CN110592172A - Method and target for screening JEV resistance gene by using CRISPR/Cas9 knockout library technology - Google Patents

Abstract

The invention provides a method and a target for screening JEV resistance genes by using CRISPR/Cas9 knockout library technology. Specifically, the invention provides a method for screening JEV resistance-related genes based on a whole genome CRISPR/Cas9 knockout library strategy and a candidate target gene. According to the method, a sgRNA plasmid library containing a pig complete genome is used for packaging lentivirus, a pig somatic cell stably expressed by Cas9 is infected, and a complete genome gene knockout cell library is obtained through enrichment by flow cytometry. And infecting a knockout cell library by using JEV, collecting the survival cells, extracting genome DNA, carrying out PCR amplification, establishing a library and high-throughput sequencing, and finally analyzing by using bioinformatics to obtain tens of JEV resistance candidate functional genes. The invention establishes a method for screening the JEV disease-resistant gene of a pig based on a whole-gene CRISPR/Cas9 knockout library strategy, and the identified candidate gene target can be used for targeted drug development and disease-resistant breeding research for inhibiting JEV replication.

Description

Method and target for screening JEV resistance gene by using CRISPR/Cas9 knockout library technology

Technical Field

The invention relates to the field of animal disease resistance breeding, in particular to a method and a target for screening JEV resistance genes by using CRISPR/Cas9 knockout library technology.

Background

Animal diseases not only harm the livestock industry, but also harm human health. The common diseases of human and livestock, such as SARS, avian influenza, encephalitis B and the like, are a great threat to animals and human beings. How to control the infection and spread of pathogenic microorganisms is a hot issue that has been concerned in recent years.

Vaccination of susceptible herds is the best method to ensure that the vaccine is already available for prophylactic vaccination of infectious diseases. However, some viruses have rapid mutation and are difficult to control vaccines. The genetic improvement of the disease resistance of livestock and poultry so as to improve the health of the livestock and poultry and the safety of livestock products is a major problem which needs to be solved urgently by current animal genetic breeding scholars and is also a technical problem of livestock and poultry breeding which is valued by the nation.

At present, the gene of a host is modified by utilizing a gene editing and disease-resistant breeding means, so that the disease resistance of the host is improved, and the prevention of virus infection is successfully reported. Such as gene editing blue ear disease resistant pigs and anti-tuberculosis transgenic cattle. However, the key to this approach is the discovery of key host genes essential for infection by pathogenic microorganisms. Therefore, how to realize high-throughput screening of host key genes interacting with pathogenic microorganisms in animal cells is a core technical problem which needs to be solved urgently.

Epidemic encephalitis B (abbreviated as encephalitis B) is a zoonosis caused by Japanese Encephalitis Virus (JEV) infection, and belongs to the second class of animal epidemic diseases in China. After fulminant pig encephalitis B in a pig farm, the testis of a boar is swollen, and sperms can be infected with viruses through hybridization; miscarriage, stillbirth, mummy; encephalitis of newborn piglets, ataxia, fever and death. At present, no specific treatment medicine exists for the disease, measures need to be taken in time after the disease occurs, and the affected pig needs to be killed for harmless treatment.

Although the Japanese encephalitis vaccine is an effective measure for preventing epidemic Japanese encephalitis, no effective therapeutic drug exists at present because the JEV infection mechanism is not clear, and especially an effective molecular target is lacked.

Therefore, the development of new methods for realizing high-throughput screening of JEV resistance genes and targets for improving the disease resistance of animals, particularly pigs, to epidemic encephalitis B is urgently needed in the field.

Disclosure of Invention

It is an object of the present invention to provide a novel method for high throughput screening of JEV resistance genes in swine with a whole genome bias.

Another objective of the invention is to provide a target for improving animal epidemic encephalitis B disease resistance, especially pig epidemic encephalitis B disease resistance, and applications thereof. The key host genes which are screened and identified by the CRISPR library and participate in mediating JEV replication can be used as Japanese encephalitis medicament treatment or molecular targets for constructing anti-JEV replication cells or animal models.

In a first aspect of the invention, there is provided a method of determining a potential JEV resistance-associated gene, comprising the steps of:

(a) providing pig somatic cells (preferably kidney cells, and more preferably PK-15-Cas9) which stably express Cas9 and are infected and survive by recombinant viruses as a first cell bank, and pig somatic cells which do not express Cas9 as control cells, wherein the cells of the first cell bank and the control cells belong to the same type of somatic cells;

wherein the recombinant virus is a virus capable of infecting the somatic cells of the pig and is respectively used for expressing sgRNA sets (sgRNAs) consisting of different knockout sgRNAs targeting pig genes, wherein the sgRNA sets comprise N recombinant viruses targeting different pig genes, wherein N is a positive integer of more than or equal to 1000 (preferably, N is more than or equal to 5000, more preferably more than or equal to 20,000 or 10,000-;

(b) in the control group, infecting said control cells with Japanese Encephalitis Virus (JEV); and in the test group, infecting swine somatic cells (i.e., test cells) of said first cell bank with Japanese Encephalitis Virus (JEV), wherein the experimental conditions of the control group and the test group are the same or essentially the same;

(c) observing the survival of the control cells in the control group, and collecting the pig somatic cells surviving in the test group when the cell death rate D1 of the control group reaches a predetermined value (e.g., D1 ≥ 90%, preferably ≥ 95%, more preferably ≥ 99%, most preferably 100%);

(d) using said viable cells as test cells in a test set in a next round of testing, repeating steps (b) and (c), and performing a next round of testing, thereby obtaining viable cells in an R-th round, wherein R is a positive integer from 2 to 10 (preferably R is from 3 to 6, such as 3, 4 or 5);

(e) determining the kind of the knockout sgRNA enriched in the viable cells for the viable cells of the j round, wherein j is more than or equal to2 and less than or equal to R;

(f) based on the determined enriched species of the knockout sgRNA, the corresponding target gene is a potential JEV resistance-related gene.

In another preferred example, the method further comprises:

(g) functional verification was performed on the potential JEV resistance-associated genes determined in the previous step.

In another preferred example, the potential JEV resistance-related gene is a target gene corresponding to a knockout sgRNA with m% of enrichment ranking, wherein m is less than or equal to 5 (preferably, m is 2, 1, 0.5, 0.1).

In another preferred example, the potential JEV resistance-associated genes are selected from the genes of group a (the genes listed in table 1): ACP7, ARID5B, B3GAT3, B4GALT7, BHLHE41, BTAF1, CALR, CAVIN3, CCNB1IP1, CDK5R2, DAPK1, DMGDH, DOK1, DR1, EMC3, EMC6, EPB41L3, ERBB4, EXT1, EXT2, EXTL 2, FAM205 2, GAA, GLCE, GNA 2, GOSR 2, GPT2, GSTO2, HS6ST 2, KCNQ 2, LRRC2, MICROALL 2, ORAOV 2, PKP 2, PRKCF 145, RNF145, SEC 2, SERP 2, SLC25A 2, SLC26A 2, SLC35B2, SMHR 365, TAF 4672, TRBV2, ZNF 72, ZNF 11, RNF 36XDH 2, TRDH 2, TRXB 2, ZNF XLT 33, SLC2, SLC 36XLT 33, and TRXB 2.

In another preferred embodiment, the potential JEV resistance-associated gene is selected from the group B: SEC63, PRKCSH, SLC35B2, RNF145, SMOX, CALR, DMGDH, EXT2, B3GAT3 and GSTO 2. (3 rd wheel)

In another preferred embodiment, the potential JEV resistance-associated gene is selected from group C: SLC35B2, SMOX, RNF145, DMGDH, SEC63, EXT2, CALR, B3GAT3, EXT1 and PRKCSH. (4 th wheel)

In another preferred embodiment, the potential JEV resistance-associated gene is selected from group D: SEC63, PRKCSH, SLC35B2, RNF145, SMOX, CALR, DMGDH, EXT2, B3GAT 3. (repeated in rounds 3 and 4)

In another preferred embodiment, the potential JEV resistance-associated gene is from a pathway selected from the group consisting of: an endoplasmic reticulum protein processing pathway, a glycosaminoglycan (GAG) and synthetic Heparan Sulfate Proteoglycan (HSPG) pathway, a glycosaminoglycan (GAG) and synthetic chondroitin sulfate pathway, a metabolic signaling pathway, or a combination thereof.

In another preferred embodiment, the potential JEV resistance-associated genes include HSPG pathway-associated genes.

In another preferred embodiment, the potential JEV resistance-associated gene is selected from the group consisting of: SLC35B2, HS6ST1, B3GAT3, GLCE, or a combination thereof.

In another preferred embodiment, the recombinant virus is selected from the group consisting of: lentivirus, adenovirus, AAV virus, or combinations thereof.

In another preferred embodiment, the recombinant virus is prepared by a method comprising the steps of:

(v1) preparing a pig whole genome CRISPR/Cas9 knockout sgRNA virus library plasmid;

(v2) packaging the infectious virus with the sgRNA virus library plasmid, thereby forming the recombinant virus; and

(v3) optionally, performing a titer (or titer) determination on the recombinant virus.

In another preferred embodiment, the infectious virus is selected from the group consisting of: a lentivirus, an adenovirus, an AAV virus, or a combination thereof; more preferably a lentivirus.

In another preferred embodiment, the somatic cell comprises: kidney cells, ST testis cells, nerve cells.

In another preferred example, the first cell bank is a cell population consisting of somatic pig cells stably expressing Cas9 and infected and surviving with a recombinant virus, and there is gene knockout resulting from gene editing based on knockout of sgRNA in the cells of the first cell bank.

In another preferred embodiment, the first cell bank is prepared by a method comprising the steps of:

(w1) providing a porcine somatic cell stably expressing Cas9 and said recombinant virus;

(w2) infecting said porcine somatic cells stably expressing Cas9 (e.g., PK-15-Cas9) with said recombinant virus, thereby obtaining virally transfected porcine somatic cells;

(w3) swine somatic cells transfected with the recombinant virus and surviving are sorted to obtain a first cell bank (i.e., a mutant cell bank).

In another preferred example, in step (w3), a library of mutant cells is prepared by flow sorting and enrichment of GFP positive cells.

In another preferred example, determining the type of knockout sgRNA enriched in the viable cells is obtained by sequencing and bioinformatic analysis.

In another preferred example, in the method, 4 rounds of JEV challenge are performed, and cells from the mutant cell bank (first cell bank), and surviving cells infected with JEV of rounds 3 and 4 are subjected to PCR amplification and construction of a high throughput sequencing library, followed by identification of enriched sgrnas by bioinformatic analysis.

In another preferred embodiment, the method is an in vitro method.

In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

In the second aspect of the present invention, there is provided a use (pharmaceutical use) of a JEV resistance promoter for the preparation of a compound or a pharmaceutical composition against Japanese encephalitis, or for the preparation of a preparation against Japanese encephalitis model animals,

wherein, the JEV resistance promoter is an inhibitor of a JEV resistance-related gene or a protein coded by the gene (namely, a JEV resistance-related protein),

the JEV resistance-associated gene is a gene determined by the method of the first aspect of the invention or the JEV resistance-associated gene is selected from group a.

In another preferred embodiment, the inhibitor is selected from the group consisting of: an antibody or small molecule inhibitor targeting a JEV resistance-associated protein, a nucleic acid molecule or gene editor targeting a JEV resistance-associated gene, or a combination thereof.

In another preferred embodiment, the gene editor comprises a DNA gene editor and an RNA gene editor.

In another preferred example, the gene editor comprises a gRNA and a gene editing protein.

In another preferred example, the gRNA is an RNA that directs the gene editing protein to specifically bind a JEV resistance-associated gene.

In another preferred example, the gRNA directs gene editing proteins to specifically bind to the nucleotide sequence of a JEV resistance-associated gene.

In another preferred embodiment, the gene-editing protein is selected from the group consisting of: cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof.

In another preferred embodiment, the JEV resistance-associated gene is selected from the group consisting of genes of group B or group C.

In another preferred embodiment, the JEV resistance-associated gene is from a pathway selected from the group consisting of: an endoplasmic reticulum protein processing pathway, a glycosaminoglycan (GAG) and synthetic Heparan Sulfate Proteoglycan (HSPG) pathway, a glycosaminoglycan (GAG) and synthetic chondroitin sulfate pathway, a metabolic signaling pathway, or a combination thereof.

In another preferred embodiment, the JEV resistance-associated gene comprises an HSPG pathway-associated gene.

In another preferred embodiment, the JEV resistance-associated gene is selected from the group consisting of: SLC35B2, HS6ST1, B3GAT3, GLCE, or a combination thereof.

In a third aspect of the invention, there is provided a composition comprising:

(a) a gene-editing protein or an expression vector thereof, said gene-editing protein selected from the group consisting of: cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof; and

(b) a gRNA or an expression vector thereof, wherein the gRNA is an RNA that directs the gene-editing protein to specifically bind a JEV resistance-associated gene,

wherein said JEV resistance-associated gene is determined by the method of the first aspect of the invention; or the JEV resistance-associated gene is selected from the genes of group a.

In another preferred example, the gRNA directs gene editing proteins to specifically bind to the nucleotide sequence of the JEV resistance-associated gene.

In another preferred embodiment, the JEV resistance-associated gene is selected from the genes of group B or group C.

In another preferred embodiment, the JEV resistance-associated gene is from a pathway selected from the group consisting of: an endoplasmic reticulum protein processing pathway, a glycosaminoglycan (GAG) and synthetic Heparan Sulfate Proteoglycan (HSPG) pathway, a glycosaminoglycan (GAG) and synthetic chondroitin sulfate pathway, a metabolic signaling pathway, or a combination thereof.

In another preferred embodiment, the JEV resistance-associated gene comprises an HSPG pathway-associated gene.

In another preferred embodiment, the JEV resistance-associated gene is selected from the group consisting of: SLC35B2, HS6ST1, B3GAT3, GLCE, or a combination thereof.

In another preferred embodiment, the composition comprises a pharmaceutical composition.

In another preferred embodiment, the composition further comprises:

(c) other active ingredients of the medicine for preventing and/or treating epidemic encephalitis B.

In another preferred embodiment, said expression vector in said component (a) and/or (b) comprises a viral vector.

In another preferred embodiment, the viral vector is selected from the group consisting of: adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, herpes virus, SV40, poxvirus, or combinations thereof.

In another preferred embodiment, the viral vector is selected from the group consisting of: lentivirus, adenovirus, adeno-associated virus (AAV), or a combination thereof, preferably, the vector is adeno-associated virus (AAV).

In another preferred embodiment, the dosage form of the composition is selected from the group consisting of: a lyophilized formulation, a liquid formulation, or a combination thereof.

In another preferred embodiment, the composition is in the form of a liquid formulation.

In another preferred embodiment, the composition is in the form of an injectable formulation.

In another preferred example, the expression vector of the gene editing protein and the expression vector of the gRNA are the same vector or different vectors.

In another preferred embodiment, the weight ratio of the component (a) to the component (b) is 100:1 to 0.01:1, preferably 10:1 to 0.1:1, more preferably 2:1 to 0.5: 1.

In another preferred embodiment, the content of the component (a) in the composition is 0.0001 to 99 wt%, preferably 0.1 to 90 wt%, more preferably 1 to 70 wt%.

In another preferred embodiment, the content of the component (b) in the composition is 0.0001 to 99 wt%, preferably 0.01 to 90 wt%, more preferably 0.1 to 70 wt%.

In another preferred embodiment, the content of the component (c) in the composition is 0.1 to 99 wt%, preferably 10 to 90 wt%, more preferably 30 to 70 wt%.

In another preferred embodiment, the component (a) and the component (b) and optionally the component (c) in the composition represent 0.01 to 99.99 wt%, preferably 0.1 to 90 wt%, more preferably 1 to 80 wt% of the total weight of the composition.

In a fourth aspect of the invention, there is provided a kit comprising:

(a1) a first container, and a gene-editing protein or an expression vector thereof located in the first container, the gene-editing protein selected from the group consisting of: cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof;

(b1) a second container, and a gRNA or an expression vector thereof located in the second container, the gRNA being a nucleotide sequence that directs a gene editing protein to specifically bind to a JEV resistance-associated gene,

wherein said JEV resistance-associated gene is determined by the method of the first aspect of the invention; or the JEV resistance-associated gene is selected from the genes of group a.

In another preferred embodiment, the kit further comprises:

(c1) a third container, and other pharmaceutical active ingredients for preventing and/or treating epidemic encephalitis B in the third container.

In another preferred embodiment, the first container, the second container and the third container are the same or different containers.

In another preferred embodiment, in the third container, the pharmaceutically active ingredient is present in the form of a pharmaceutical formulation (including a single formulation or a compound formulation).

In another preferred embodiment, the dosage form of the drug is selected from the group consisting of: a lyophilized formulation, a liquid formulation, or a combination thereof.

In another preferred embodiment, the dosage form of the drug is an oral dosage form or an injection dosage form.

In another preferred embodiment, the kit further comprises instructions.

In a fifth aspect of the invention, there is provided a use (pharmaceutical use) of the composition of the third aspect of the invention or the kit of the fourth aspect, for the manufacture of (i) a medicament for the prevention and/or treatment of epidemic encephalitis b, or (ii) a medicament for inhibiting JEV virus infection.

In another preferred embodiment, the medicament is administered to a human or non-human mammal.

In another preferred embodiment, the non-human mammal includes pig and rodent.

In another preferred embodiment, the preventing and/or treating of epidemic encephalitis b comprises increasing disease resistance of a human or non-human mammal to a JEV viral infectious disease, ameliorating a symptom of the JEV viral infectious disease.

In another preferred example, the JEV viral infectious disease comprises human epidemic encephalitis b, and/or swine epidemic encephalitis b, particularly swine epidemic encephalitis b.

In another preferred example, the inhibiting JEV viral infection comprises blocking or reducing replication of Japanese Encephalitis Virus (JEV) in a host cell.

In another preferred embodiment, the source of the host cell is selected from pig, mouse, rat and/or monkey.

In another preferred embodiment, the source of the host cell is selected from pigs.

In another preferred embodiment, the cells comprise somatic cells.

In another preferred embodiment, the host cell is selected from porcine kidney cells (e.g., PK-15).

In another preferred embodiment, the JEV virus comprises a wild type and a mutant.

In a sixth aspect of the invention, there is provided an isolated genetically engineered cell resistant to infection by a JEV virus, which cell is a somatic cell, and in which an endogenous JEV resistance-associated gene is knocked out or knocked down, such that expression or activity of an endogenous JEV resistance-associated protein is decreased,

wherein said JEV resistance-associated gene is determined by the method of the first aspect of the invention; or the JEV resistance-associated gene is selected from the genes of group a.

In another preferred embodiment, the JEV resistance-associated protein is not expressed at all or is not substantially expressed in the genetically engineered cell.

In another preferred embodiment, the cell comprises a human or porcine cell.

In another preferred embodiment, the cell is selected from porcine kidney cells (e.g., PK-15).

In another preferred example, the nucleic acid sequence of the JEV resistance-associated gene has a frame shift mutation or premature termination in the genome of the genetically engineered cell.

In another preferred embodiment, 3n-1, or 3n-2 bases are inserted or deleted in the ORF nucleic acid sequence of the JEV resistance-associated gene of the cell, and n is a positive integer.

In another preferred embodiment, the cell has 1, 2, 4 or 5 base insertions and/or deletions in the ORF nucleic acid sequence of the JEV resistance-associated gene R.

In another preferred embodiment, the cell is subjected to gene knockout by a method selected from the group consisting of: meganuclease (Meganuclease) method, Zinc Finger Nuclease (ZFN) method, transcription activator-like effector nuclease (TALEN) method, and clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) gene editing method.

In another preferred example, the method is to directly perform frame shift mutation on the JEV resistance related gene by using CRISPR/Cas 9.

In another preferred embodiment, the JEV resistance-associated gene is selected from the genes of group B or group C.

In another preferred embodiment, the JEV resistance-associated gene is from a pathway selected from the group consisting of: an endoplasmic reticulum protein processing pathway, a glycosaminoglycan (GAG) and synthetic Heparan Sulfate Proteoglycan (HSPG) pathway, a glycosaminoglycan (GAG) and synthetic chondroitin sulfate pathway, a metabolic signaling pathway, or a combination thereof.

In another preferred embodiment, the JEV resistance-associated gene comprises an HSPG pathway-associated gene.

In another preferred embodiment, the JEV resistance-associated gene is selected from the group consisting of: SLC35B2, HS6ST1, B3GAT3, GLCE, or a combination thereof.

In a seventh aspect of the present invention, there is provided a culture system against epidemic encephalitis b, comprising:

(a) a JEV virus; and

(b) an isolated genetically engineered cell resistant to infection by a JEV virus according to the sixth aspect of the invention.

In another preferred embodiment, the culture system further comprises a culture medium.

In an eighth aspect of the present invention, there is provided a method for preparing a non-human mammal against epidemic encephalitis b, comprising the steps of:

(m1) providing a non-human mammalian cell, inactivating JEV resistance-associated proteins in said cell to obtain a CALR protein-inactivated non-human mammalian cell; and

(m2) preparing a non-human mammal against epidemic encephalitis B with inactivated JEV resistance-associated protein by using the CALR protein inactivated cells obtained in the step (m 1).

In another preferred example, the cells in step (m1) are somatic cells, preferably, fibroblasts.

In another preferred example, the step (m1) further includes: screening monoclonal cell strains with homozygous inactivation existing at JEV resistance related gene loci.

In another preferred embodiment, the method of screening for a monoclonal cell line of homozygotes comprises manual selection, preferably by flow sorting techniques.

In another preferred example, the method further comprises: (m3) crossing the non-human mammal obtained in step (m2) to obtain homozygous progeny that are CALR inactivated.

In another preferred embodiment, the non-human mammal is a pig.

In a ninth aspect of the present invention, there is provided an engineered non-human mammal against epidemic encephalitis b, in which an endogenous JEV resistance-associated gene is knocked out or knocked down in a somatic cell of the non-human mammal, so that expression or activity of an endogenous JEV resistance-associated protein is decreased.

In another preferred embodiment, the non-human mammal is prepared by the method of the eighth aspect of the invention.

In another preferred embodiment, the non-human mammal is selected from the group consisting of: pig, rodent (e.g., mouse, rat).

In another preferred embodiment, the non-human mammal is a pig.

In a tenth aspect of the present invention, there is provided a method of screening a candidate compound for preventing and/or treating epidemic encephalitis b, the method comprising the steps of:

(a3) in the test group, adding a test compound to a culture system of cells, and observing the expression amount (E1) and/or activity (A1) of the JEV resistance-associated protein in the cells of the test group; in the control group, no test compound was added to the culture system of the same cells, and the expression amount (E0) and/or activity (a0) of the JEV resistance-related protein in the cells of the control group was observed;

wherein, if the expression level (E1) and/or activity (A1) of the JEV resistance-associated protein of the cells in the test group is significantly lower than that of the control group, it is indicated that the test compound is a candidate compound for preventing and/or treating epidemic encephalitis B, which has an inhibitory effect on the expression and/or activity of the JEV resistance-associated protein.

In another preferred example, the expression level of the JEV resistance-associated protein is determined by qPCR method.

In another preferred embodiment, the JEV resistance-associated protein comprises a protein encoded by a JEV resistance-associated gene selected from group a, group B, or group C.

In another preferred embodiment, the JEV resistance-associated protein is selected from the group consisting of: SLC35B2 protein, HS6ST1 protein, B3GAT3 protein, GLCE protein, or a combination thereof.

In another preferred example, the method further comprises the steps of:

(b3) with respect to the candidate compound obtained in the step (a3), it was further tested whether it has an inhibitory effect on Japanese Encephalitis Virus (JEV) replication in the host cell.

In another preferred embodiment, the method comprises the step (c 3): administering the candidate compound identified in step (a3) to a non-human mammalian model and determining whether the candidate compound has inhibitory effect on Japanese encephalitis virus infected mammals.

In another preferred example, the non-human mammal has epidemic encephalitis B, or the non-human mammal has been vaccinated or is to be vaccinated with Japanese encephalitis virus.

In another preferred embodiment, the phrase "substantially less than" means E1/E0 ≦ 1/2, preferably ≦ 1/3, more preferably ≦ 1/4.

In another preferred embodiment, the phrase "substantially less than" means A1/A0 ≦ 1/2, preferably ≦ 1/3, more preferably ≦ 1/4.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

Figure 1 shows a flow chart for screening JEV resistance genes based on the pig whole genome CRISPR/Cas9 knockout library strategy. The general flow is as follows: packaging pig genome-wide sgRNA lentivirus, wherein the number of sgRNA is 85,674. Infecting a PK-15 cell that stably expresses Cas9 (PK-15-Cas 9); after infection for 2 days, GFP positive cells are screened by a flow cytometer, after a mutant cell bank is obtained by continuously culturing for 7 days, part of the cells are taken to extract genome DNA, a certain amount of the cells are taken to be infected by Japanese encephalitis virus JEV, the stored living cells are taken and subjected to 4 successive rounds of JEV virus challenge experiments, the cell genome DNA is respectively extracted, PCR amplification and DNA sequencing library preparation are carried out, bioinformatics analysis is carried out on high-throughput sequencing data, and the enriched sgRNA and target gene signal path analysis are identified.

FIG. 2 shows the assessment of the optimal level of infection by JEV in PK-15 cells. A. Comparing cytopathic effects of Japanese encephalitis virus JEV with different multiplicity of infection MOI to infect PK-15 cells; B. the expression of the NS3 protein encoded by JEV in PK-15 cells is detected by using an indirect immunofluorescence experiment.

Figure 3 shows the identification of JEV resistance genes using a pig genome-wide CRISPR/Cas9 knock-out library strategy. A. The sgRNA target genes are obviously enriched in the survival cells after JEV challenge in the 3 rd round; B. the sgRNA target genes are obviously enriched in the survival cells after JEV challenge in the 4 th round; C. wien graph analysis of sgRNA target genes significantly enriched in 0.1% of survivors after JEV challenge in rounds 3 and 4; D. wien graph analysis of sgRNA target genes significantly enriched in 0.5% of the top-ranked surviving cells after JEV challenge in rounds 3 and 4.

FIG. 4 shows the analysis of signal pathways significantly enriching sgRNA target genes in 0.5% of the top-ranked surviving cells after JEV challenge in rounds 3 and 4

Fig. 5 shows that significantly enriched sgRNA target genes are associated with HSPG synthesis and metabolic pathways. A. Analyzing the significantly enriched sgRNA target gene and GAG, HSPG synthesis and metabolic pathway gene Wein diagram; analyzing the difference multiple of the HSPG signal channel related genes; C. a pattern of target genes involved in the HSPG synthesis pathway; D. schematic diagram of pathways involved in HSPG sulfylation modification.

FIG. 6 shows that the knock-out of the HSPG pathway-related gene SLC35B2, HS6ST1, B3GAT3 or GLCE can significantly inhibit the replication of JEV in PK-15 cells. Sequencing results of slc35b2, HS6ST1, B3GAT3 or GLCE knockout cell lines; B. the virus plaque experiment evaluates the inhibition effect of SLC35B2, HS6ST1, B3GAT3 or GLCE knockout cells on JEV replication; C. an indirect immunofluorescence experiment is used for evaluating the effect of SLC35B2, HS6ST1, B3GAT3 or GLCE knockout cells on inhibiting JEV replication; D. an absolute quantitative PCR experiment is used for evaluating the JEV replication inhibition effect of SLC35B2, HS6ST1, B3GAT3 or GLCE knockout cells; E. indirect immunofluorescence experiments assessed changes in the level of HSPG sulfanyl modification in SLC35B2 and HS6ST1 knockout cells. DAPI: cell nucleus; a scale: 100 μm.

FIG. 7 shows that the knock-out of SLC35B2, HS6ST1, B3GAT3 or GLCE gene did not affect the normal proliferation of PK-15 cells. DAPI: cell nucleus; a scale: 100 μm.

Detailed Description

After extensive and intensive studies, the present inventors have for the first time developed a method for screening a virus resistance gene of swine at high throughput. Specifically, the pig genome-wide CRISPR/Cas9 knockout library strategy is adopted, and the JEV resistance gene is screened in high flux under the optimized JEV infection condition, so that the gene capable of regulating (particularly improving) the virus resistance of the pig is determined efficiently. Experiments show that the gene screened by the method can inhibit the replication of JEV so as to improve the resistance of pigs to the JEV, and therefore, the gene can be used as a new molecular target for inhibiting the replication of the JEV. On this basis, the inventors have completed the present invention.

Description of the terms

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

Epidemic encephalitis B and Japanese encephalitis virus

Epidemic encephalitis B (abbreviated as encephalitis B) is a zoonosis caused by Japanese Encephalitis Virus (JEV) infection, and belongs to the second class of animal epidemic diseases in China. Epidemic encephalitis B is a neurologically transmitted disease that seriously harms human and animal health. Mosquitoes are intermediate transmission media of the disease, and the disease is transmitted mainly by the sick pigs bitten by the poisonous mosquitoes, and is widely transmitted in the pig farm in the form of mosquitoes, pigs and mosquitoes. Therefore, the Japanese encephalitis of the pig has typical seasonality, is mostly generated in summer and autumn with more mosquitoes and mass propagation, and belongs to natural epidemic diseases. After fulminant pig encephalitis B in a pig farm, the testis of a boar is swollen, and sperms can be infected with viruses through hybridization; miscarriage, stillbirth, mummy; encephalitis of newborn piglets, ataxia, fever and death.

Japanese encephalitis virus belongs to the Flaviviridae family (Flaviviridae) of the genus Flaviviridae. JEV is a single-stranded positive-strand RNA virus, which is spherical and has an envelope, the total length of the virus is about 11kb, the virus consists of 3432 amino acids, and 3 structural proteins are coded and respectively include envelope glycoprotein E, non-glycosylated envelope protein M (PrM membrane precursor) and capsid protein C (core protein); 7 non-structural proteins (NS1, NS2a, NS2b, NS3, NS4a, NS4b and NS5), wherein PrM protein and E protein have immunogenicity, can induce the body to generate durable antibodies and T memory cells, and envelope protein E has 8 antigenic determinants and can display the property of encephalitis B.

Inactivation of genes

Many methods are available for the study of genes of unknown function, such as inactivation of the gene to be studied, analysis of the resulting genetically modified phenotypic change, and subsequent acquisition of functional information about the gene. Another advantage of this approach is that it can correlate gene function with disease, thus obtaining both gene function and disease information and animal models of disease that the gene can treat as a potential drug or drug target. The gene inactivation method can be realized by means of gene knockout, gene interruption or gene insertion. Among them, gene knockout technology is a very powerful means for studying the function of human genes in the whole.

As used herein, the terms "gene inactivation", "gene knockout", and the like, are used interchangeably and refer to genetic manipulation such as disruption, knockout, etc. of a certain gene of interest, such that the expression and/or activity of the gene of interest is substantially reduced or even completely lost.

Gene editor

In the present invention, the gene editor includes a DNA gene editor and an RNA gene editor. In a preferred embodiment, the gene editor of the invention comprises a gene editing protein and optionally a gRNA.

Gene editing proteins

In the present invention, the nucleotide of the gene-editing protein can be obtained by genetic engineering techniques such as genome sequencing, Polymerase Chain Reaction (PCR), etc., and the amino acid sequence thereof can be deduced from the nucleotide sequence. In a preferred embodiment of the present invention, the gene-editing proteins include, but are not limited to, Cas13, Cpf1, SaCas9, Cas13a, Cas13b, Cas13 c.

Expression of

As used herein, the term "expression" includes the production of mRNA from a gene or portion of a gene, and includes the production of protein encoded by an RNA or gene or portion of a gene, as well as the presence of a test substance associated with expression. For example, cDNA, binding of a binding partner (e.g., an antibody) to a gene or other oligonucleotide, protein or protein fragment, and chromogenic moieties of the binding partner are included within the scope of the term "expression". Thus, an increase in the density of half-spots on immunoblots such as western blots is also within the scope of the term "expression" based on biological molecules.

CRISPR/Cas system

The CRISPR/Cas system (Clustered regulated short palindromic repeats/CRISPR-associated protein) is an acquired immune defense mechanism against foreign gene invasion in prokaryotes. Has evolved from bacteria and archaea in the process of defending against the invasion of foreign viruses and bacteriophages. The system can integrate DNA fragments of foreign invasion hosts into CRISPR sites, and then guide Cas endonuclease to cut foreign DNA sequences through corresponding CRISPR RNAs (crRNAs), so as to resist the invasion of viruses or phages. The CRISPR/Cas gene cluster consists of a series of encoding genes of Cas proteins (Cas1, Cas2, Cas4 and effector proteins such as Cas9, Cpf1 and the like) and a section of CRISPR sequence,

CRISPR sequences consist of a leader (leader), a number of short and conserved repeat regions (repeat), and a spacer (spacer). The repeated sequence region contains a palindrome sequence and can form a hairpin structure. And the spacer is the foreign DNA sequence captured by the host. These trapped foreign DNA sequences correspond to the "black list" of the immune system, and when these foreign genetic material re-invades the host, the bacteria begin to transcribe CRISPR, forming a primary transcription product pre-crRNA, which is cleaved by ribonuclease or Cas protein within the repeat site to form mature crRNA, which forms a ribonucleoprotein complex with a specific CRISPR effector protein, recognizes and cleaves foreign DNA that is capable of complementary pairing with the crRNA, causing double strand breaks, initiating self-repair of the host cell.

CRISPRs are classified into type 2 and type 5, 16 subtypes in total, according to the composition of Cas genes and the number of effector proteins. Class 1 is CRISPR/Cas system that uses multiple effector protein complexes to interfere with target genes, including types i, iii and IV; class 2 is the CRISPR/Cas system that interferes with a target gene using a single effector protein, including type ii and type v. The most widely studied and utilized is the type 2 ii, i.e., CRISPR/Cas9 system. The system successfully achieved gene editing in mammalian cells in 2013. Type ii systems can utilize a single Cas9 nuclease to precisely and sufficiently cleave DNA target sites via crRNA guidance. The system is simple to operate, short in experimental period, high in efficiency and widely applicable to multiple species. The system needs to design a special guide RNA, namely sgRNA (single guide RNA), and the sequence of the sgRNA is designed to be about 20nt of nucleotide sequence of PAM (NGG) region in genome sequence. Under the guidance of sgRNA, Cas9 protein can perform site-directed cleavage on genome, cause DNA double strand break, activate two repair mechanisms of Non-Homologous end joining (NHEJ) or Homologous Recombination (HR) of cells, thereby realizing gene knockout, random fragment deletion or insertion, or utilize specific template repair, thereby realizing permanent modification of genome.

CRISPR/Cas9 knockout libraries

The high-throughput screening of functional genes by using a Loss-of-function (Loss-of-function) or Gain-of-function (Gain-of-function) strategy is a main method for rapidly searching important or key genes for regulating and controlling a specific phenotype, and the high-throughput screening of the functional genes based on a CRISPR/Cas9 system knockout library is one of the best strategies. By combining virus infection positive screening and applying certain screening pressure to a cell library successfully integrating the sgRNA, only a few phenotypic cells can survive, and the aim of enriching key genes can be achieved.

JEV resistance-associated genes and proteins

The method of the invention firstly and efficiently screens various JEV resistance related genes and coding proteins thereof (namely JEV resistance related proteins)

Typically, in the methods of the invention, the potential JEV resistance-associated gene is the target gene corresponding to the knockout sgRNA with the highest enrichment, e.g., the top m% of the species, where m is less than or equal to 5 (preferably, m is 2, 1, 0.5, 0.1)

Typical JEV resistance-associated genes include JEV resistance-associated genes selected from group a, group B or group C.

The studies of the present invention indicate that the majority of potential JEV resistance-related genes are from pathways selected from the group consisting of: an endoplasmic reticulum protein processing pathway, a glycosaminoglycan (GAG) and synthetic Heparan Sulfate Proteoglycan (HSPG) pathway, a glycosaminoglycan (GAG) and synthetic chondroitin sulfate pathway, a metabolic signaling pathway, or a combination thereof.

In the present invention, some potential genes associated with JEV resistance were further confirmed by functional experiments, which indicates the effectiveness of the method of the present invention.

Preferred JEV resistance-associated genes are selected from the group consisting of: SLC35B2, HS6ST1, B3GAT3, GLCE, or a combination thereof.

JEV resistance promoter and pharmaceutical composition

By utilizing the protein of the invention, substances, particularly inhibitors and the like, which interact with the gene or protein of the JEV resistance-related gene can be screened out by various conventional screening methods.

Inhibitors (or antagonists) useful in the present invention for increasing JEV resistance include any substance that can inhibit the expression and/or activity of a JEV resistance-associated gene or its encoded protein.

For example, the inhibitors include: an antibody, an antisense RNA of a JEV resistance-associated gene, an siRNA, an shRNA, an miRNA, a gene editor, or an inhibitor of the activity of a JEV resistance-associated protein. A preferred inhibitor is a gene editor capable of inhibiting the expression of a gene associated with JEV resistance.

Preferably, the inhibitor of the present invention comprises an inhibitor targeting a JEV resistance-associated gene sequence. The object on which the inhibitor of the present invention acts includes somatic cells, particularly somatic cells with high expression of the JEV resistance-related gene.

In a preferred embodiment, a method of increasing JEV resistance or inhibiting JEV replication comprises the steps of: neutralizing JEV resistance related protein by using a specific antibody, or silencing or knocking out a JEV resistance related gene by using shRNA or siRNA or a gene editor carried by a virus (such as adeno-associated virus).

The inhibition rate of the gene related to the JEV resistance is generally at least 50% inhibition, preferably 60%, 70%, 80%, 90% or 95% inhibition, and the inhibition rate can be controlled and detected based on conventional techniques, such as flow cytometry, fluorescent quantitative PCR or Western blot.

The inhibitor of the JEV resistance-related protein (including an antibody, an antisense nucleic acid, a gene editor and other inhibitors) can inhibit the expression and/or activity of the JEV resistance-related protein when being applied (dosed) on treatment, and further inhibit the replication of JEV virus, thereby preventing and/or treating epidemic encephalitis B. Generally, these materials will be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally from about 5 to about 8, preferably from about 6 to about 8, although the pH will vary depending on the nature of the material being formulated and the condition being treated. The formulated pharmaceutical compositions may be administered by conventional routes including, but not limited to: topical, intramuscular, intraperitoneal, intravenous, subcutaneous, intradermal, topical administration, autologous cell extraction culture followed by reinfusion, etc.

The invention also provides a pharmaceutical composition comprising a safe and effective amount of an inhibitor of the invention (e.g., an antibody, gene editor, antisense sequence (e.g., siRNA), or inhibitor) and a pharmaceutically acceptable carrier or excipient. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should be compatible with the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions, such as tablets and capsules, can be prepared by conventional methods. Pharmaceutical compositions such as injections, solutions, tablets and capsules are preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount, for example, from about 1 microgram to 10 milligrams per kilogram of body weight per day.

In the present invention, suitable modes of administration include (but are not limited to): oral administration, intravenous injection, intraperitoneal injection, subcutaneous injection, vertebral canal administration or direct intracerebral injection.

The technical scheme of the invention has the following main beneficial effects:

1. the invention provides a method for screening JEV resistance genes at high flux and high efficiency based on a pig whole genome CRISPR/Cas9 knockout library strategy for the first time.

2. Based on the strategy of a pig whole genome CRISPR/Cas9 knockout library, 51 candidate genes participating in mediating JEV replication are screened and identified for the first time, and the candidate genes (including further verified genes) can be used as molecular targets for drug development or preparation of gene editing disease-resistant animal models.

3. The invention verifies for the first time that the copy of JEV can be obviously inhibited by knocking out SLC35B2, HS6ST1, B3GAT3 or GLCE genes.

The invention is further illustrated with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring Harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Example 1: experimental flow for screening resistance genes of JEV (Japanese encephalitis Virus) by utilizing pig genome-wide CRISPR/Cas9 knockout library technology

In order to screen host factors involved in mediating JEV infection and thereby inducing cell death using a whole genome unbiased strategy, an experimental procedure was developed as shown in fig. 1, comprising the steps of:

(1) preparing a pig genome-wide CRISPR/Cas9 knockout sgRNA lentiviral library plasmid, packaging lentivirus and determining titer;

(2) infecting a PK-15 cell stably expressing Cas9 (PK-15-Cas9) with an appropriate amount of sgRNA lentivirus;

(3) GFP positive cells are enriched through flow sorting, and a mutant cell bank is prepared;

(4) respectively infecting PK-15-Cas9 (a control group) and mutant cells which are not treated by JEV, observing cytopathic effect, and collecting survival cells after the cells of the control group are all dead; performing JEV challenge experiments of 2 nd, 3 rd and 4 th rounds on the survival cells obtained in the previous round;

(5) performing PCR amplification and constructing a high-throughput sequencing library on the mutant cell bank and the JEV-infected surviving cells of the 3 rd round and the 4 th round, and then identifying the enriched sgRNA through bioinformatics analysis;

(6) and performing functional verification on the target gene corresponding to the screened sgRNA.

It is noteworthy that the porcine CRISPR/Cas9 knockout library employed in this example contained a total of 85,674 sgrnas, including sgrnas for 17,743 protein-encoding genes, 11,053 lncrnas and 551 mirnas, and 1,000 negative control sgrnas (see CN 201710533398.9).

Example 2: optimization of optimal infection conditions of Japanese encephalitis virus JEV on PK-15 cells

2.1 infection experiments

JEV encephalitis B viruses with MOI of 0.01, 0.05 and 0.1, respectively, were inoculated to monolayer confluent PK-15 cells and cultured in an incubator at 37 ℃ for 3 days.

As can be seen from FIG. 2A, the JEV-inoculated cells all developed cytopathic effects (CPE) as compared to the uninfected control group, and the degree of pathology increased with the increase in viral titer. As time goes on, PK-15 cells in different infection dose groups die. This indicates that JEV infection and resulting PK-15 cytopathy and death are dose-dependent.

2.2 Indirect immunofluorescence assay

The protein expression of JEV-encoded NS3 was examined after the inoculation of PK-15 cells with JEV to evaluate the infection efficiency of JEV. Inoculating PK-15 cells into a six-hole plate culture plate one day before an experiment, inoculating JEV when the cell density grows to 70-80%, and setting a negative control group without virus infection; after JEV inoculation, 1mL of serum-free DMEM medium is added into each well, and the mixture is cultured for 1.5h at 37 ℃; then, the old culture medium is removed by suction, and is replaced by a DMEM low-sugar fresh culture medium containing 1% of double antibody and 2% of FBS, and the culture is continued for 4 days; after the cells have obvious pathological changes, carrying out an indirect immunofluorescence experiment.

The experimental steps are as follows: (1) washing cells with precooled PBS for 2 times, adding precooled 4% paraformaldehyde, and standing at room temperature for 15 min; (2) sucking out paraformaldehyde, washing cells for 2 times with precooled PBS, adding precooled 0.3% TritonX-100, standing at room temperature for 10min, and sucking out TritonX-100; (3) adding precooled PBS, incubating for 5min at room temperature by shaking table, and repeating the step for 3 times; (4) sucking out PBS, adding confining liquid, and incubating at room temperature for 1-2 h; (5) sucking out the sealing liquid, washing the cells, and performing the step 3; (6) dilutions were made with reference to NS3 antibody instructions. Adding NS3 antibody diluent, and incubating overnight at 4 ℃; (7) sucking out the antibody diluent, washing cells, and performing a synchronous step 3; (8) dilutions were made according to secondary antibody instructions. Adding a secondary antibody diluent, and incubating for 1-2h in a shaking table at room temperature in a dark place; (9) sucking out the secondary antibody diluent, washing cells, and performing a synchronous step 3; (10) and (3) cell nucleus staining: adding DAPI, and dyeing for 10min at room temperature in dark; (11) sucking out DAPI, washing cells by PBS, and synchronously performing step 3; (12) 1mL of PBS was added and fluorescence was observed under a fluorescence microscope.

The results show (fig. 2B): after the PK-15 cells are infected by the JEV, the NS3 protein expression is completely overlapped with cell nucleus DAPI staining, and the JEV is shown to be contained in all the cells, thereby indicating that the JEV infection efficiency is high.

Example 3: high-throughput sequencing and biological signal analysis of mutant cells surviving multiple rounds of JEV infection

3.1 packaging of sgRNA Lentiviral libraries for lentivirus and preparation of PK-15 mutant cell banks

The experimental procedure was followed as described in example 1. Extracting the sgRNA lentiviral plasmid of the whole genome of the pig, and packaging the sgRNA lentiviral library by adopting a three-plasmid system. The backbone of the target plasmid was lenti-sgRNA-eGFP and the helper system plasmids were pspax2 and pmd2. g. All plasmids were extracted using a small endotoxin-free plasmid Mini Kit (Endo-freePlasmid DNA Mini Kit II, cat # D6950-01) from OMEGA. The cell transfection reagent adopted by the lentivirus package isThe cell line is HEK293T cell.

The sgRNA lentivirus packaging experimental procedure was as follows: (1) and 3-generation HEK293T cells with good growth state are used for packaging lentivirus. Cells were seeded one day before transfection into 10cm dishes and transfection was performed when cells grew to 90% -95% confluence. (2) Prior to transfection, the old medium was aspirated off and 5mL of fresh, antibiotic-free 2% FBS medium was added and returned to the incubator for further culture. (3) For a 10cm dish, the total plasmid amount for lentivirus packaging was 24. mu.g, the ratio of three was pmd2. g: pspax 2: the target plasmid is 1:2: 3; (4) sequentially adding plasmids with corresponding volumes into 500 mu l of Jetprime Buffer, slightly blowing, beating and uniformly mixing, adding 40 mu l of Jetprime regent, slightly blowing, uniformly mixing, and standing for 10min at room temperature; carefully add to the dish and gently shake well and return to the incubator. (5) After plasmid transfection for 6-8h, 5ml of 2% FBS culture medium containing 1% double antibody is supplemented, and the mixture is uniformly mixed and then put back into an incubator; observing the cell state 24h after the first fluid infusion, then supplementing 10ml of 2% FBS culture medium containing 1% double antibody, mixing uniformly and then putting back to the incubator. (6) Observing the cell state and the fluorescence expression condition at 60h after plasmid transfection, and taking pictures and recording by a microscope; (7) the cell supernatant (one tube per 2 plates) was collected, centrifuged at3,000 rpm for 10min at 4 ℃ after sealing with a sealing membrane, filtered using a 0.45 μm filter, and then centrifuged at 30,000rpm at 4 ℃ for 2.5h at an ultra high speed. (8) Pouring out the supernatant, reversing the supernatant on absorbent paper to suck out the residual liquid, adding 120 mu L of precooled PBS into each tube for resuspension, uniformly mixing, transferring the same virus concentrated solution into the same collecting tube, and dissolving virus particles overnight at 4 ℃; the virus suspension was then aliquoted and stored at-80 ℃ for a long period.

A SgRNA lentivirus library with the infection complex number MOI of 0.3 is used for infecting PK-15 cells (PK-15-Cas9) which stably express Cas9, after 2 days of infection, GFP positive cells are sorted and enriched by a flow cytometer and are expanded to be cultured, and a whole genome mutant cell bank is prepared.

3.2 inoculating the PK-15 mutant cell bank with the JEV to collect the surviving cells, preparing a sequencing library and sequencing on a computer

According to the experimental procedure described in example 1, PK-15-Cas9 and whole genome mutant cells were inoculated with Japanese encephalitis virus JEV with a multiplicity of infection MOI of 0.03, respectively. After a certain number of days of infection, JEV was observed to cause total death when inoculated with PK-15-Cas9 cells, whereas a small number of cells survived when inoculated with whole genome mutant cells. Replacing a fresh high-concentration (20%) fetal calf serum culture medium for amplification culture, and then respectively carrying out JEV challenge experiments of 2 nd, 3 rd and 4 th rounds, wherein the MOI of each JEV inoculation is 0.03. And finally, respectively collecting the mutant cells before infection and the mutant cells infected by the JEV of the 3 rd round and the 4 th round, extracting genome DNA, amplifying by PCR, preparing a sequencing library, and performing high-throughput sequencing on the sequencing library.

For the collected cells, Cell genomic DNA was extracted with reference to the instruction manual of the DNA extraction Kit Blood & Cell Culture DNA Midi Kit (QIAGEN). Wherein the sequence of the PCR amplification primer pair is as follows: Lib-cell-F: GTGGAAAGGACGAAACACCG (SEQ ID No.:23) and Lib-cell-R: GCGGTACCTCTAGAGCCATT (SEQ ID No.: 24).

The PCR amplification reaction system is as follows:

composition of	Reaction volume
		Q5 High-Fidelity 2X Master Mix	25μL
Lib-cell-F(10μM)	2.5μL
		Lib-cell-R(10μM)	2.5μL
Genomic DNA	1.0μg
		Supplementary sterilizing double distilled water	to 50μL

The PCR product was detected by agarose gel electrophoresis and, after confirming a positive band for amplification, purified using the PCR product Purification Kit MinElute PCR Purification Kit (QIAGEN). The prepared PCR purified product is sent to a company to construct a sequencing library and carry out high-throughput sequencing.

3.3 bioinformatics analysis of high throughput sequencing data

Next, sgRNA enrichment analysis was performed on high throughput sequencing data from different sample sources using MAGECK software (https:// sourceforce.

The sgrnas 0.5% before the ordinal ranking were set as enriched sgrnas (table 1). As can be seen from fig. 3A and B, the top 10 sgrnas with highest enrichment factor identified in the surviving cells after the 3 rd round of japanese encephalitis virus JEV challenge were designated as SEC63, PRKCSH, SLC35B2, RNF145, SMOX, CALR, DMGDH, EXT2, B3GAT3, and GSTO2, while the top 10 sgrnas with highest enrichment factor identified in the 4 th round were designated as SLC35B2, SMOX, RNF145, DMGDH, SEC63, EXT2, CALR, B3GAT3, EXT1, and PRKCSH. Notably, these genes are highly overlapping, with 9 genes being repeated in rounds 3 and 4, except for EXT1 (column 9 in round 4) and GSTO2 (column 10 in round 4).

Then, we performed wien map analysis of sgRNA-enriched target genes in host cells surviving JEV infection in rounds 3 and 4, and found 44 genes in common (overlap 86.3%), 3 unique in round 3 and 4 unique in round 4, which were ranked 0.1%.

Then, the Wien graph analysis was performed on the top 0.5% of the ranking, and 231 genes shared by the two genes (the overlapping rate was 89.9%), while 12 genes were unique in the 3 rd round screening and 14 genes were unique in the 4 th round screening.

The results show that the sgRNA target gene overlapping rate in the survival cells identified after 3 rd and 4 th JEV challenge is relatively high, and the purpose of stable screening can be basically achieved, so that an important reference basis is provided for screening other pathogenic microorganisms by adopting similar strategies in the future.

In table 1, the number of sequencing numbers and target genes corresponding to sgrnas obtained by screening surviving cells based on JEV infection of host cells in rounds 3 and 4 are listed. These screened candidate functional genes will serve as important molecular targets for inhibiting JEV replication or infection.

TABLE 1 identification of the top 0.1% sgRNAs and target genes using CRISPR/Cas9 knock-out libraries

Note: in table 1, the following genes appear 2 times or more: b3GAT3, EXT1, EXT2, EXTL3, GLCE, HS6ST1, PRKCSH, RNF145 and SEC 63.

Example 4: signal pathway analysis of significantly enriched sgRNA target genes

4.1KEGG analysis

Based on the identification of the target genes of the sgrnas ranked first 0.5% in viable cells by JEV challenge rounds 3 and 4 as described in example 3, KEGG analysis was performed using DAVID software (https:// DAVID.

The results are shown in fig. 4, in the 3 rd round JEV challenge survival cells, the signal pathways involved by the enriched sgRNA targeting gene are: endoplasmic reticulum protein processing, glycosaminoglycans (GAGs) and synthetic Heparan Sulfate Proteoglycans (HSPGs), glycosaminoglycans (GAGs) and synthetic chondroitin sulfate (chondroitin sulfate, ChS); whereas, JEV-infected host cells from round 4 were associated with metabolic signaling pathways, in addition to the same as round 3.

4.2 Wien graph analysis

The common top 0.5% sgRNA target genes identified in JEV challenge surviving cells from rounds 3 and 4 were analyzed in wain maps with GAG signaling pathways, HSPG metabolism and synthesis pathways, respectively.

The results are shown in FIG. 5A, in which 10 genes enriched in the HSPG anabolic pathway are: EXT1, EXT2, GLCE, HS6ST1, B3GAT3, B4GALT7, XYLT2, EXTL3, SLC35B2, and GAA.

4.3 sequencing number analysis of sgRNA

Further, sequencing numbers corresponding to sgrnas obtained by all the screenings were analyzed.

The results show (fig. 5B) that 3 sgrnas correspond to EXT1 and HS6ST1, and 2 sgrnas correspond to B3GAT3, EXT2, EXTL3 and GLCE, respectively, which indicates that the target genes to be screened are reliable.

As can be seen in FIGS. 5C and D, EXT1 and EXT2, etc. are involved in the biosynthesis of HSPG, while SLC35B2 and HS6ST1 are involved in sulfate transport and modification of HSPG. This suggests that screening for enriched genes may be involved in the biosynthesis and sulfhydrylation modification of HSPGs in porcine PK-15 cells and thus in the process of mediating the replication of JEV.

Example 5: JEV replication is obviously inhibited after HSPG pathway related gene is knocked out by using CRISPR/Cas9 technology

5.1 construction of sgRNA expression vector

Selecting SLC35B2, HS6ST1, B3GAT3 or GLCE involved in HSPG biosynthesis and modification in example 4, and respectively constructing gene knockout cell lines by using CRISPR/Cas9 lentivirus technology.

Sgrnas targeting SLC35B2, HS6ST1, B3GAT3 and GLCE were selected from sgRNA lentivirus libraries, and the sequences and vector construction primers are shown in tables 2 and 3:

table 2sgRNA sequences

Name of Gene	sgRNA sequence (5'-3' -NGG)	SEQ ID No:
			SLC35B2	GTCTCTGCTGGCTCTGACCGGGG	1
HS6ST1	AACCTGTCCTTCATCCCCGAGGG	2
			B3GAT3	GGACCGCCAGATGTGTGAAGAGG	3
GLCE	TTGAAGCCACCAACAACAGGGGG	4

Note: the underline is PAM.

Table 3 primer pairs for construction of sgRNA expression vectors

The construction process of the sgRNA expression vector comprises the following steps: sgRNA annealing: diluting the forward and reverse primer concentration of the sgRNA to 10 mu M; sucking 5 mul of each primer, and mixing uniformly; heating at 95 deg.C for 10min on PCR instrument; and (4) connecting the sgRNA expression vector with the enzyme-cleaved and linearized sgRNA expression vector at 65 ℃ for 1 h.

An enzyme digestion system of the sgRNA expression vector:

composition of	Reaction volume
		Lenti-sgRNA-GFP	2μg
10x Fast Digest buffer	2μL
		BpiI(BbsI)	2μL
Make up water to	20μL

Preparing a digestion reaction solution, and then placing the solution in a water bath at 37 ℃ for 3h for digestion; and then performing gel electrophoresis and purification recovery on the enzyme digestion product, and connecting the enzyme digestion product with the annealed sgRNA primer pair.

sgRNA expression vector ligation system:

composition of	Reaction volume
		Ligation Mix(Takara)	5μL
Linearized sgRNA lentiviral plasmids	50ng
		Annealed sgrnas	1ng
Make up water to	10μL

5.2 packaging of sgRNA lentiviruses and preparation of knockout cells

The sgRNA expression vectors targeting SLC35B2, HS6ST1, B3GAT3, and GLCE were constructed and verified by sequencing.

The sequencing-verified bacterial solution was subjected to scale-up culture, and plasmids were extracted and concentration was determined using endotoxin-free plasmid extraction kit (OMEGA, # D6950-01).

Packaging of sgRNA lentiviruses was then performed, with the experimental steps: (1) newly recovered HEK293T cells were cultured for about 3 generations for transfection. Cells were seeded into 10cm cell culture dishes the day before transfection. (2) And (5) performing transfection when the cell reaches 80-90% confluence. Removing the old culture medium before transfection, washing with PBS once, adding 5mL of fresh 2% FBS DMEM culture medium (without antibiotics), and placing in an incubator for continuous culture; (3) a10 cm cell culture dish required a total of 24. mu.g of plasmid for transfection, and the plasmid DNA was diluted with 500. mu.L of Jetprime Buffer (PMD2. G: PSPAX: purpose 1:2:3) and mixed well; (4) add 40. mu.L Jetprime (Polyplus, # B180306) and mix; (5) standing at room temperature for 10min, carefully adding into cell culture medium, and shaking gently; (6) supplementing 5mL of DMEM medium containing 1% double antibody and 2% FBS 6-8h after transfection, mixing uniformly and continuing to culture; (7) after 24 hours, 10mL of DMEM medium containing 1% double antibody and 2% FBS is supplemented; (8) after 60h, collecting all the supernatant into a 50mL centrifuge tube, and filtering by using a 0.45 mu m filter; (9) centrifuging the filtered supernatant at 30000rpm at 4 deg.C for 2.5 h; (10) after the centrifugation, the supernatant was poured off, and the residue was blotted with absorbent paper. The virus is concentrated at the bottom of the tube, 100 mu L of precooled 1% double antibody, 10% FBS DMEM culture medium or precooled PBS heavy suspension virus is added into each tube; (11) the virus was solubilized overnight at 4 ℃ and finally stored at-80 ℃.

And (3) measuring the titer of the purified lentivirus, and after infecting PK-15-Cas9 cells, respectively sorting and picking monoclonal cells edited by different genes through flow cells for amplification culture. Subsequently, a part of the cells were taken, and genomic DNA was extracted separately with reference to the instructions of DNA extraction kit (TIANGEN, # DP304), and then subjected to PCR amplification, wherein specific PCR primers were shown in Table 4.

TABLE 4 PCR amplification primer pairs

Primer name	Primer sequence (5'-3')	SEQ ID No.:
			SLC35B2-F	ACGCTGTAAGGTCAGCATCTC	13
SLC35B2-R	GGAAAGGGTGGGTAAGTGTGTT	14
			HS6ST1-F	GTCAGGTTGTCCCTCCCAAG	15
HS6ST1-R	GCATGAAAGGCCGGATGAAC	16
			B3GAT3-F	AGCGTGAAGTTGACAGGCAAG	17
B3GAT3-R	CATCCCAGGACTCACCTCCTCA	18
			GLCE-F	AAATGTCAGTAGTACACCTTGGC	19
GLCE-R	GCCATCGTACTGAACCACCT	20

Sequencing is carried out on the PCR product, and as can be seen in a sequencing result shown in FIG. 6A, 4 kinds of monoclonal gene editing cells have non-integral multiple base deletion or insertion of 3, thereby causing frame shift mutation of a reading frame and achieving the gene knockout effect.

5.3 evaluation of the ability of Gene knockout cells to inhibit JEV replication

5.3.1 Virus plaque assay

By the plaque experiment of the virus, the influence of the knockout and wild type cells on the replication of the JEV virus is compared under the condition that the MOI of the JEV is 0.03 and 0.1 respectively. The experimental procedure was as follows: first, a virus supernatant was prepared: (1) inoculating PK-15 cells into a 6-well culture plate on the previous day; (2) when the growth rate reaches 70%, inoculating JEV-RP9, and setting a control group; (3) adding 1mL of serum-free DMEM medium into each well, and culturing at 37 ℃ for 1.5 h; (4) sucking out the old culture medium, and replacing with a DMEM low-sugar culture medium containing 1% double antibody and 2% FBS for continuous culture; (5) after infection for 48h, the culture plate is repeatedly frozen and thawed for 2 times at-80 ℃; (6) virus supernatants were collected and frozen at-80 ℃.

Subsequently, a plaque formation experiment was performed, the experimental procedure being: (1) BHK cells were seeded into 12-well cell culture plates the day before; (2) the cells grow to 30-40%, and virus supernatant is inoculated. Preparing a virus diluent: 900 μ L DMEM and 100 μ L of the virus stock were serially diluted 10-fold (10)^-1，10^-2，10^-3，10^-4，10^-5，10^-6，10^-7，10^-8) Lightly blowing, beating and uniformly mixing; (3) the cells were removed from the incubator, the well was aspirated of medium and washed 1-2 times with PBS. Pipette 800. mu.L of the diluted virus into the plateThen 200. mu.L of DMEM was added and 3 replicates per well were performed. Shaking, placing in an incubator at 37 deg.C for 2h, and shaking gently every 15-20 min; (4) after 2h, the old medium was aspirated off and replaced with 1mL of DMEM (2X) medium containing 2% FBS, 1% double antibody and 50% low melting agarose; (5) standing in a refrigerator at 4 deg.C for several minutes until agarose solidifies, and then 5% CO at 37 deg.C₂The incubator continues to culture. (6) After 48h the agarose was poured off. Adding 10% neutral formaldehyde, fixing for more than 4h, filling each hole, placing in a fume hood, and opening a fan; (7) washing 10% neutral formaldehyde. Adding crystal violet, dyeing for more than 30min, washing with tap water until no purple color appears, and drying in an inverted state; (8) and (4) counting plaques.

As shown in FIG. 6B, under the conditions of JEV vaccination at different MOI, when the genes of SLC35B2, HS6ST1, B3GAT3 or GLCE were knocked out, the replication of JEV was significantly inhibited, compared with the wild type.

5.3.2 Indirect immunofluorescence assay

Through indirect immunofluorescence experiments, the expression of the NS3 protein coded by JEV is detected under JEV infection conditions of different MOIs respectively. The experimental procedure was as described in example 2.

As shown in FIG. 6C, under the conditions of JEV vaccination at different MOI, when genes of SLC35B2, HS6ST1, B3GAT3 and GLCE were knocked out, the expression of NS3 protein encoded by JEV was significantly inhibited, compared with wild type.

5.3.3 Absolute quantitative PCR experiment

By referring to the specification of a virus RNA extraction kit, virus RNA in wild cells and gene knockout cells of SLC35B2, HS6ST1, B3GAT3 and GLCE is respectively extracted, and the copy number of a C gene coded by JEV is detected by an absolute quantitative PCR method. The experimental process is as follows: (1) knocking out the cell line and inoculating JEV in the same way as the embodiment 2; (2) viral supernatant RNA was extracted. Reference viral nucleic acid purification kit (Takara, # 9766); (3) reverse transcription into cDNA. Reference PrimeScript^TMII 1st Strand cDNA Synthesis Kit (Takara, # 6210); (4) PCR amplifying the C gene of JEV-RP9, cloning to a PMD-19T vector, extracting a PMD19-T-C plasmid after sequencing identification is correct, determining the concentration, and calculating the copy number; wherein the sequence of the quantitative PCR amplification primer is as follows:JEV-RP9-C-F: GAGCTTGTTGGACGGCAGAG (SEQ ID No.:21) and JEV-RP9-C-R: CACGGCGTCGATGAGTGTTC (SEQ ID No.: 22). Continuously diluting the plasmid by 10 times, and taking the plasmid as a standard plasmid for making a standard curve; and finally, calculating the copy number of the sample according to a standard curve made by standard plasmids.

The PCR reaction system is as follows:

composition of	Reaction volume
		SYBRGreen	10μL
JEV-RP9-C-F	0.6μL
		JEV-RP9-C-R	0.6μL
cDNA	1μL
		H2O	7.8μL

The results of absolute quantitative PCR are shown in fig. 6D: the copy number of the JEV-encoding C gene was significantly reduced following gene knockout of SLC35B2, HS6ST1, B3GAT3 and GLCE compared to wild type.

5.3.4 Effect on modification of HSPG sulfenylation

Through indirect immunofluorescence experiments, the influence of SLC35B2 and HS6ST1 gene knockout cells on HSPG sulfenyl modification is detected. The antibodies used were: heparin Sulfate (HS) (USbiological, H1890). The experimental procedure is as described in example 2.

The results are shown in fig. 6E, after the SLC35B2 or HS6ST1 gene is knocked out, the level of the sulfation modification of HSPG can be significantly inhibited, indicating that the sulfation modification of HSPG is important for mediating the replication of JEV.

Example 6 evaluation of the Effect of Gene knockout on Normal cellular proliferation Using the EdU assay

In this example, the effect on cell proliferation after knock-out of SLC35B2, HS6ST1, B3GAT3 and GLCE genes was further examined by EdU cell proliferation assay.

The experimental steps are as follows: (1) inoculating cells into 12-well culture plates on the previous day; (2) carrying out EdU staining when the cells grow to 30-50%; (3) the cells were cultured in a cell culture medium at 1000: 1, preparing a proper amount of 50 mu M EdU culture medium; (4) adding 500 mu L of 50 mu M EdU culture medium into each cell sample, incubating for 2h, and removing the culture medium; (5) the cells were washed 3 times with pre-chilled PBS for 5min each time. (6) Adding 500 μ L of cell fixing solution (PBS containing 4% paraformaldehyde) into each well of cell sample, and incubating at room temperature for 30 min; (6) the cells were washed 3 times with pre-chilled PBS for 5min each time; (7) adding 500 μ L of penetrant (0.3% TritonX-100 PBS) into each well of cell sample, decolorizing and shaking for 10 min; PBS wash 3 times for 5min each. (8) Add 500. mu.L of 1X per wellIncubating the dyeing reaction solution for 30min in a light-proof, room temperature and decolorizing shaking table, and then discarding the dyeing reaction solution; (8) washing with PBS decolorizing shaking table for 5min for 3 times. Then, nuclear staining was performed: adding DAPI, and dyeing for 10min at room temperature in dark; discarding DAPI, and washing 3 times with PBS (phosphate buffer solution) decolorizing and shaking table for 5 minutes each time; 1mL of PBS was added and fluorescence was observed as soon as possible under a fluorescence microscope.

As can be seen in FIG. 7, the fluorescence signal of EdU staining overlaps DAPI compared to wild type after knock-out of SLC35B2, HS6ST1, B3GAT3 and GLCE genes. This indicates that knockout of these genes does not affect normal proliferation of the cells.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims (10)

1. A method of determining a potential JEV resistance-associated gene comprising the steps of:

(a) providing a porcine somatic cell that stably expresses Cas9 and is infected with a recombinant virus and survives as a first cell bank, and a porcine somatic cell that does not express Cas9 as a control cell, wherein the cells of the first cell bank and the control cell are of the same type of somatic cell;

the recombinant viruses are viruses capable of infecting the somatic cells of the pigs and are respectively used for expressing sgRNA sets (sgRNAs) consisting of different knockout sgRNAs of targeted pig genes, wherein the sgRNA sets comprise N recombinant viruses targeting different pig genes, and N is a positive integer more than or equal to 1000;

(b) in the control group, infecting said control cells with Japanese Encephalitis Virus (JEV); and in the test group, infecting the swine somatic cells of the first cell bank, i.e., test cells, with a Japanese Encephalitis Virus (JEV), wherein the experimental conditions of the control group and the test group are the same or essentially the same;

(c) observing the survival of the control cells in the control group, and collecting the pig somatic cells surviving in the test group when the cell death rate D1 of the control group reaches a predetermined value (e.g., D1 ≧ 90%, optimally 100%);

(d) using the viable cells as test cells of a test group in the next test round, repeating the steps (b) and (c), and performing the next test round to obtain the viable cells of the R round, wherein R is a positive integer of 2-10;

(e) determining the kind of the knockout sgRNA enriched in the viable cells for the viable cells of the j round, wherein j is more than or equal to2 and less than or equal to R; and

(f) based on the determined enriched species of the knockout sgRNA, the corresponding target gene is a potential JEV resistance-related gene.

2. The method of claim 1, wherein the method further comprises:

(g) functional verification was performed on the potential JEV resistance-associated genes determined in the previous step.

3. The method of claim 1, wherein the potential JEV resistance-associated gene is a target gene corresponding to a knockout sgRNA with an enrichment rank m%, wherein m is less than or equal to 5.

4. The method of claim 1, wherein the potential JEV resistance-associated genes are selected from the group a genes: ACP7, ARID5B, B3GAT3, B4GALT7, BHLHE41, BTAF1, CALR, CAVIN3, CCNB1IP1, CDK5R2, DAPK1, DMGDH, DOK1, DR1, EMC3, EMC6, EPB41L3, ERBB4, EXT1, EXT2, EXTL 59672, FAM205 2, GAA, GLCE, GNA 2, GOSR 2, GPT2, GSTO2, HS6ST 2, KCNQ 2, LRRC2, MICROALL 2, ORAOV 2, PKP 2, PRKCSH, RNF145, 2, SEC 2, SERP 2, SLC25A 2, SLC26A 2, SLC35B2, SMHR 365, TAF 36BV 2, TRBV2, ZNF 36XDH 72, ZNF33, ZNF 36XDH 2, ZNF33, ZNF X2, ZNF 33;

or said potential JEV resistance-associated gene is selected from the group consisting of: SEC63, PRKCSH, SLC35B2, RNF145, SMOX, CALR, DMGDH, EXT2, B3GAT3 and GSTO 2;

or said potential JEV resistance-associated gene is selected from the group C: SLC35B2, SMOX, RNF145, DMGDH, SEC63, EXT2, CALR, B3GAT3, EXT1 and PRKCSH.

5. The method of claim 1, wherein the potential JEV resistance-associated gene is from a pathway selected from the group consisting of: an endoplasmic reticulum protein processing pathway, a glycosaminoglycan (GAG) and synthetic Heparan Sulfate Proteoglycan (HSPG) pathway, a glycosaminoglycan (GAG) and synthetic chondroitin sulfate pathway, a metabolic signaling pathway, or a combination thereof;

more preferably, the potential JEV resistance-associated gene is selected from the group consisting of: SLC35B2, HS6ST1, B3GAT3, GLCE, or a combination thereof.

6. An application of JEV resistance promoter, which is characterized in that the JEV resistance promoter is used for preparing a compound or a drug combination for resisting epidemic encephalitis B, or is used for preparing a preparation for resisting an epidemic encephalitis B model animal,

wherein, the JEV resistance promoter is an inhibitor of a JEV resistance-related gene or a protein coded by the gene (namely, a JEV resistance-related protein),

the JEV resistance-associated gene is determined by the method of claim 1 or the JEV resistance-associated gene is selected from the group a genes.

7. A composition, comprising:

(a) a gene-editing protein or an expression vector thereof, said gene-editing protein selected from the group consisting of: cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof; and

(b) a gRNA or an expression vector thereof, wherein the gRNA is an RNA that directs the gene-editing protein to specifically bind a JEV resistance-associated gene,

wherein said JEV resistance-associated gene is determined by the method of claim 1; or the JEV resistance-associated gene is selected from the genes of group a.

8. A kit, comprising:

(a1) a first container, and a gene-editing protein or an expression vector thereof located in the first container, the gene-editing protein selected from the group consisting of: cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof;

(b1) a second container, and a gRNA or an expression vector thereof located in the second container, the gRNA being a nucleotide sequence that directs a gene editing protein to specifically bind to a JEV resistance-associated gene,

wherein said JEV resistance-associated gene is determined by the method of claim 1; or the JEV resistance-associated gene is selected from the genes of group a.

9. Use of a composition according to claim 7 or a kit according to claim 8 for the manufacture of a medicament (i) for the prevention and/or treatment of epidemic encephalitis b, or (ii) for inhibiting JEV virus infection.

10. An isolated genetically engineered cell resistant to infection by a JEV virus, wherein the cell is a somatic cell and an endogenous JEV resistance-associated gene in the cell is knocked out or knocked down such that expression or activity of an endogenous JEV resistance-associated protein is reduced,

wherein said JEV resistance-associated gene is determined by the method of claim 1; or the JEV resistance-associated gene is selected from the genes of group a.