CN114591945A - DNA virus nucleic acid extraction detection reagent, kit, method and application thereof - Google Patents
DNA virus nucleic acid extraction detection reagent, kit, method and application thereof Download PDFInfo
- Publication number
- CN114591945A CN114591945A CN202210351200.6A CN202210351200A CN114591945A CN 114591945 A CN114591945 A CN 114591945A CN 202210351200 A CN202210351200 A CN 202210351200A CN 114591945 A CN114591945 A CN 114591945A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- extraction
- detection
- ebv
- dna virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a DNA virus nucleic acid extraction detection reagent, a kit, a method and an application thereof, wherein the extraction detection reagent consists of InstaGeneMatrix, Tris-HCl, SDS, KCl, EDTA and Sarkosyl; EBV nucleic acid can be rapidly and efficiently extracted from a complex sample, and the potential clinical applicability of the extraction method is verified.
Description
Technical Field
The invention relates to the technical field of biology, in particular to the technical field of extraction and detection of DNA virus nucleic acid.
Background
Epstein-Barr virus (EBV) is a member of the genus lymphotropic virus of the family Herpesviridae, and its genome is DNA. EBV has the biological property of specifically infecting human and certain primate B cells in vitro and in vivo. Humans are hosts of EBV infection and are transmitted mainly through saliva, asymptomatic infection often occurs in young children, more than 90% of young children 3-5 years old have been infected with EBV, and more than 90% of adults have virus antibodies. EBV is the causative agent of infectious monocytogenes, is closely related to the occurrence of nasopharyngeal carcinoma and childhood lymphoma, and is classified as one of the human oncogenic tumor viruses.
For scientific prevention and control and diagnosis of EBV, the DNA virus needs to be optimized for nucleic acid extraction, so as to facilitate deep research in later period, such as molecular diagnosis and the like. The commercial kit which is relied on by the current virus extraction method has low extraction speed and low working efficiency, and residual viruses are difficult to clean in the later period. For example, the extraction of viral nucleic acids is typically performed by lysis with a guanidinium salt, which solubilizes the proteins and causes the viral particles to break up, allowing the nucleoprotein to be rapidly separated from the nucleic acid due to the disruption of its secondary structure. However, the guanidine salt requires a longer lysis time in the actual lysis process, the addition time of the lysis solution is different from that of the binding solution, and protease K needs to be added to assist in lysis, so that the extraction time of the viral nucleic acid is too long, and the extraction efficiency is low. In addition, the viral nucleic acid extraction can also adopt the steps of ultrasonic treatment, bead beating, enzyme, mixing (vortex), mechanical shearing, chaotropic solution and the like, but the steps can not directly realize the extraction purpose, and the actual extraction procedure is required to extract after the treatment, so that the complexity and the operation time are finally added to the whole extraction process.
Disclosure of Invention
Aiming at one of the technical problems recorded in the content, the invention provides a DNA virus nucleic acid extraction detection reagent, a kit, a method and application thereof, and by the method, not only can the cross contamination among samples be reduced, but also the infectious virus can be effectively inactivated, the whole virus nucleic acid extraction period is greatly shortened, and the extraction limit can be improved to 100 copies/ml. Compared with the traditional extraction method, the method has the advantages that the efficiency of extracting DNA virus nucleic acid is improved by at least 10 times, the cost is greatly saved, the extraction efficiency is improved, and the practical problems of low efficiency and high cost of the existing DNA virus extraction are solved.
In a first aspect, the invention provides a DNA virus nucleic acid extraction detection reagent, which consists of InstaGene Matrix, Tris-HCl, SDS, KCl, EDTA and Sarkosyl.
Further, the mass concentration of the InstaGene Matrix in the detection reagent is 1-15%; the amount concentration of the Tris-HCl substance is 10-100 mmols/L, and the pH value is 8.0; the mass concentration of SDS is 1% -20%; the mass concentration of KCl substance is 10mmol/L-100m mol/L; the quantity concentration of EDTA substance is 1-10m mol/L; the mass concentration of the Sarkosyl is 1-5%.
In the invention, the extraction detection reagent is a buffer solution; the buffer solution is autoclaved after preparation and stored at 4 ℃ for a long time for later use.
In a second aspect, the present invention provides a DNA virus nucleic acid extraction and detection method, comprising the following steps:
(1) the virus-containing samples were pelleted by centrifugation at parameters 10000-.
(2) Adding a nucleic acid extraction detection reagent comprising InstaGene Matrix, Tris-HCl, SDS, KCl, EDTA and Sarkosyl into the colony precipitate obtained in the step (1), and shaking and uniformly mixing; the mixture was then placed in a boiling water bath for 5-10 minutes, followed by cooling at room temperature for 1-3 minutes.
(3) The lysate was pelleted at high speed with parameters 10000-.
(4) And taking the supernatant for subsequent quality control and target gene detection.
Further, the extraction detection method of the present invention further includes: breaking and building a library, performing computer sequencing and analyzing data.
Further, the extraction detection method of the present invention further comprises: the method comprises the following steps of primer design and synthesis, qPCR amplification, qPCR detection and result analysis.
In a third aspect, the invention also provides a DNA virus nucleic acid extraction detection kit, which comprises an extraction detection reagent, wherein the extraction detection reagent contains an InstaGene Matrix with a mass concentration of 1-15%; Tris-HCl with pH of 8.0 and a substance concentration of 10-100 mmols/L; SDS with the mass concentration of 1-20%; KCl with the mass concentration of 10-100m mol/L; EDTA with the mass concentration of 1-10m mol/L; sarkosyl with the mass concentration of 1-5%.
In a fourth aspect, the invention provides an application of a DNA virus nucleic acid extraction detection reagent or an extraction detection kit in DNA virus nucleic acid extraction detection.
Specifically, the invention provides an application of the DNA virus nucleic acid extraction detection reagent or the kit in EBV nucleic acid extraction detection.
Furthermore, the sequence information of the primers used for extraction and detection in the invention is as follows: EBV-F: GTCCTGCAGCTATTTCTGGT, respectively; EBV-R: GAGGGCTAGGGAGAGGTAGAAG are provided.
In a fifth aspect, a method for determining the extraction limit of EBV nucleic acids, the method comprising the steps of:
(1) setting a combination of various microorganisms and adding a human-derived background, wherein the input parameter of the EBV is 103And 104Copy number/ml;
(2) nucleic acid extraction: centrifuging and precipitating the prepared 1ml of mixed bacteria liquid with the parameter of 10000-; adding 200 mul of nucleic acid extracting solution to bacterial colony sediment, shaking and mixing evenly; then placing the mixture in a water bath at 100 ℃, standing for 5-10 minutes, and then cooling for 1-3 minutes at room temperature; centrifuging and precipitating the cracking product at a high speed with the parameter of 10000-; taking 50-150 μ l of supernatant, preferably 100 μ l for subsequent quality control and target gene detection;
(3) and (3) concentration measurement and quality control: using NanoReady to carry out quality control on the extracted nucleic acid solution, wherein the parameter is A260/A280; meanwhile, the Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid;
(4) extraction of the control method group: extracting according to a column method;
(5) and (3) comparing extraction results: the comparative parameters include extraction time, extraction cost, quality control of extracted nucleic acid, total extraction amount, and qPCR amplification detection result;
(6) and (3) carrying out mNGS sequencing verification on detection interruption and library building, on-machine sequencing and data analysis of the simulated mixed sample nucleic acid, and determining the extraction limit of extracting the EBV nucleic acid.
By implementing the technical scheme of the invention, the following beneficial effects can be achieved:
the DNA virus nucleic acid extraction detection reagent, the kit and the method thereof can realize the rapid and efficient extraction of the EBV nucleic acid DNA, and the efficiency of extracting the DNA virus nucleic acid is improved by at least 2 times, compared with a column method, the method of the invention has the advantages that the cost is reduced by 160 times, compared with a magnetic bead method, the cost is reduced by 40 times, and the extraction detection limit of the EBV is improved to 100 copy numbers/ml; EBV nucleic acid can be rapidly and efficiently extracted from a complex sample, and the potential clinical applicability of the extraction method is verified.
Drawings
FIG. 1 is a flow chart of the extraction method of the present invention;
FIG. 2 is a diagram showing the result of qPCR amplification in EBV nucleic acid detection according to the present invention;
FIG. 3 is a graph of qPCR raw data and its analytical statistics;
legend: ct1 is repeat 1; ct2 is repeat 2; the Ct mean is the mean of Ct1 and Ct 2; the standard deviation is a value calculated from Ct1 and Ct 2. EBV-1,2,3 is 104Copy number/ml, EBV-4, 5, 6 is 103Copy number/ml.
Detailed Description
The technical solutions in the embodiments of the present invention will be described clearly and completely with reference to the drawings in the specification, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention will be further understood by reference to the following detailed description of preferred embodiments of the invention and the examples included therein.
EBV used in the present invention was purchased from the China center for type culture Collection. Extracting the bacterial nucleic acid by using a Qiagen nucleic acid extraction kit (cat # 56204) through a column method, then quantifying by using a spectrophotometry method, checking the total mass of the nucleic acid which can be extracted by each tube, calculating the copy number of a genome by taking the total mass as a standard, and establishing a reference line for the subsequent extraction detection limit.
According to the sample group provided by the embodiment of the invention, the purchased EBV is utilized to simulate the EBV under the complex biological background, the EBV is provided with a combination of a plurality of different microorganisms and a human-derived background to increase the extraction complexity, and finally, a simulated sample capable of simulating the actual human body sample environment is formed. The specific microorganism combination is a commercial reagent ZymobiomicsTMMicrobial Community Standard (Cat: D6300, hereinafter referred to as Zymo) comprising ten common microorganisms with the use parameter of 1.4X106cell/ml; a human HeLa cell line (purchased from North Nay Bio) with the use parameter of 1.0x10 was also added5cell/ml; EBV input parameter is 103And 104Number of copies/ml.
The control group compared with the extraction method of the invention carries out nucleic acid detection by extraction according to a column method and a magnetic bead method, and the embodiment of the control group of the invention selects a Qiagen nucleic acid extraction kit to carry out the column method for extracting the somatic nucleic acid.
The first embodiment is as follows: the invention relates to a DNA virus nucleic acid extraction and detection reagent
The preparation method of the solution comprises the following steps: mixing InstaGene Matrix (1-15%, w/v, Bio-Rad), Tris-HCl (10-100mM, pH8.0), SDS (1-20%, w/v), KCl (10-100mM) and EDTA (1-10mM), Sarkosyl (1-5%, w/v); the buffer solution is prepared, autoclaved and subpackaged at 4 ℃ for long-term storage for later use.
Example two: the invention relates to a DNA virus nucleic acid extraction detection kit
The DNA virus nucleic acid extraction detection kit comprises an extraction detection reagent, wherein the extraction detection reagent contains InstaGene Matrix with the mass concentration of 1-15%; Tris-HCl with pH of 8.0 and a substance concentration of 10-100 mmols/L; SDS with the mass concentration of 1-20%; KCl with the mass concentration of 10-100m mol/L; EDTA with the mass concentration of 1-10m mol/L; sarkosyl with the mass concentration of 1-5%.
Example three: the method for extracting the EBV nucleic acid by the nucleic acid extracting solution
The nucleic acid extracting solution is used for extracting EBV nucleic acid, and comprises the following specific steps:
a: centrifuging and precipitating the prepared 1ml of mixed bacteria liquid at 12000rpm for 1 minute, and removing the supernatant;
b: adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then placing the mixture in a water bath at 100 ℃, standing for 8 minutes, and then cooling for 1-3 minutes, preferably 2 minutes at room temperature;
c: centrifuging and precipitating the lysate at high speed with the parameter of 12000rpm for 2 minutes;
d: taking 100 mu l of supernatant for subsequent quality control and target gene detection;
the quality control of nucleic acid, in this example, NanoReady (Hangzhou kansui) was used to control the quality of the extracted nucleic acid solution, with parameters of A260/A280, A260/A230, and nucleic acid concentration; meanwhile, Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid.
Example four: the method for extracting the EBV nucleic acid by the nucleic acid extracting solution
The nucleic acid extracting solution is used for extracting EBV nucleic acid, and comprises the following specific steps:
a: centrifuging and precipitating the prepared 1ml of mixed bacteria liquid with the parameter of 10000rpm for 1 minute, and removing the supernatant;
b: adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then the mixture was placed in a water bath at 100 ℃ for 5 minutes, and then cooled at room temperature for 1 minute;
c: centrifuging the cracked product at high speed for 2 minutes with the parameter of 10000 rpm;
d: taking 50 mu l of supernatant for subsequent quality control and target gene detection;
the quality control of nucleic acid, in this example, NanoReady (Hangzhou kansui) was used to control the quality of the extracted nucleic acid solution, and the parameters were A260/A280 nucleic acid concentration; and simultaneously, the Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid.
Example five: the method for extracting the EBV nucleic acid by the nucleic acid extracting solution
The nucleic acid extracting solution is used for extracting EBV nucleic acid, and comprises the following specific steps:
a: centrifuging and precipitating the prepared 1ml of mixed bacterium liquid at 14000rpm for 1 minute, and removing the supernatant;
b: adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then placing the mixture in a water bath at 100 ℃, standing for 10 minutes, and then cooling for 3 minutes at room temperature;
c: centrifuging and precipitating the lysate at high speed with the parameter of 14000rpm for 2 minutes;
d: taking 150 mu l of supernatant for subsequent quality control and target gene detection;
the quality control of nucleic acid, in this example, NanoReady (Hangzhou kansui) was used to control the quality of the extracted nucleic acid solution, and the parameters were A260/A230 nucleic acid concentration; and simultaneously, the Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid.
Results and discussion: comparing the extraction time, the extraction cost, the quality control of extracted nucleic acid, the total extraction amount, the qPCR amplification detection result and the like with a control group, it can be known that the EBV in the simulation and metagenome samples can be efficiently extracted by the methods in the third, fourth and fifth embodiments of the invention, and the cost and time comparison data of the method of the invention and the traditional EBV nucleic acid extraction method are as follows (the data of the method of the invention is the average value of the data of the methods in the third, fourth and fifth embodiments):
| method comparison | Cost (Yuan/times) | Cost improvement factor | Operating time (minutes) | Time improvement factor |
| The method of the invention | 0.25 | 1 | 25 | 1 |
| |
40 | 160 | 90 | 3.6 |
| |
10 | 40 | 60 | 2.4 |
According to the data, the cost of the method is reduced by 160 times compared with the column method, and the time is shortened by 3.6 times; compared with the magnetic bead method, the method of the invention has the advantages that the cost is reduced by 40 times, and the time is shortened by 2.4 times.
Example six: method for extracting and detecting EBV nucleic acid by using nucleic acid extracting solution
In this example, the complex sample set was used for nucleic acid extraction, qPCR amplification, qPCR detection and result analysis of EBV.
(1) Extracting nucleic acid of EBV by using the nucleic acid extraction detection reagent of the embodiment 1;
(2) designing and synthesizing primers: after downloading the EBV genome from NBCI (https:// www.ncbi.nlm.nih.gov/taxonomy/10376), Primer design was performed using Primer3 (https:// bioinfo. ut. ee/Primer3-0.4.0/Primer3/), with the following information on Primer sequences: EBV-F: GTCCTGCAGCTATTTCTGGT, respectively; EBV-R: GAGGGCTAGGGAGAGGTAGAAG, respectively; then, primer synthesis is carried out through Shanghai worker; finally, dissolving the synthesized primer by using enzyme-free water, wherein the final concentration is 10 mu M;
(3) qPCR amplification: the kit is carried out by adopting a fluorescent quantitative detection kit, and the kit is a Talent fluorescent quantitative detection kit (SYBR Green) (cargo number: FP 209); the PCR amplification system is as follows:
(4) qPCR detection and result analysis: analyzing the amplification result by an ABI 7500 fluorescence quantitative PCR instrument; and (3) carrying out relative quantitative analysis on the amplified EBV nucleic acid by combining the results of the dissolution curves to obtain that the extracted nucleic acid contains EBV genes, so that the method is shown to be capable of extracting EBV genomic DNA.
From the above results, it can be seen that when the addition is 102After copy/ml dosing, the detected RPM was compared to 103The copy number/ml shows large difference, but the EBV can still be stably detected, so the detection limit of the extraction method can reach 102Number of copies/ml.
Example seven: detection of EBV in mixed microbial strains by means of second-generation metagenomic sequencing (mNGS)
The method comprises the following specific steps:
(1) breaking and building a library: the operation steps provided by the kit are adopted to interrupt and build the library by adopting a domestic Novovzan second-generation library building kit (the cargo number is ND 617);
(2) and (3) machine sequencing: adopting an Illumina computer-on sequencing kit (cargo number: 20024906), and utilizing a kit recommendation operation instruction to complete computer-on sequencing;
(3) and (3) data analysis: after the offline data are subjected to quality control and anthropogenic source removal, reads of TB specific and other species are identified by using Blast, and finally, identification information is output in batches as shown in the following table.
Example eight: method for determining extraction limit of EBV nucleic acid
In this example, the EBV extraction limit of EBV nucleic acid was initially explored by setting the EBV input amount with different copy numbers, and the specific steps are as follows:
(1) setting a complex sample group: the main difference is the difference in copy number of the inactivated EBV added; the number of copies of EBV experimentally input in this example was 102，103And 104Copy number/ml; background organisms include ten common microorganisms contained in Zymo, using parameters of 1.4X106cell/ml; meanwhile, a humanized HeLa cell strain is added, and the use parameter is 1.0x105cell/ml；
(2) The method provided by the embodiment of the invention is used for extracting the nucleic acid of the sample, and performing concentration measurement and quality control;
(3) the control method group adopts column method extraction, preferably a Qiagen nucleic acid extraction kit for control test;
(4) carrying out mNGS sequencing verification on the detection of the nucleic acid of the simulated mixed sample according to the seventh step embodiment, and determining the extraction limit of the method for extracting the EBV nucleic acid;
results and discussion: as can be determined from the data in the table below, the present method allows the extraction of two different copy numbers (10)2，103And 104Copy number/ml) of EBV nucleic acid, and the number of reads after second-generation sequencing is kept at 102Above, it is demonstrated that the method can be used for extracting EBV nucleic acid in a complex sample background.
Example nine: performance comparison of different DNA virus nucleic acid extraction detection reagents
In the embodiment of the invention, the complex sample group of the embodiment of the invention is extracted by using the method of the embodiment 3 for extracting the DNA virus nucleic acid extraction detection reagents with different combinations, and the result of the complex sample group is compared with the data of the EBV extraction detection limit establishing reference line 9. The results obtained are shown in the following table:
| processing number | Name of process | Performance enhancement (fold; Total DNA yield/treatment 9) |
| 1 | Buffer1(InstaGene+Tri+SDS+KCl+EDTA+Sarkosyl) | 10±0.45 |
| 2 | Buffer2(InstaGene+Tri+SDS+EDTA+Sarkosyl) | 6.5±0.65 |
| 3 | Buffer3(InstaGene+Tri+SDS+Sarkosyl) | 5.8±0.48 |
| 4 | Buffer4(InstaGene+Tri+Sarkosyl) | 1.5±0.55 |
| 5 | Buffer5(InstaGene+Tri+KCl) | 3.8±0.35 |
| 6 | Buffer6(Tri+SDS+KCl+EDTA+Sarkosyl) | 4.1±0.44 |
| 7 | Buffer7(InstaGene+Tri+EDTA) | 3.7±0.43 |
| 8 | Buffer8(InstaGene+Tri+KCl+EDTA) | 5.1±0.55 |
| 9 | Qiagenkit | 1.0±0.25 |
In the test of taking the detection reagent, the mass concentration of the selected InstaGene Matrix is 7%, the mass concentration of a Tris-HCl substance is 50m mol/L, the pH value is 8.0, the mass concentration of SDS is 10%, the mass concentration of a KCl substance is 50m mol/L, the mass concentration of an EDTA substance is 5m mol/L, and the mass concentration of Sarkosyl is 2%. The action and the mutual relation of the substances are judged by continuously increasing and decreasing the substance detection and comparing with the data which are already published and reported by the substance.
As can be seen from the above data and the published data of the above substances, the reagent for extracting and detecting DNA virus nucleic acid provided by the component 1 in the embodiment of the application has the best effect, and the extraction performance is not influenced by the uniform degree of one or more components; meanwhile, the different components are in certain correlation, wherein the action proportion of the detergent and the chelating agent accounts for a higher level, the invention discovers that the substances not only have the functions of breaking cells, chelating divalent ions of EDTA, buffering and the like, but also have influence on other reagents through repeated experiments of examples, and the invention discovers that the combination of InstaGene, Tri, SDS, KCl, EDTA and Sarkosyl plays a good synergistic effect.
Example ten: performance comparison of different nucleic acid extraction detection reagents suitable for DNA viruses
In the embodiment of the present invention, the usage amounts of the substances in embodiment 1 are adjusted, the method in embodiment 3 is respectively used to extract the complex sample set in the embodiment of the present invention, and the results of the complex sample set are compared with the baseline established by using the EBV extraction detection limit. The results obtained are shown in the following table:
in the above-mentioned nucleic acid extraction detection reagent test, different mass concentrations of InstaGene Matrix, Tris-HCl, KCl and EDTA and different mass concentrations of SDS and Sarkosyl are selected, wherein the numbers 1,2,3, 4, 5, 7 and 8 are test groups, the numbers 6, 9, 10, 11, 12, 13, 14 and 15 are control groups with individual substance concentrations out of the range of the application, and 16 is a reference group. The combination of InstaGene, Tri, SDS, KCl, EDTA and Sarkosyl according to the invention, in addition to a very good synergistic effect, was found to have a great effect on the results of the combination by comparison of the amounts of the substances, and to be extremely sensitive to the range, which is quite different from the expectation that the amounts of the respective substances according to the invention could be obtained by a single experiment, and the decrease in performance was evident beyond the limits of the concentration ranges according to the invention, which would be an increase or decrease in the equivalent to a certain amount, affecting the other agents.
Example eleven: comparison of detection reagent performances of different nucleic acid extraction methods
The comparison with the conventional column extraction process shows that the method has obvious advantages in EBV nucleic acid extraction, and the second-generation sequencing data show that the RPM value difference multiple of EBV obtained by the two methods is 9.4 times on specific performance parameters. Therefore, the method has obvious performance advantages compared with the traditional extraction method.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Claims (10)
1. A DNA virus nucleic acid extraction detection reagent is characterized in that the extraction detection reagent consists of InstaGene Matrix, Tris-HCl, SDS, KCl, EDTA and Sarkosyl.
2. The reagent of claim 1, wherein the InstaGene Matrix is present in the reagent at a concentration of 1% to 15% by weight; the amount concentration of the Tris-HCl substance is 10-100 mmols/L, and the pH value is 8.0; the mass concentration of SDS is 1% -20%; the mass concentration of KCl substance is 10-100m mol/L; the quantity concentration of EDTA substance is 1-10 mmol/L; the mass concentration of the Sarkosyl is 1-5%.
3. The DNA virus nucleic acid extraction and detection reagent of claim 1, wherein the extraction and detection reagent is a buffer solution; the buffer solution is autoclaved after preparation and stored at 4 ℃ for a long time for later use.
4. A DNA virus nucleic acid extraction and detection method is characterized by comprising the following steps:
(1) centrifuging and precipitating the sample containing the virus with the parameter of 10000-;
(2) adding a nucleic acid extraction detection reagent comprising InstaGene Matrix, Tris-HCl, SDS, KCl, EDTA and Sarkosyl into the colony precipitate obtained in the step (1), and shaking and uniformly mixing; then placing the mixture in a boiling water bath, placing for 5-10 minutes, and then cooling for 1-3 minutes at room temperature;
(3) centrifuging and precipitating the cracking product at a high speed with the parameter of 10000-;
(4) and taking the supernatant for subsequent quality control and target gene detection.
5. The method for extracting and detecting DNA virus nucleic acid according to claim 4, further comprising: the method comprises the following steps of primer design and synthesis, qPCR amplification, qPCR detection and result analysis.
6. The method for extracting and detecting DNA virus nucleic acid according to claim 4, further comprising: breaking and building a library, performing computer sequencing and analyzing data.
7. A DNA virus nucleic acid extraction detection kit is characterized by comprising an extraction detection reagent, wherein the extraction detection reagent contains an InstaGene Matrix with a mass concentration of 1-15%; the mass concentration of the substance is 10-100 mmol/L/LTris-HCl, and the pH is 8.0; SDS with the mass concentration of 1-20%; KCl with the mass concentration of 10-100m mol/L; EDTA with the mass concentration of the substance of 1mmol/L-10m mol/L; sarkosyl with the mass concentration of 1-5%.
8. The DNA virus nucleic acid extraction detection reagent of claim 1 or the DNA virus nucleic acid extraction detection kit of claim 7 for use in EBV nucleic acid extraction detection.
9. The use of the DNA virus nucleic acid extraction detection reagent or kit of claim 8 in EBV nucleic acid extraction detection, wherein the primer sequence information used for the extraction detection is: EBV-F: GTCCTGCAGCTATTTCTGGT, respectively; EBV-R: GAGGGCTAGGGAGAGGTAGAAG is added.
10. A method for determining the extraction limit of EBV nucleic acids, comprising the steps of:
(1) setting up a combination of multiple different microorganisms and addingAdding human source background, the input parameter of EBV is 102，103And 104Copy number/ml;
(2) nucleic acid extraction: centrifuging and precipitating the prepared 1ml of mixed bacteria liquid with the parameter of 10000-; adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then placing the mixture in a water bath at 100 ℃, standing for 5-10 minutes, and then cooling for 1-3 minutes at room temperature; centrifuging and precipitating the cracking product at a high speed with the parameter of 10000-; taking 50-150 mul of supernatant for subsequent quality control and target gene detection;
(3) and (3) concentration measurement and quality control: using NanoReady to carry out quality control on the extracted nucleic acid solution, wherein the parameters are A260/A280 and A260/A230; meanwhile, the Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid;
(4) extraction of the control method group: extracting according to a column method;
(5) and (3) comparing extraction results: the comparative parameters include extraction time, extraction cost, quality control of extracted nucleic acid, total extraction amount, and qPCR amplification detection result;
(6) and (3) carrying out mNGS sequencing verification on detection interruption and library building, on-machine sequencing and data analysis of the simulated mixed sample nucleic acid, and determining the extraction limit of extracting the EBV nucleic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210351200.6A CN114591945B (en) | 2022-04-02 | 2022-04-02 | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210351200.6A CN114591945B (en) | 2022-04-02 | 2022-04-02 | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114591945A true CN114591945A (en) | 2022-06-07 |
| CN114591945B CN114591945B (en) | 2022-12-06 |
Family
ID=81821494
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210351200.6A Active CN114591945B (en) | 2022-04-02 | 2022-04-02 | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114591945B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024066120A1 (en) * | 2022-09-27 | 2024-04-04 | 上海伯杰医疗科技股份有限公司 | Virus nucleic acid sample diluent, virus nucleic acid sample extraction kit, and virus nucleic acid extraction method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420403A (en) * | 2016-01-14 | 2016-03-23 | 北京纳捷诊断试剂有限公司 | Real-time fluorescence quantification PCR method with magnetic bead nucleic acid extraction and amplification conducted in one tube |
| CN108220484A (en) * | 2017-03-03 | 2018-06-29 | 绍兴迅敏康生物科技有限公司 | One-step method detects EBV, CMV, the kit and detection method of HSV-6 herpesvirals simultaneously |
-
2022
- 2022-04-02 CN CN202210351200.6A patent/CN114591945B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420403A (en) * | 2016-01-14 | 2016-03-23 | 北京纳捷诊断试剂有限公司 | Real-time fluorescence quantification PCR method with magnetic bead nucleic acid extraction and amplification conducted in one tube |
| CN108220484A (en) * | 2017-03-03 | 2018-06-29 | 绍兴迅敏康生物科技有限公司 | One-step method detects EBV, CMV, the kit and detection method of HSV-6 herpesvirals simultaneously |
Non-Patent Citations (2)
| Title |
|---|
| ASIM K等: "Identification and Isolation of Oyster Genes Resistant to Pollutants Using Genechip Technology", 《HTTPS://REPOSITORY.LIBRARY.NOAA.GOV/VIEW/NOAA/38186/NOAA_38186_DS1.PDF》 * |
| 娄高明等: "PCR 检测伪狂犬病病毒DNA", 《中国生物化学与分子生物学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024066120A1 (en) * | 2022-09-27 | 2024-04-04 | 上海伯杰医疗科技股份有限公司 | Virus nucleic acid sample diluent, virus nucleic acid sample extraction kit, and virus nucleic acid extraction method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114591945B (en) | 2022-12-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
| EP3347491B1 (en) | Purification of nucleic acid from environmental or biological samples | |
| CN107955832B (en) | Primer set and method for simultaneously detecting thalassemia, deafness, phenylketonuria and hepatolenticular degeneration disease | |
| JP2016512045A (en) | One-step nucleic acid amplification method for non-eluting samples | |
| WO2019147555A1 (en) | A method for enrichment and purification of cell-free dna from body fluid for high-throughput processing | |
| CN114591945B (en) | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof | |
| EP3277809B1 (en) | Isolation of nucleic acids | |
| CN113046484B (en) | Primer probe, kit and method for detecting African swine fever virus p72 gene | |
| EP3810800A1 (en) | Mitochondrial nucleic acid depletion and detection | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| CN107586886B (en) | Reagent and method for rapidly detecting porcine adenovirus | |
| US20210207125A1 (en) | Method of isolating nucleic acids for long sequencing reads | |
| CN114592036B (en) | Actinomycete nucleic acid extraction detection reagent, kit, method and application thereof | |
| CN106148483B (en) | Primer and method for detecting escherichia coli cell DNA | |
| CN112063615A (en) | Genome DNA extracting solution, genome DNA extracting method and application thereof | |
| CN114561380B (en) | Bacterial nucleic acid extraction detection reagent, kit, method and application thereof | |
| CN113249375A (en) | High-throughput detection method for rapidly and efficiently enriching fecal viruses | |
| JP2022533269A (en) | Method for detecting rare DNA sequences in stool samples | |
| CN111172319A (en) | Primer pair for detecting porcine epidemic diarrhea virus, kit and application thereof | |
| CN114107325B (en) | Metagenome internal reference, preparation method and application thereof, and metagenome blood flow pathogen detection method | |
| CN110964849B (en) | Method for eliminating African swine fever virus detection false positive and kit for detecting African swine fever virus | |
| CN116926065B (en) | Nucleic acid extraction kit suitable for detecting pathogenic microorganisms and host residues and extraction method thereof | |
| CN113969281B (en) | Modified CrRNA fragment and African swine fever virus kit | |
| CN117126945A (en) | Method for rapidly detecting schistosome nucleic acid based on CRISPR-Cas14a1 system and kit for detecting schistosomiasis | |
| CN116949218A (en) | RAA-CRISPR kit for detecting type III cyprinid herpesvirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |