CN114591945B - DNA virus nucleic acid extraction detection reagent, kit, method and application thereof - Google Patents
DNA virus nucleic acid extraction detection reagent, kit, method and application thereof Download PDFInfo
- Publication number
- CN114591945B CN114591945B CN202210351200.6A CN202210351200A CN114591945B CN 114591945 B CN114591945 B CN 114591945B CN 202210351200 A CN202210351200 A CN 202210351200A CN 114591945 B CN114591945 B CN 114591945B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- extraction
- ebv
- detection
- detection reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a DNA virus nucleic acid extraction detection reagent, a kit, a method and an application thereof, wherein the extraction detection reagent consists of InstaGeneMatrix, tris-HCl, SDS, KCl, EDTA and Sarkosyl; EBV nucleic acid can be rapidly and efficiently extracted from a complex sample, and the potential clinical applicability of the extraction method is verified.
Description
Technical Field
The invention relates to the technical field of biology, in particular to the technical field of extraction and detection of DNA virus nucleic acid.
Background
Epstein-Barr virus (EBV) is a member of the genus lymphotropic virus of the family Herpesviridae, and its genome is DNA. EBV has the biological property of specifically infecting human and certain primate B cells in vitro and in vivo. Humans are hosts of EBV infection and are mainly transmitted by saliva, asymptomatic infection often occurs in young children, more than 90% of young children 3-5 years old are infected with EBV, and more than 90% of adults have virus antibodies. EBV is the pathogen of infectious monocytogenes, has close correlation with occurrence of nasopharyngeal carcinoma and children lymphoma, and is classified as one of possible carcinogenic human tumor viruses.
For scientific prevention and control and diagnosis of EBV, the DNA virus needs to be optimized for nucleic acid extraction, so as to facilitate deep research in later period, such as molecular diagnosis and the like. The commercial kit which is relied on by the current virus extraction method has low extraction speed and low working efficiency, and the residual virus is difficult to clean in the later period. For example, the extraction of viral nucleic acids is typically performed by lysis with a guanidinium salt, which solubilizes the proteins and causes the viral particles to break up, allowing the nucleoprotein to be rapidly separated from the nucleic acid due to the disruption of its secondary structure. However, the guanidine salt requires a longer lysis time in the actual lysis process, the addition time of the lysis solution is different from that of the binding solution, and protease K needs to be added to assist in lysis, so that the extraction time of the viral nucleic acid is too long, and the extraction efficiency is low. In addition, steps such as ultrasonic treatment, bead beating, enzyme, mixing (vortex), mechanical shearing, chaotropic solution and the like can be adopted for extracting the virus nucleic acid, but the steps cannot directly realize the extraction purpose, and the actual extraction procedure is required for extraction after the treatment, so that the complexity and the operation time are added in the whole extraction process finally.
Disclosure of Invention
Aiming at one of the technical problems recorded in the content, the invention provides a DNA virus nucleic acid extraction detection reagent, a kit, a method and application thereof, and by the method, not only can the cross contamination among samples be reduced, but also the infectious virus can be effectively inactivated, the whole virus nucleic acid extraction period is greatly shortened, and the extraction limit can be improved to 100 copies/ml. Compared with the traditional extraction method, the method has the advantages that the efficiency of extracting DNA virus nucleic acid is improved by at least 10 times, the cost is greatly saved, the extraction efficiency is improved, and the practical problems of low efficiency and high cost of the existing DNA virus extraction are solved.
In a first aspect, the invention provides a DNA virus nucleic acid extraction detection reagent, which consists of InstaGene Matrix, tris-HCl, SDS, KCl, EDTA and Sarkosyl.
Further, the mass concentration of the InstaGene Matrix in the detection reagent is 1% -15%; the amount concentration of the Tris-HCl substance is 10-100 mmols/L, and the pH value is 8.0; the mass concentration of SDS is 1% -20%; the mass concentration of KCl substance is 10mmol/L-100m mol/L; the amount concentration of EDTA substance is 1-10 mol/L; the mass concentration of the Sarkosyl is 1-5%.
In the invention, the extraction detection reagent is a buffer solution; the buffer solution is autoclaved after preparation and stored at 4 ℃ for a long time for later use.
In a second aspect, the present invention provides a DNA virus nucleic acid extraction and detection method, comprising the following steps:
(1) The virus-containing samples were pelleted by centrifugation at a parameter of 10000-14000rpm and the supernatant was removed.
(2) Adding a nucleic acid extraction detection reagent comprising InstaGene Matrix, tris-HCl, SDS, KCl, EDTA and Sarkosyl into the colony precipitate obtained in the step (1), and shaking and uniformly mixing; the mixture was then placed in a boiling water bath for 5-10 minutes, followed by cooling at room temperature for 1-3 minutes.
(3) The lysate is precipitated by high speed centrifugation with parameters of 10000-14000rpm for 2 minutes.
(4) And taking the supernatant for subsequent quality control and target gene detection.
Further, the extraction detection method of the present invention further comprises: breaking and building a library, performing computer sequencing and analyzing data.
Further, the extraction detection method of the present invention further comprises: the method comprises the following steps of primer design and synthesis, qPCR amplification, qPCR detection and result analysis.
In a third aspect, the invention also provides a DNA virus nucleic acid extraction detection kit, which comprises an extraction detection reagent, wherein the extraction detection reagent contains an InstaGene Matrix with a mass concentration of 1-15%; tris-HCl with pH of 8.0 and a substance concentration of 10-100 mmols/L; SDS with the mass concentration of 1-20%; KCl with the mass concentration of 10-100m mol/L; EDTA with the mass concentration of 1-10m mol/L; sarkosyl at a mass concentration of 1% to 5%.
In a fourth aspect, the invention provides an application of a DNA virus nucleic acid extraction detection reagent or an extraction detection kit in DNA virus nucleic acid extraction detection.
Specifically, the invention provides an application of the DNA virus nucleic acid extraction detection reagent or the kit in EBV nucleic acid extraction detection.
Furthermore, the sequence information of the primers used for extraction and detection in the invention is as follows: EBV-F: GTCCTGCAGGCTATTTCTGGT; EBV-R: GAGGGCTAGGGAGAGGTAGAAG.
In a fifth aspect, a method for determining the extraction limit of EBV nucleic acids, the method comprising the steps of:
(1) Setting a combination of a plurality of different microorganisms and adding a human source background, wherein the input parameter of the EBV is 10 3 And 10 4 Copy number/ml;
(2) Nucleic acid extraction: centrifuging and precipitating the prepared 1ml of mixed bacteria liquid with the parameters of 10000-14000rpm for 1 minute, and removing the supernatant; adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then placing the mixture in a water bath at 100 ℃, standing for 5-10 minutes, and then cooling for 1-3 minutes at room temperature; centrifuging and precipitating the lysate at high speed with the parameter of 10000-14000rpm for 2 minutes; taking 50-150 μ l of supernatant, preferably 100 μ l for subsequent quality control and target gene detection;
(3) And (3) concentration measurement and quality control: performing quality control on the extracted nucleic acid solution by using NanoReady, wherein the parameter is A260/A280; meanwhile, the Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid;
(4) Extraction of the control method group: extracting according to a column method;
(5) And (3) comparing extraction results: the comparative parameters include extraction time, extraction cost, quality control of extracted nucleic acid, total extraction amount, and qPCR amplification detection result;
(6) And (3) carrying out mNGS sequencing verification on detection interruption and library building, on-machine sequencing and data analysis of the simulated mixed sample nucleic acid, and determining the extraction limit of extracting the EBV nucleic acid.
By implementing the technical scheme of the invention, the following beneficial effects can be achieved:
the DNA virus nucleic acid extraction detection reagent, the kit and the method thereof can realize the rapid and efficient extraction of the EBV nucleic acid DNA, and the efficiency of extracting the DNA virus nucleic acid is improved by at least 2 times, compared with a column method, the method of the invention has the advantages that the cost is reduced by 160 times, compared with a magnetic bead method, the cost is reduced by 40 times, and the extraction detection limit of the EBV is improved to 100 copy numbers/ml; EBV nucleic acid can be rapidly and efficiently extracted from a complex sample, and the potential clinical applicability of the extraction method is verified.
Drawings
FIG. 1 is a flow chart of the extraction method of the present invention;
FIG. 2 is a diagram showing the result of qPCR amplification in EBV nucleic acid detection according to the present invention;
FIG. 3 is a graph of qPCR raw data and its analytical statistics;
legend: ct1 is repeat 1; ct2 is repeat 2; the Ct mean value is the mean value of Ct1 and Ct 2; the standard deviation is a value calculated from Ct1 and Ct 2. EBV-1,2,3 is 10 4 Copy number/ml, EBV-4,5,6 is 10 3 Number of copies/ml.
Detailed Description
The technical solutions in the embodiments of the present invention will be described clearly and completely with reference to the drawings in the specification, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.
The invention will be further understood by reference to the following detailed description of preferred embodiments of the invention and the examples included therein.
EBV used in the present invention was purchased from China center for type culture Collection. Extracting the bacterial nucleic acid by using a Qiagen nucleic acid extraction kit (a cargo number is 56204) through a column method, then quantifying by using a spectrophotometry method, checking the total mass of the nucleic acid which can be extracted by each tube, calculating the copy number of a genome by taking the total mass as a standard, and establishing a reference line for the subsequent extraction detection limit.
According to the sample group provided by the embodiment of the invention, the purchased EBV is utilized to simulate the EBV under the complex biological background, the EBV is provided with a combination of a plurality of different microorganisms and a human-derived background to increase the extraction complexity, and finally, a simulated sample capable of simulating the actual human body sample environment is formed. The specific microorganism combination is a commercial reagent Zymobiomics TM Microbiological Community Standard (Cat: D6300, hereinafter referred to as Zymo) comprising ten common microorganisms with the use parameter of 1.4x10 6 cell/ml; a human HeLa cell line (purchased from Nah Bio) was also added at the same time, with a use parameter of 1.0x10 5 cell/ml; EBV input parameter is 10 3 And 10 4 Number of copies/ml.
The comparison group compared with the extraction method of the invention carries out nucleic acid detection according to the extraction of a column method and a magnetic bead method, and the embodiment of the comparison group of the invention selects a Qiagen nucleic acid extraction kit to carry out the extraction of the bacterial nucleic acid by the column method.
The first embodiment is as follows: the invention relates to a DNA virus nucleic acid extraction and detection reagent
The preparation method of the solution comprises the following steps: instaGene Matrix (1-15%, w/v, bio-Rad), tris-HCl (10-100mM, pH 8.0), SDS (1-20%, w/v), KCl (10-100 mM) and EDTA (1-10 mM), sarkosyl (1-5%, w/v) were mixed; the buffer solution is prepared, autoclaved and subpackaged at 4 ℃ for long-term storage for later use.
Example two: the invention relates to a DNA virus nucleic acid extraction detection kit
The DNA virus nucleic acid extraction detection kit comprises an extraction detection reagent, wherein the extraction detection reagent contains InstaGene Matrix with the mass concentration of 1-15%; tris-HCl with pH of 8.0 and a substance concentration of 10-100m mol/L; SDS with the mass concentration of 1-20%; KCl with the mass concentration of 10-100m mol/L; EDTA with the mass concentration of 1-10m mol/L; sarkosyl at a mass concentration of 1% to 5%.
Example three: the method for extracting the EBV nucleic acid by the nucleic acid extracting solution
The nucleic acid extracting solution is used for extracting EBV nucleic acid, and comprises the following specific steps:
a: centrifuging and precipitating the prepared 1ml of mixed bacterium liquid with the parameters of 12000rpm for 1 minute, and removing the supernatant;
b: adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then placing the mixture in a water bath at 100 ℃, standing for 8 minutes, and then cooling for 1-3 minutes, preferably 2 minutes at room temperature;
c: centrifuging and precipitating the lysate at high speed with the parameter of 12000rpm for 2 minutes;
d: taking 100 mu l of supernatant for subsequent quality control and target gene detection;
the quality control of nucleic acid, in this example, nanoReady (Hangzhou kansui) was used to control the quality of the extracted nucleic acid solution, the parameters were A260/A280, A260/A230, and the concentration of nucleic acid; and simultaneously, the Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid.
Example four: the method for extracting the EBV nucleic acid by the nucleic acid extracting solution
The nucleic acid extracting solution is used for extracting EBV nucleic acid, and comprises the following specific steps:
a: centrifuging and precipitating the prepared 1ml of mixed bacterium liquid at the parameter of 10000rpm for 1 minute, and removing the supernatant;
b: adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then the mixture was placed in a water bath at 100 ℃ for 5 minutes, and then cooled at room temperature for 1 minute;
c: centrifuging the cracked product at high speed for precipitation with the parameter of 10000rpm for 2 minutes;
d: taking 50 mu l of supernatant for subsequent quality control and target gene detection;
the quality control of nucleic acid, in this example, nanoReady (Hangzhou kansui) was used to control the quality of the extracted nucleic acid solution, the parameters were A260/A280 nucleic acid concentration; and simultaneously, the Agilent 2100 is adopted to carry out quality control on the extracted nucleic acid.
Example five: the method for extracting the EBV nucleic acid by the nucleic acid extracting solution
The nucleic acid extracting solution is used for extracting EBV nucleic acid, and comprises the following specific steps:
a: centrifuging and precipitating the prepared 1ml of mixed bacteria liquid with the parameter of 14000rpm for 1 minute, and removing the supernatant;
b: adding 200 mul of nucleic acid extracting solution to the colony sediment, shaking and mixing uniformly; then placing the mixture in a water bath at 100 ℃, standing for 10 minutes, and then cooling for 3 minutes at room temperature;
c: centrifuging and precipitating the lysate at high speed with the parameter of 14000rpm for 2 minutes;
d: taking 150 mu l of supernatant for subsequent quality control and target gene detection;
the quality control of nucleic acid, in this example, nanoReady (Hangzhou kansui) was used to control the quality of the extracted nucleic acid solution, the parameters were A260/A230 nucleic acid concentration; meanwhile, agilent 2100 is adopted to carry out quality control on the extracted nucleic acid.
Results and discussion: comparing the extraction time, the extraction cost, the quality control of extracted nucleic acid, the total extraction amount, the qPCR amplification detection result and the like with a control group, it can be known that the EBV in the simulation and metagenome samples can be efficiently extracted by the methods in the third, fourth and fifth embodiments of the invention, and the cost and time comparison data of the method of the invention and the traditional EBV nucleic acid extraction method are as follows (the data of the method of the invention is the average value of the data of the methods in the third, fourth and fifth embodiments):
method comparison | Cost (Yuan/times) | Cost improvement factor | Operating time (minutes) | Time improvement factor |
The method of the invention | 0.25 | 1 | 25 | 1 |
|
40 | 160 | 90 | 3.6 |
|
10 | 40 | 60 | 2.4 |
According to the data, the cost of the method is reduced by 160 times compared with the column method, and the time is shortened by 3.6 times; compared with the magnetic bead method, the method of the invention has the advantages that the cost is reduced by 40 times, and the time is shortened by 2.4 times.
Example six: method for extracting and detecting EBV nucleic acid by using nucleic acid extracting solution
In the embodiment, a complex sample group is used for extracting nucleic acid of EBV, qPCR amplification, qPCR detection and result analysis.
(1) EBV nucleic acid extraction was performed using the nucleic acid extraction detection reagent of example 1 of the present invention;
(2) Designing and synthesizing a primer: after downloading the EBV genome from NBCI (https:// www.ncbi.nlm.nih.gov/taxonomy/10376), primer design was performed using Primer3 (https:// biolnfo.ut.ee/Primer 3-0.4.0/Primer3 /), with the following Primer sequence information: EBV-F: GTCCTGCAGGCTATTTCTGGT; EBV-R: GAGGGGCTAGGGAGAGGTAGAAG; then, primer synthesis is carried out through Shanghai worker; finally, dissolving the synthesized primer by using enzyme-free water, wherein the final concentration is 10 mu M;
(3) qPCR amplification: the kit is carried out by adopting a fluorescent quantitative detection kit, and a Talent fluorescent quantitative detection kit (SYBR Green) (cargo number: FP 209) is selected in the embodiment; the PCR amplification system is as follows:
(4) qPCR detection and result analysis: analyzing the amplification result by an ABI 7500 fluorescence quantitative PCR instrument; and (3) carrying out relative quantitative analysis on the amplified EBV nucleic acid by combining the results of the dissolution curves to obtain that the extracted nucleic acid contains EBV genes, so that the method is shown to be capable of extracting EBV genomic DNA.
From the above results, it can be seen that when 10 is added 2 After copy/ml dosing, the detected RPM was compared to 10 3 The copy number/ml shows large difference, but the EBV can still be stably detected, so the detection limit of the extraction method can reachTo 10 2 Copy number/ml.
Example seven: detection of EBV in mixed microbial strains by means of second-generation metagenomic sequencing (mNGS)
The method comprises the following specific steps:
(1) Breaking and building a library: the operation steps provided by the kit are adopted to interrupt and build the library by adopting a domestic Novovisan second-generation library building kit (the goods number is ND 617);
(2) And (3) machine sequencing: adopting an Illumina sequencing-on-machine kit (cargo number: 20024906) and utilizing a kit recommendation operation instruction to complete sequencing-on-machine;
(3) And (3) data analysis: after the offline data are subjected to quality control and anthropogenic source removal, reads of TB specific and other species are identified by using Blast, and finally, identification information is output in batches as shown in the following table.
Example eight: method for determining extraction limit of EBV nucleic acid
In this example, the EBV extraction limit of EBV nucleic acid was initially explored by setting the EBV input amount with different copy numbers, and the specific steps are as follows:
(1) Setting a complex sample group: the main difference is the difference in copy number of the inactivated EBV added; the number of copies of EBV experimentally input in this example was 10 2 ,10 3 And 10 4 Copy number/ml; the background organisms include ten common microorganisms contained in Zymo, with a use parameter of 1.4x10 6 cell/ml; meanwhile, a human HeLa cell strain is added, and the use parameter is 1.0x10 5 cell/ml;
(2) The method provided by the embodiment of the invention is used for extracting the nucleic acid of the sample, and performing concentration measurement and quality control;
(3) The control method group adopts a column method for extraction, and preferably selects a Qiagen nucleic acid extraction kit for control test;
(4) Carrying out mNGS sequencing verification on the detection of the nucleic acid of the simulated mixed sample according to the seventh step embodiment, and determining the extraction limit of the method for extracting the EBV nucleic acid;
results and discussion: as can be determined from the data in the table below, the method allows for the extraction of two different copy numbers (10) 2 ,10 3 And 10 4 Copy number/ml) of EBV nucleic acid, and the number of reads after second-generation sequencing is kept at 10 2 Above, it is demonstrated that the method can be used for extracting EBV nucleic acid in a complex sample background.
Example nine: performance comparison of different DNA virus nucleic acid extraction detection reagents
In the embodiment of the invention, the complex sample group of the embodiment of the invention is extracted by using the method of the embodiment 3 for extracting the DNA virus nucleic acid extraction detection reagents with different combinations, and the result of the complex sample group is compared with the data of the EBV extraction detection limit establishing reference line 9. The results obtained are shown in the following table:
processing number | Name of process | Performance enhancement (fold; total DNA yield/treatment 9) |
1 | Buffer1(InstaGene+Tri+SDS+KCl+EDTA+Sarkosyl) | 10±0.45 |
2 | Buffer2(InstaGene+Tri+SDS+EDTA+Sarkosyl) | 6.5±0.65 |
3 | Buffer3(InstaGene+Tri+SDS+Sarkosyl) | 5.8±0.48 |
4 | Buffer4(InstaGene+Tri+Sarkosyl) | 1.5±0.55 |
5 | Buffer5(InstaGene+Tri+KCl) | 3.8±0.35 |
6 | Buffer6(Tri+SDS+KCl+EDTA+Sarkosyl) | 4.1±0.44 |
7 | Buffer7(InstaGene+Tri+EDTA) | 3.7±0.43 |
8 | Buffer8(InstaGene+Tri+KCl+EDTA) | 5.1±0.55 |
9 | Qiagenkit | 1.0±0.25 |
In the test of taking the detection reagent, the selected InstaGene Matrix has the mass concentration of 7%, the mass concentration of a Tris-HCl substance is 50 mmol/L, the pH is 8.0, the mass concentration of SDS is 10%, the mass concentration of a KCl substance is 50 mmol/L, the mass concentration of an EDTA substance is 5 mmol/L, and the mass concentration of Sarkosyl is 2%. The action and the relation among each substance are judged by continuously increasing and decreasing the substance and comparing with the data which are already published and reported by the substance.
As can be seen from the above data and the published data of the above substances, the reagent for extracting and detecting DNA virus nucleic acid provided by the component 1 in the embodiment of the application has the best effect, and the extraction performance is not influenced by the uniform degree of one or more components; meanwhile, the different components are in certain correlation, wherein the action proportion of the detergent and the chelating agent accounts for a higher level, the invention discovers that the substances not only have the functions of breaking cells, chelating divalent ions of EDTA, buffering and the like, but also have influence on other reagents through repeated experiments of examples, and the invention discovers that the combination of InstaGene, tri, SDS, KCl, EDTA and Sarkosyl plays a good synergistic effect.
Example ten: performance comparison of different nucleic acid extraction detection reagents suitable for DNA viruses
In the embodiment of the present invention, the usage amounts of the substances in embodiment 1 are adjusted, the method in embodiment 3 is respectively used to extract the complex sample set in the embodiment of the present invention, and the results of the complex sample set are compared with the baseline established by using the EBV extraction detection limit. The results obtained are shown in the following table:
in the above-mentioned nucleic acid extraction detection reagent test, different mass concentrations of InstaGene Matrix, tris-HCl, KCl and EDTA and different mass concentrations of SDS and Sarkosyl are selected, wherein the numbers 1,2,3, 4,5, 7 and 8 are test groups, the numbers 6, 9, 10, 11, 12, 13, 14 and 15 are control groups with individual substance concentrations out of the range of the application, and 16 is a reference group. The combination of InstaGene, tri, SDS, KCl, EDTA and Sarkosyl according to the invention, in addition to a very good synergistic effect, was found to have a great effect on the results of the combination by comparison of the amounts of the substances, and to be extremely sensitive to the range, which is quite different from the expectation that the amounts of the respective substances according to the invention could be obtained by a single experiment, and the decrease in performance was evident beyond the limits of the concentration ranges according to the invention, which would be an increase or decrease in the equivalent to a certain amount, affecting the other agents.
Example eleven: comparison of detection reagent performances of different nucleic acid extraction methods
The comparison with the conventional column extraction process shows that the method has obvious advantages in EBV nucleic acid extraction, and the second-generation sequencing data show that the RPM value difference multiple of EBV obtained by the two methods is 9.4 times on specific performance parameters. Therefore, the method has obvious performance advantages compared with the traditional extraction method.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Claims (3)
1. A DNA virus nucleic acid extraction and detection method is characterized by comprising the following steps:
(1) Centrifuging and precipitating the sample containing the virus at the parameter of 10000-14000rpm, and removing the supernatant;
(2) Adding a nucleic acid extraction detection reagent to the colony sediment obtained in the step (1), wherein the extraction detection reagent consists of InstaGene Matrix, tris-HCl, SDS, KCl, EDTA and Sarkosyl, and the mass concentration of the InstaGene Matrix is 1-15%; the amount concentration of the Tris-HCl substance is 10-100 mmol/L, and the pH value is 8.0; the mass concentration of SDS is 1% -20%; the mass concentration of KCl substance is 10-100m mol/L; the quantity concentration of EDTA substance is 1-10 mmol/L; the mass concentration of the Sarkosyl is 1-5%; shaking and mixing uniformly; then placing the mixture in a boiling water bath, standing for 5-10 minutes, and then cooling for 1-3 minutes at room temperature;
(3) Centrifuging and precipitating the cracked product at high speed with the parameter of 10000-14000rpm;
(4) Taking the supernatant for subsequent quality control and target gene detection;
the extraction detection method further comprises the following steps: the method comprises the following steps of primer design and synthesis, qPCR amplification, qPCR detection and result analysis.
2. The method for extracting and detecting DNA virus nucleic acid according to claim 1, further comprising: breaking and building a library, performing computer sequencing and analyzing data.
3. The method for extracting and detecting DNA virus nucleic acid according to claim 1, wherein the extraction detection reagent is prepared, autoclaved, and stored at 4 ℃ for a long time for use.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210351200.6A CN114591945B (en) | 2022-04-02 | 2022-04-02 | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210351200.6A CN114591945B (en) | 2022-04-02 | 2022-04-02 | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN114591945A CN114591945A (en) | 2022-06-07 |
CN114591945B true CN114591945B (en) | 2022-12-06 |
Family
ID=81821494
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202210351200.6A Active CN114591945B (en) | 2022-04-02 | 2022-04-02 | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN114591945B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115386575A (en) * | 2022-09-27 | 2022-11-25 | 上海伯杰医疗科技股份有限公司 | Virus nucleic acid sample diluent, virus nucleic acid sample extraction kit and virus nucleic acid extraction method |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105420403B (en) * | 2016-01-14 | 2019-04-05 | 北京纳捷诊断试剂有限公司 | A kind of real time fluorescence quantifying PCR method for carrying out magnetic bead in a pipe and extracting nucleic acid and amplification |
CN106636446A (en) * | 2017-03-03 | 2017-05-10 | 绍兴迅敏康生物科技有限公司 | Direct real-time quantitative PCR method of throat swab sample or nasopharyngeal swab sample |
-
2022
- 2022-04-02 CN CN202210351200.6A patent/CN114591945B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN114591945A (en) | 2022-06-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
CN107955832B (en) | Primer set and method for simultaneously detecting thalassemia, deafness, phenylketonuria and hepatolenticular degeneration disease | |
CN108368539A (en) | Nucleic acid purification in environment or biological sample | |
JP6559647B2 (en) | One-step nucleic acid amplification method for non-eluting samples | |
CN108026570A (en) | The composition and method of purification of nucleic acid from blood sample | |
CN114591945B (en) | DNA virus nucleic acid extraction detection reagent, kit, method and application thereof | |
EP3277809B1 (en) | Isolation of nucleic acids | |
Raymond et al. | UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA | |
US20210254135A1 (en) | Mitochondrial nucleic acid depletion and detection | |
Thatcher | Nucleic acid isolation | |
US20210207125A1 (en) | Method of isolating nucleic acids for long sequencing reads | |
CN114592036B (en) | Actinomycete nucleic acid extraction detection reagent, kit, method and application thereof | |
JPWO2018061877A1 (en) | Method for extracting nucleic acid and kit used therefor | |
CN112063615A (en) | Genome DNA extracting solution, genome DNA extracting method and application thereof | |
CN114561380B (en) | Bacterial nucleic acid extraction detection reagent, kit, method and application thereof | |
CN113249375A (en) | High-throughput detection method for rapidly and efficiently enriching fecal viruses | |
JP2022533269A (en) | Method for detecting rare DNA sequences in stool samples | |
CN110964849B (en) | Method for eliminating African swine fever virus detection false positive and kit for detecting African swine fever virus | |
CN114107325B (en) | Metagenome internal reference, preparation method and application thereof, and metagenome blood flow pathogen detection method | |
CN117126945A (en) | Method for rapidly detecting schistosome nucleic acid based on CRISPR-Cas14a1 system and kit for detecting schistosomiasis | |
CN116574782A (en) | Lesion tissue sample dissociation host method applied to mNGS pathogen detection | |
CN116949218A (en) | RAA-CRISPR kit for detecting type III cyprinid herpesvirus | |
CN117947195A (en) | One-step CRISPR/Cas12b detection kit and method for detecting salmonella | |
CN112322701A (en) | Pathogen microorganism metagenome de-hosting method and kit | |
CN117904100A (en) | Whole blood pathogenic bacteria nucleic acid extraction kit and extraction method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |