCK-cell line.

9. Use of the MDCK-KOslc35b2 cell line suitable for adenoviral vector propagation according to claim 1 for the preparation of an adenoviral vector vaccine.