CN114561461A - Composition for detecting cervical cancer, kit and application thereof - Google Patents

Composition for detecting cervical cancer, kit and application thereof Download PDF

Info

Publication number
CN114561461A
CN114561461A CN202011356693.XA CN202011356693A CN114561461A CN 114561461 A CN114561461 A CN 114561461A CN 202011356693 A CN202011356693 A CN 202011356693A CN 114561461 A CN114561461 A CN 114561461A
Authority
CN
China
Prior art keywords
seq
primer
methylation
cervical cancer
probe combination
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202011356693.XA
Other languages
Chinese (zh)
Other versions
CN114561461B (en
Inventor
邵琦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Dajian Medical Technology Co ltd
GUANGZHOU TARGENE BIOTECH CO Ltd
Original Assignee
Anhui Dajian Medical Technology Co ltd
GUANGZHOU TARGENE BIOTECH CO Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Dajian Medical Technology Co ltd, GUANGZHOU TARGENE BIOTECH CO Ltd filed Critical Anhui Dajian Medical Technology Co ltd
Priority to CN202011356693.XA priority Critical patent/CN114561461B/en
Publication of CN114561461A publication Critical patent/CN114561461A/en
Application granted granted Critical
Publication of CN114561461B publication Critical patent/CN114561461B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a composition for detecting cervical cancer, a kit and application thereof, wherein a nucleic acid sample of the cervical cancer to be detected is subjected to bisulfite conversion by a bisulfite modification method, a fluorescence quantitative PCR technology is combined, a literature research result, a TCGA methylation chip database and a transcriptome sequencing expression profile are comprehensively analyzed, screening candidate genes for hypermethylation of cervical cancer by multiple data filtration analysis, designing specific gene methylation detection primers and probes aiming at a plurality of methylation detection sites on the candidate genes for hypermethylation of cervical cancer, covering more than 10 methylation CpG sites, amplifying the DNA sample to be detected modified by the bisulfite by a multiplex PCR amplification technology, and determining the methylation condition of the target gene in the sample to be detected according to the PCR amplification result, and improving the sensitivity and specificity of the kit through multiple ways to realize early screening and diagnosis of cervical cancer.

Description

Composition for detecting cervical cancer, kit and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a composition for detecting cervical cancer, a kit and application thereof.
Background
Cervical cancer (cervical cancer) is one of the most common reproductive system malignant tumors of women, is the second place among the female malignant tumors in the world, has the morbidity and mortality rate second to breast cancer, and seriously threatens the physical and psychological health of women. The cervical cancer is almost related to high-risk human papilloma virus (HR-HPV) infection, the onset age is 40 to 50 years at most, and the onset of the cervical cancer is younger in recent years. Cervical cancer occurs in the cervical region, and is mostly squamous carcinoma, and is secondarily adenocarcinoma and adenosquamous carcinoma, and is rarely classified into small cell carcinoma, clear cell carcinoma, etc. Cervical cancer does not generally have any symptoms in the early stage, and the symptoms such as contact bleeding and abnormal vaginal bleeding appear along with the progression of the disease, and the symptoms need to be actively screened to be discovered. The treatment effect of the cervical cancer is closely related to clinical stages, early-stage cervical cancer usually has better prognosis, early detection of the cervical cancer can increase the chance of retaining the uterus in operation, the overall survival rate is improved, early diagnosis and early treatment are the key for improving the cure rate, and the cervical cancer has the possibility of relapse, so that prognosis monitoring also needs to be taken into consideration, and the clinical significance is high on how to detect the cervical cancer as early as possible and how to detect the relapse of the cervical cancer in time after the operation.
The current cervical cancer diagnosis technology comprises the following steps: 1) cytological examination of cervical scrape: the method is easily influenced by subjective factors, has a certain false negative rate, and is easy to miss diagnosis; 2) imaging technology: MRI examination, B-ultrasonic examination and CT examination, but the small tumor is not sensitive enough and can not be diagnosed clearly; 3) colposcopy: the naked eyes can not observe whether the cancer is changed or not, and the medicine is not suitable for patients with vaginal stenosis, cervical surface necrosis and hemorrhage; 4) examination of cervical biopsy: the operation is complex, the requirement on the diagnosis level of a pathological diagnostician is high, the grading standard is fuzzy, and the high heterotypic cells (HSIL) and the low heterotypic cells (LSIL) are difficult to accurately distinguish. The invention adopts the latest methylation specificity real-time fluorescence PCR (MSP-PCR) technology, can realize the extraction of genome from cervical exfoliated cells and the detection of the methylation condition of cervical cancer related genes, and leads the collection of samples to be more convenient; the experimental result is stable, the repeatability is good, the kit is very suitable for periodic examination of high risk groups and early diagnosis of related groups, and a new thought and method are provided for early diagnosis of cervical cancer.
Epigenetics is a hot field of tumor research in recent years, epigenetic changes such as DNA methylation, histone modification, chromatin remodeling, and non-coding RNA regulation are considered to be closely related to tumor occurrence, wherein DNA methylation is the most common epigenetic change that can regulate cell proliferation, apoptosis, and differentiation, and the level is closely related to the biological characteristics of tumors. The current research shows that the cervical cancer is the same as other cancers and is the result of long-term action of various carcinogenic factors, the pathological process is a complex process of multigene variation accumulation, and the abnormal methylation of various oncogenes and cancer suppressor genes is involved, wherein most abnormal methylation is the hypermethylation of the cancer suppressor genes, and the hypermethylation often leads to the transcriptional silencing of the cancer suppressor genes. DNA methylation abnormality usually occurs in early cancer, and the methylation state of the DNA methylation abnormality changes once the DNA methylation abnormality is formed and needs to be continuously stimulated by external environment for a long time through the occurrence and development processes of the cancer, so that the detection of the DNA methylation index can be used as an important biological index for cancer diagnosis, early screening and prognosis.
Detection methods for DNA methylation can be broadly divided into two categories: whole genome methylation analysis and specific site methylation detection. The whole genome methylation analysis has higher detection cost and is often used as a high-throughput means for screening and discovering target genes; the specific site methylation detection method comprises a sodium bisulfite-combined restriction endonuclease analysis method (COBRA), a methylation specificity PCR Method (MSP), a methylation sensitivity high-resolution melting curve analysis method (MethyLight), and the like, wherein the restriction endonuclease analysis method can only obtain the methylation condition of a special enzyme cutting site, the methylation specificity PCR method is based on common PCR and electrophoresis analysis, has complicated operation and is easy to cause sample pollution, the methylation sensitivity high-resolution melting curve analysis method has higher requirements on the instrument, a fluorescence quantitative PCR instrument with a high-resolution melting (HRM) module is required, and the methylation fluorescence quantitative method is based on high flux and high sensitivity, does not need electrophoresis, hybridization and other operations after PCR, reduces pollution and operation errors, and is widely applied to DNA methylation detection. The existing method for detecting the DNA methylation of the cervical cancer based on the methylation fluorescence quantitative method has the defects of poor detection precision aiming at a single gene and limited diagnosis effect, researchers often improve the detection sensitivity by combining combined detection of a plurality of genes, but the specificity may be reduced due to the combined detection of the plurality of genes, and meanwhile, if the detection is carried out by adopting a single-tube single-gene test mode, more reagents are required to be consumed, the operation of experimenters is increased, and the experiment cost is higher.
Therefore, the market urgently needs to develop a stable and reliable noninvasive cervical cancer detection method with high sensitivity and specificity.
Disclosure of Invention
In view of the above, the invention provides a composition for detecting cervical cancer, a kit and an application thereof, wherein a nucleic acid sample of the cervical cancer to be detected is subjected to bisulfite conversion by a bisulfite modification method, and a fluorescence quantitative PCR technology is combined to comprehensively analyze a literature research result, a TCGA methylation chip database and a transcriptome sequencing expression profile, screening candidate genes for hypermethylation of cervical cancer by multiple data filtration analysis, designing specific gene methylation detection primers and probes aiming at a plurality of methylation detection sites on the candidate genes for hypermethylation of cervical cancer, covering more than 10 methylation CpG sites, amplifying the DNA sample to be detected modified by the bisulfite by a multiplex PCR amplification technology, and determining the methylation condition of the target gene in the sample to be detected according to the PCR amplification result, and improving the sensitivity and specificity of the kit through multiple ways to realize early screening and diagnosis of cervical cancer.
In order to achieve the above objects, the present invention provides, in a first aspect, a methylation detection site for a cervical cancer gene, wherein the methylation detection site for the gene comprises one or more of PCDH10, LMX1A, ZNF 582.
The second aspect of the invention provides a PCR primer probe combination for detecting methylation of cervical cancer genes, which comprises one or more of the following nucleic acid sequence combinations shown in 1) to 3):
1) PCR primers and probes for detecting methylation of PCDH10, comprising one or more of a primer probe combination 1, a primer probe combination 2 and a primer probe combination 3, wherein the primer probe combination 1 comprises an upstream primer shown as SEQ ID NO.1, a downstream primer shown as SEQ ID NO.2 and a fluorescent probe shown as SEQ ID NO.3, the primer probe combination 2 comprises an upstream primer shown as SEQ ID NO.4, downstream primers shown as SEQ ID NO.5 and SEQ ID NO.6 and a fluorescent probe shown as SEQ ID NO.7, and the primer probe combination 3 comprises an upstream primer shown as SEQ ID NO.8, downstream primers shown as SEQ ID NO.9 and SEQ ID NO.10 and a fluorescent probe shown as SEQ ID NO. 11;
2) the PCR primer and probe for detecting the methylation of LMX1A comprise one or more of a primer probe combination 4, a primer probe combination 5 and a primer probe combination 6, wherein the primer probe combination 4 comprises an upstream primer shown as SEQ ID NO.12, a downstream primer shown as SEQ ID NO.13 and a fluorescent probe shown as SEQ ID NO.14, the primer probe combination 5 comprises an upstream primer shown as SEQ ID NO.15, a downstream primer shown as SEQ ID NO.16 and a fluorescent probe shown as SEQ ID NO.17, and the primer probe combination 6 comprises an upstream primer shown as SEQ ID NO.18, a downstream primer shown as SEQ ID NO.19 and a fluorescent probe shown as SEQ ID NO. 20;
3) ZNF582 methylation detection PCR primers and probes comprise one or more of a primer probe combination 7, a primer probe combination 8 and a primer probe combination 9, wherein the primer probe combination 7 comprises an upstream primer shown as SEQ ID NO.21, a downstream primer shown as SEQ ID NO.22 and a fluorescent probe shown as SEQ ID NO.23, the primer probe combination 8 comprises an upstream primer shown as SEQ ID NO.24, a downstream primer shown as SEQ ID NO.25 and a fluorescent probe shown as SEQ ID NO.26, and the primer probe combination 9 comprises an upstream primer shown as SEQ ID NO.27, a downstream primer shown as SEQ ID NO.28 and a fluorescent probe shown as SEQ ID NO. 29.
In an embodiment of the present invention, the PCR primer probe combination for detecting methylation of a cervical cancer gene further includes a PCR primer and a probe for detecting an internal reference gene GAPDH, the primer includes an upstream primer shown in SEQ ID No.30 and a downstream primer shown in SEQ ID No.31, and the probe includes a fluorescent probe shown in SEQ ID No. 32.
In one embodiment of the invention, the 5' end of the fluorescent probe comprises a fluorescent reporter group, including any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY 5.
In one embodiment of the invention, the 3' end of the fluorescent probe comprises a fluorescence quenching group, including any one of MGB, BHQ-1, BHQ-2 and BHQ-3.
In a preferred embodiment of the present invention, the fluorescence quenching group is MGB.
The third aspect of the invention provides a kit for detecting methylation of cervical cancer genes, which comprises the PCR primer probe combination as described in the second aspect of the invention, and further comprises a positive quality control product and a negative quality control product.
In one embodiment of the invention, the positive quality control material is cervical cancer tissue DNA.
In one embodiment of the present invention, the negative quality control material is leukocyte DNA.
In an embodiment of the present invention, the final concentration composition of the reaction system of the cervical cancer gene methylation detection kit comprises: 0.1-1 μ M PCR primer, 0.1-1 μ M probe.
In a preferred embodiment of the present invention, the final concentration composition of the reaction system of the cervical cancer gene methylation detection kit comprises: 0.1-0.5 mu MPCR primer and 0.1-0.5 mu M probe.
In one embodiment of the invention, the fluorescence quantitative PCR reaction conditions of the kit for detecting methylation of cervical cancer genes are as follows:
Figure BDA0002802772760000031
in one embodiment of the invention, the fluorescence quantitative PCR reaction conditions of the kit for detecting methylation of cervical cancer genes are as follows:
Figure BDA0002802772760000032
Figure BDA0002802772760000041
the fourth aspect of the present invention provides a method for detecting methylation of a cervical cancer gene, comprising the steps of:
1) separating nucleic acid of a target gene in a biological sample to be detected;
2) subjecting the nucleic acid obtained in step 1) to bisulfite conversion treatment to obtain bisulfite converted DNA (Bis-DNA);
3) detecting the methylation state of the Bis-DNA obtained in the step 2) by adopting a methylation fluorescent quantitative PCR technology.
In an embodiment of the present invention, the biological sample in step 1) includes one of tissue and cell.
In a preferred embodiment of the present invention, the biological sample of step 1) comprises exfoliated cervical cells.
In the fifth aspect, the invention provides the cervical cancer gene methylation detection site according to the first aspect, the PCR primer probe combination for cervical cancer gene methylation detection according to the second aspect, the cervical cancer gene methylation detection kit according to the third aspect, or the cervical cancer gene methylation detection method according to the fourth aspect, in the preparation of the cervical cancer detection kit.
The invention has the following beneficial effects:
1) can be used as an important index for early screening, process monitoring and prognosis evaluation of cervical cancer: the kit for detecting the methylation of the cervical cancer gene takes DNA methylation abnormality as a detection object, the DNA methylation abnormality usually occurs in the early stage of cancer and runs through the occurrence and development processes of the cancer, and the methylation state of the DNA methylation abnormality changes once the DNA methylation abnormality is formed and needs to be continuously stimulated by external environment for a long time, so that the detection of the DNA methylation index can be used as an important biological index for early screening, process monitoring and prognosis evaluation of the cervical cancer;
2) non-invasive detection: the kit for detecting the methylation of the cervical cancer gene can assist in diagnosing the cervical cancer by detecting the methylation state of the cervical cancer related gene in the exfoliated cervical cell, so that noninvasive detection is realized;
3) single-tube multiple gene methylation detection: the joint inspection of the single-tube multiple gene methylation detection sites is established, so that the reagent consumption is reduced, the material consumption cost is reduced, the operation steps of experimenters are reduced, and the labor cost is reduced.
4) The accuracy is high: the cervical cancer gene methylation detection kit provided by the invention screens the cervical cancer hypermethylation candidate gene through multiple data analysis, designs specific gene methylation detection primers and probes aiming at a plurality of methylation detection sites on the cervical cancer hypermethylation candidate gene, covers more than 10 methylation CpG sites, adopts a multiple PCR amplification technology to amplify a DNA sample to be detected modified by bisulfite, by combining the methylation profiles of different genes for joint detection or by detecting multiple different methylation detection regions of a single gene, meanwhile, in order to further improve the detection sensitivity, the invention designs two upstream primers or two downstream primers aiming at one methylation detection region of a single gene, the sensitivity and specificity of the kit are improved through various ways, and the accurate detection of the early screening and diagnosis of the cervical cancer is realized.
Drawings
FIG. 1 is a positive diagram of typical detection results of cervical cancer gene methylation detection provided in an embodiment of the present invention, wherein the CT value of a gene methylation detection site is less than or equal to 25 and less than the CT value of an internal reference gene, and the detection result is determined to be positive;
FIG. 2 is a positive diagram of another exemplary detection result of methylation detection of cervical cancer genes, wherein the CT value of the methylation detection site of the gene is less than or equal to 25, is greater than the CT value of an amplified reference gene, the Delta CT value is less than or equal to 5, and the result is determined to be positive;
FIG. 3 is a negative diagram of typical detection results of methylation detection of cervical cancer genes, wherein the CT value of the methylation detection site of the gene is greater than the CT value of an internal reference gene and the Delta CT value is greater than 5, and the result is determined to be negative.
Detailed Description
The present invention is described in detail below with reference to specific examples so that those skilled in the art can easily practice the present invention in light of the disclosure of the present specification. The embodiments described below are only a part of the embodiments of the present invention, and not all of them. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Unless otherwise indicated, the reagents, methods and apparatus used in the present invention are conventional in the art, and experimental methods without specific conditions being indicated are generally performed according to conventional conditions or conditions recommended by the manufacturer.
According to the invention, a bisulfite modification method is adopted to carry out bisulfite conversion on a cervical cancer nucleic acid sample to be detected, a fluorescence quantitative PCR technology is combined, a literature research result, a TCGA methylation chip database and a transcriptome sequencing expression profile are comprehensively analyzed, a cervical cancer hypermethylation candidate gene is screened through multiple data filtration analysis, a specific gene methylation detection primer and a specific gene methylation detection probe are designed, a DNA sample to be detected modified by bisulfite is amplified, the methylation condition of a target gene in the sample to be detected is determined according to a PCR amplification result, and the early screening and diagnosis of the cervical cancer are realized.
The gene methylation detection site of the cervical cancer gene methylation detection kit provided by the invention comprises one or more of PCDH10, LMX1A and ZNF 582.
The PCR primer probe combination of the cervical cancer gene methylation detection kit provided by the invention comprises one or more of the following nucleic acid sequence combinations shown in 1) -3):
1) PCR primers and probes for detecting methylation of PCDH10, comprising one or more of a primer probe combination 1, a primer probe combination 2 and a primer probe combination 3, wherein the primer probe combination 1 comprises an upstream primer shown as SEQ ID NO.1, a downstream primer shown as SEQ ID NO.2 and a fluorescent probe shown as SEQ ID NO.3, the primer probe combination 2 comprises an upstream primer shown as SEQ ID NO.4, downstream primers shown as SEQ ID NO.5 and SEQ ID NO.6 and a fluorescent probe shown as SEQ ID NO.7, and the primer probe combination 3 comprises an upstream primer shown as SEQ ID NO.8, downstream primers shown as SEQ ID NO.9 and SEQ ID NO.10 and a fluorescent probe shown as SEQ ID NO. 11;
2) the PCR primer and probe for detecting the methylation of LMX1A comprise one or more of a primer probe combination 4, a primer probe combination 5 and a primer probe combination 6, wherein the primer probe combination 4 comprises an upstream primer shown as SEQ ID NO.12, a downstream primer shown as SEQ ID NO.13 and a fluorescent probe shown as SEQ ID NO.14, the primer probe combination 5 comprises an upstream primer shown as SEQ ID NO.15, a downstream primer shown as SEQ ID NO.16 and a fluorescent probe shown as SEQ ID NO.17, and the primer probe combination 6 comprises an upstream primer shown as SEQ ID NO.18, a downstream primer shown as SEQ ID NO.19 and a fluorescent probe shown as SEQ ID NO. 20.
3) ZNF582 methylation detection PCR primers and probes comprise one or more of a primer probe combination 7, a primer probe combination 8 and a primer probe combination 9, wherein the primer probe combination 7 comprises an upstream primer shown as SEQ ID NO.21, a downstream primer shown as SEQ ID NO.22 and a fluorescent probe shown as SEQ ID NO.23, the primer probe combination 8 comprises an upstream primer shown as SEQ ID NO.24, a downstream primer shown as SEQ ID NO.25 and a fluorescent probe shown as SEQ ID NO.26, and the primer probe combination 9 comprises an upstream primer shown as SEQ ID NO.27, a downstream primer shown as SEQ ID NO.28 and a fluorescent probe shown as SEQ ID NO. 29.
In an embodiment of the present invention, the PCR primer probe combination for detecting methylation of a cervical cancer gene further includes a PCR primer and a probe for detecting an internal reference gene GAPDH, the primer includes an upstream primer shown in SEQ ID No.30 and a downstream primer shown in SEQ ID No.31, and the probe includes a fluorescent probe shown in SEQ ID No. 32.
Preferably, the 5' end of the fluorescent probe comprises a fluorescent reporter group, including any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY 5.
Preferably, the 3' end of the fluorescent probe comprises a fluorescence quenching group, including any one of MGB, BHQ-1, BHQ-2 and BHQ-3.
Further preferably, the fluorescence quenching group is MGB.
The cervical cancer gene methylation detection kit provided by the invention comprises a detection sample including one of tissues and cells.
The interpretation of the detection result of the cervical cancer gene methylation detection kit provided by the invention comprises the following steps:
1) setting a threshold value: the baseline can be adjusted either automatically per instrument or manually according to the instructions for use of the instrument, the threshold is set in the linear portion of the log plot of fluorescence values, data is derived from the software and CT values are read.
2) And (3) judging the effectiveness of the kit:
the negative quality control product has the reference gene amplified and the CT value is less than or equal to 25, and the gene methylation detection site is not amplified; the reference gene and the gene methylation detection site of the positive quality control product are amplified, and the CT value is less than or equal to 25.
3) And (3) judging the effectiveness of the sample:
a) if the internal reference gene is amplified and the CT value is less than or equal to 25, the analysis can be continued;
b) if the CT value of the reference gene is more than or equal to 25 or no amplification exists, but the methylation detection site of the gene is amplified and the CT value is less than or equal to 25, the analysis can be continued;
c) if the CT value of the internal reference gene is greater than 25 or no amplification exists, if the CT value of the gene methylation detection site is greater than 25 or no amplification exists, the analysis cannot be continued, repeated detection is needed, and if the CT value of the internal reference gene is greater than 25 or no amplification exists, the sampling detection needs to be carried out again.
4) Determination of methylation detection result (CT value of gene methylation detection site-CT value of reference gene)
a) If the CT value of the gene methylation detection site is less than or equal to 25, the result is judged to be positive if the CT value of the gene methylation detection site is less than the CT value of the reference gene or the reference gene is not amplified; if the CT value of the gene methylation detection site is greater than the CT value of the reference gene and the delta CT value is less than or equal to 5, judging that the result is positive;
b) the gene methylation detection site is not amplified, or the CT value of the gene methylation detection site is greater than the CT value of the reference gene and the Delta CT value is greater than 5, and the result is judged to be negative.
In order to show the technical scheme of the invention more clearly, the invention is further illustrated by combining specific examples.
Example 1: sample DNA extraction and bisulfite conversion
1. Treatment of cervical exfoliated cell samples and extraction of DNA
1) Collecting samples:
the collection operation of the cervical exfoliated cell sample is as follows: the medical staff firstly exposes the cervix by peeping the vaginal apparatus, and then the excess secretion of the cervix is wiped off by a cotton swab. Placing a cervical brush at the cervical orifice, rotating for 5 circles in a single direction to obtain a sufficient epithelial cell sample, then placing the head of the cervical brush into a sample tube filled with cell preservation solution, breaking the cervical brush handle along the crease of the brush handle, leaving the brush head in the sample tube, screwing a tube cover, and making a sample mark
2) DNA extraction:
the method for extracting the DNA of the cervical exfoliated cells by using a nucleic acid extraction or purification reagent (universal type) produced by Anhudajian medical science and technology limited comprises the following specific steps:
(a) centrifuging a to-be-detected cervical exfoliated cell preservation solution sample at 4000rpm for 15min, sucking waste supernate by using a sample adding gun, and then adding 500 mu L of cell preservation solution;
(b) b, taking the cell sample obtained in the step a, adding 500 mu L of lysate A and 30 mu L of protease K into each tube, and performing lysis at 70 ℃ for 40 min;
(c) centrifuging for a short time, adding 200 μ L isopropanol into each tube, mixing well, and centrifuging for a short time;
(d) c, adding all the liquid in the step c into an adsorption column, and centrifuging at full speed for 30 s;
(e) washing once with 600 microliter of rinsing liquid I, and centrifuging at full speed for 30 s;
(f) rinsing with 600 μ L of rinsing solution II once, and centrifuging at full speed for 30 s;
(g) rinsing with 600 μ L of rinsing solution II once, and centrifuging at full speed for 2 min;
(h) air drying the centrifugal column in an air draft cabinet for 3min, suspending, adding 60 μ L of 70 deg.C preheated eluent, standing at room temperature for 5min, centrifuging at 13000rpm for 2min, collecting DNA, and storing at-20 deg.C.
2. Bisulfite conversion:
the genomic DNA obtained in the step was subjected to bisulfite conversion by using a nucleic acid extraction or purification reagent (centrifugal column type) produced by Anhudajian medical science and technology, Inc., having the following steps:
(a) mu.L of the DNA sample to be tested was placed in a new 1.5mL centrifuge tube and 5. mu.L of the transformation buffer was added and incubated in a metal bath at 37 ℃ for 15 min.
(b) After incubation is finished, 100 mu L of conversion solution prepared in advance is added into each sample, the mixture is uniformly mixed and centrifuged for a short time, and the mixture is incubated for 12 to 16 hours in a metal bath at 50 ℃ in a dark place
(c) The sample is placed on ice (0-4 ℃) and incubated for 10min
(d) Placing the adsorption column in a collection tube, adding 400 μ L binding solution into the adsorption column
(e) Adding the sample in the step c into an adsorption column (containing binding solution), covering a tube cover tightly, turning upside down, mixing uniformly for several times, centrifuging at full speed (14000rpm) for 30s, and discarding waste liquid
(f) Adding 100 μ L of rinsing solution into adsorption column, centrifuging at full speed for 30s, and discarding waste liquid
(g) Adding 200 mu L of desulfonation liquid into the adsorption column, incubating for 20min at room temperature (20-30 ℃), centrifuging for 30s at full speed, and discarding the waste liquid
(h) Adding 200 μ L of rinsing solution into adsorption column, centrifuging at full speed for 30s, repeatedly adding 200 μ L of rinsing solution, centrifuging at full speed for 30s, discarding waste liquid and collecting tube
(i) Placing the adsorption column into a 1.5mL sterile centrifuge tube, suspending and dropwise adding 30 μ L eluent into the middle part of the adsorption membrane, eluting and converting DNA, centrifuging at full speed for 1min, collecting Bis-DNA, and storing at-20 ℃.
Example 2: cervical cancer hypermethylation candidate gene, specific primer and probe screening
1. Screening of cervical exfoliated cell hypermethylation candidate genes of cervical cancer patients
Comprehensively analyzing the research results of the literature, a TCGA methylation chip database and a transcriptome sequencing expression profile, screening methylation sites with significant differences, and finally screening and determining PCDH10, LMX1A and ZNF582 as candidate genes for hypermethylation of cervical cancer through multiple data filtering analysis.
2. Primer probe combination screening for cervical cancer methylation detection
1) Screening of specific primers and probes:
designing methylation primers and probes on Methyl primer express v1.0 software according to the nucleic acid sequences of the PCDH10, LMX1A and ZNF582, repeatedly designing and knocking by the applicant, screening to obtain PCR probes and primers for methylation of related genes, and synthesizing the designed primers and probes by Beijing Rui Boxing biological technology company Limited, wherein the specific sequences are shown in the following table:
Figure BDA0002802772760000081
Figure BDA0002802772760000091
specific primers and probes for an internal reference gene GAPDH are arranged at the same time, and the specific sequences are as follows:
name (R) Sequence (5 '-3')
MethyGAPDH-F AAGTTAGGTTAGTTTGGTAGGGAAGTT(SEQ ID NO.30)
Methy-GAPDH-R AACCCTAAACCACCTCCCC(SEQ ID NO.31)
Methy-GAPDH-P TTTGGGTTTTTTTGGGGGTAAGGAGATGT(SEQ ID NO.32)
Wherein the 5 'end of the probe sequence is modified with a fluorescent group selected from any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY5, and the 3' end is marked with a fluorescence quenching group selected from any one of MGB, BHQ-1, BHQ-2 and BHQ-3.
Example 3: methylation fluorescent quantitative PCR amplification detection of cervical cancer hypermethylation candidate genes
1. The reaction system of the methylation fluorescent quantitative PCR is as follows: 7.5. mu.L of 2 XPCR reaction premix, 0.1. mu.L of each 10. mu.M GAPDH primer and probe, 0.5. mu.L of each 10. mu.M primer probe combination, 0.2. mu.L of each probe, 3. mu.L of Bis-DNA, and up to 15. mu.L of water.
2. Reaction conditions of methylation fluorescent quantitative PCR
Figure BDA0002802772760000092
3. Interpretation of detection results of methylation fluorescent quantitative PCR
1) Setting a threshold value: the baseline can be adjusted either automatically per instrument or manually according to the instructions for use of the instrument, the threshold is set in the linear portion of the log plot of fluorescence values, data is derived from the software and CT values are read.
2) And (3) judging the effectiveness of the kit:
the negative quality control product has the reference gene amplified and the CT value is less than or equal to 25, and the gene methylation detection site is not amplified; the reference gene and the gene methylation detection site of the positive quality control product are amplified, and the CT value is less than or equal to 25.
3) And (3) judging the effectiveness of the sample:
a) if the internal reference gene is amplified and the CT value is less than or equal to 25, the analysis can be continued;
b) if the CT value of the reference gene is more than or equal to 25 or no amplification exists, but the methylation detection site of the gene is amplified and the CT value is less than or equal to 25, the analysis can be continued;
c) if the CT value of the internal reference gene is greater than 25 or no amplification exists, if the CT value of the gene methylation detection site is greater than 25 or no amplification exists, the analysis cannot be continued, repeated detection is needed, and if the CT value of the internal reference gene is greater than 25 or no amplification exists, the sampling detection needs to be carried out again.
4) Determination of methylation detection result (CT value of gene methylation detection site-CT value of reference gene)
a) If the CT value of the gene methylation detection site is less than or equal to 25, the result is judged to be positive if the CT value of the gene methylation detection site is less than the CT value of the reference gene or the reference gene is not amplified; if the CT value of the gene methylation detection site is greater than the CT value of the reference gene and the delta CT value is less than or equal to 5, judging that the result is positive;
b) the gene methylation detection site is not amplified, or the CT value of the gene methylation detection site is greater than the CT value of the reference gene and the Delta CT value is greater than 5, and the result is judged to be negative.
Example 4: clinical sample detection and verification kit effect
1. Cervical exfoliated cell sample detection
The test and verification kit effect is performed on clinical cervical exfoliated cell samples according to the experimental procedures described in the above examples 1, 2 and 3, in order to verify the test effect of the primer probe combination for methylation detection of cervical cancer genes, the primer probe combination in the above example 2 is used to test 22 cervical exfoliated cell samples for cervical cancer and 8 normal female cervical exfoliated cell samples for normal female cervical cancer, wherein the numbers 1 to 22 are cervical exfoliated cell samples for cervical cancer, and the numbers 23 to 30 are normal female cervical exfoliated cell samples for cervical cancer, under the condition that the negative quality control product and the positive quality control product meet the validity judgment of the kit, typical methylation detection result amplification graphs are shown in fig. 1, fig. 2 and fig. 3, the detailed results are shown in the following tables, "+" represents positive detection, and "-" represents negative detection:
Figure BDA0002802772760000101
Figure BDA0002802772760000111
from the above results, the statistical analysis was as follows:
Figure BDA0002802772760000112
from the results, the detection sensitivity of the single primer probe combination in the kit for detecting the methylation of the cervical cancer genes is 72.7-86.4%, and the specificity is 87.5-100%.
In order to further improve the performance of the kit, the combination of the primer and the probe is expected to improve the detection effect of the kit in a multiple joint detection mode, and the following combination is preferably selected:
Figure BDA0002802772760000113
Figure BDA0002802772760000121
the combined detection effect of three groups of primer probe combinations of PCDH10, LMX1A or ZNF582 respectively is as follows:
Figure BDA0002802772760000122
the above results are obtained based on single-tube detection analysis of single-gene single-detection-site of cervical cancer, the detection mode needs to consume more reagents and simultaneously increases the operation of experimenters, the experiment cost is higher, and the joint inspection of single-tube multiple-gene methylation detection sites can reduce the reagent consumption to a greater extent, reduce the material cost, simultaneously reduce the operation of experimenters and reduce the labor cost. Therefore, the invention establishes the optimal combination of the single-tube multiple gene methylation detection site joint inspection and further screens the cervical cancer gene methylation detection kit, takes the cervical cancer cervical exfoliated cell sample and the DNA sample of the cervical cancer cervical exfoliated cell sample as templates, tests the detection effect of the single-tube multiple gene methylation detection site joint inspection, and has the following results:
Figure BDA0002802772760000123
the results show that the detection sensitivity and specificity of the joint detection of partial single-tube multiple gene methylation detection sites are reduced to a certain extent, so that the primer probe combinations 2, 4 and 8, the primer probe combinations 2, 6 and 7, the primer probe combinations 3, 4 and 7 and the primer probe combinations 1, 2 and 3 are preferably used for further verification.
2. Tissue sample testing
By testing the tissue samples with the above preferred combination, the effect of testing the tissue samples was tested, with the following results:
Figure BDA0002802772760000131
the result shows that the detection sensitivity of the cervical cancer gene methylation detection kit provided by the invention is between 90 and 100 percent, the specificity is 100 percent, and the kit has higher detection sensitivity and detection specificity when detecting the cervical cancer tissue sample gene methylation.
In conclusion, the cervical cancer gene methylation detection kit provided by the invention has higher detection sensitivity and detection specificity, becomes an ideal choice for cervical cancer diagnosis and early screening, and assists in early diagnosis and early treatment of cervical cancer.
While the foregoing description shows and describes several preferred embodiments of the invention, it is to be understood, as noted above, that the invention is not limited to the forms disclosed herein, but is not to be construed as excluding other embodiments and is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the inventive concept as expressed herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> Guangzhou Dajian Biotechnology Ltd
Anhui Dajian medicine science and technology Limited
<120> composition for detecting cervical cancer, kit and application thereof
<160> 32
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aggaaagaag tacgtcgaac gc 22
<210> 2
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
actcctaaaa aacgaaaaaa ttcacg 26
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttgttcgttt gtaagcgttg t 21
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cggaaggggt atttatagtt ggtta 25
<210> 5
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aacccaaaac ttaactctat ataaaccc 28
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cgctacgaat atctacgaac acg 23
<210> 7
<211> 15
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cgcgtttttc ggaat 15
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ttagtcgttg cgtggtattt g 21
<210> 9
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
caaacccgcc atcctaac 18
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
aaacccacca tcctaacacc 20
<210> 11
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
atgttttaga gttcggcg 18
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ggaattttcg tggcggtatc 20
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tcaccccgac taaaccttta cg 22
<210> 14
<211> 14
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
aggcgtcgat attt 14
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
ggggtttaga gggtagcggt c 21
<210> 16
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgtcccgtaa cgaaaccg 18
<210> 17
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
tggtggtcgc gtagtt 16
<210> 18
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gggaaaggga gtattacggt ttc 23
<210> 19
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gacgctacgt acgcgacga 19
<210> 20
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
tacgggacgc gttgtta 17
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ttttcggaag atattgcggc 20
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
accgataaat tcgccgtacg 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
tatggcgtag tatcggtgtg 20
<210> 24
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
aatagtattt tttcgcgtat tgcgta 26
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
ccttaaaacc gaatctcgcg 20
<210> 26
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
tacgtttgcg ttcggttt 18
<210> 27
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
cgtcggtttt attatggcgt agtatc 26
<210> 28
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
gataaattcg ccgtacgcaa c 21
<210> 29
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
ttgtgcgttt gcgttat 17
<210> 30
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
aagttaggtt agtttggtag ggaagtt 27
<210> 31
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
aaccctaaac cacctcccc 19
<210> 32
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
tttgggtttt tttgggggta aggagatgt 29

Claims (10)

1. The gene methylation detection site for the cervical cancer is characterized by comprising one or more of PCDH10, LMX1A and ZNF 582.
2. The PCR primer probe combination for detecting the methylation of the cervical cancer genes is characterized by comprising one or more of the following nucleic acid sequence combinations shown in 1) to 3):
1) PCR primers and probes for detecting methylation of PCDH10, comprising one or more of a primer probe combination 1, a primer probe combination 2 and a primer probe combination 3, wherein the primer probe combination 1 comprises an upstream primer shown as SEQ ID NO.1, a downstream primer shown as SEQ ID NO.2 and a fluorescent probe shown as SEQ ID NO.3, the primer probe combination 2 comprises an upstream primer shown as SEQ ID NO.4, downstream primers shown as SEQ ID NO.5 and SEQ ID NO.6 and a fluorescent probe shown as SEQ ID NO.7, and the primer probe combination 3 comprises an upstream primer shown as SEQ ID NO.8, downstream primers shown as SEQ ID NO.9 and SEQ ID NO.10 and a fluorescent probe shown as SEQ ID NO. 11;
2) the PCR primer and probe for detecting the methylation of LMX1A comprise one or more of a primer probe combination 4, a primer probe combination 5 and a primer probe combination 6, wherein the primer probe combination 4 comprises an upstream primer shown as SEQ ID NO.12, a downstream primer shown as SEQ ID NO.13 and a fluorescent probe shown as SEQ ID NO.14, the primer probe combination 5 comprises an upstream primer shown as SEQ ID NO.15, a downstream primer shown as SEQ ID NO.16 and a fluorescent probe shown as SEQ ID NO.17, and the primer probe combination 6 comprises an upstream primer shown as SEQ ID NO.18, a downstream primer shown as SEQ ID NO.19 and a fluorescent probe shown as SEQ ID NO. 20;
3) ZNF582 methylation detection PCR primers and probes comprise one or more of a primer probe combination 7, a primer probe combination 8 and a primer probe combination 9, wherein the primer probe combination 7 comprises an upstream primer shown as SEQ ID NO.21, a downstream primer shown as SEQ ID NO.22 and a fluorescent probe shown as SEQ ID NO.23, the primer probe combination 8 comprises an upstream primer shown as SEQ ID NO.24, a downstream primer shown as SEQ ID NO.25 and a fluorescent probe shown as SEQ ID NO.26, and the primer probe combination 9 comprises an upstream primer shown as SEQ ID NO.27, a downstream primer shown as SEQ ID NO.28 and a fluorescent probe shown as SEQ ID NO. 29.
3. The PCR primer probe combination for detecting methylation of cervical cancer genes as claimed in claim 2, further comprising PCR primers and probes for detecting the internal reference gene GAPDH, wherein the primers comprise an upstream primer shown as SEQ ID No.30 and a downstream primer shown as SEQ ID No.31, and the probes comprise fluorescent probes shown as SEQ ID No. 32.
4. The PCR primer probe combination for cervical cancer gene methylation detection according to claim 2 or claim 3, wherein the 5' end of the fluorescent probe comprises a fluorescent reporter group, and the fluorescent reporter group comprises any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY 5.
5. The PCR primer probe combination for detecting the methylation of the cervical cancer gene according to claim 2 or claim 3, wherein the 3' end of the fluorescent probe comprises a fluorescence quenching group, and the fluorescence quenching group comprises any one of MGB, BHQ-1, BHQ-2 and BHQ-3.
6. A kit for detecting methylation of cervical cancer genes, which is characterized by comprising the PCR primer probe combination as claimed in claim 2, and further comprising a positive quality control substance and a negative quality control substance.
7. The kit for detecting methylation of a cervical cancer gene according to claim 6, wherein the final concentration composition of the reaction system of the kit for detecting methylation of a cervical cancer gene comprises: 0.1-1 μ M PCR primer, 0.1-1 μ M probe.
8. The kit for detecting methylation of a cervical cancer gene according to claim 6, wherein the PCR reaction conditions of the kit are as follows:
Figure FDA0002802772750000021
9. the detection method for detecting the methylation of the cervical cancer gene is characterized by comprising the following steps:
1) separating nucleic acid of a target gene in a biological sample to be detected;
2) subjecting the nucleic acid obtained in the step 1) to bisulfite conversion treatment to obtain bisulfite converted DNA, namely Bis-DNA;
3) detecting the methylation state of the Bis-DNA obtained in the step 2) by adopting a methylation fluorescent quantitative PCR technology.
10. The use of the methylation detection site of the cervical cancer gene according to claim 1, the PCR primer probe combination for the methylation detection of the cervical cancer gene according to claim 2, the methylation detection kit of the cervical cancer gene according to claim 6, or the methylation detection method of the cervical cancer gene according to claim 9 for preparing the kit for detecting the cervical cancer.
CN202011356693.XA 2020-11-27 2020-11-27 Composition for detecting cervical cancer, kit and application thereof Active CN114561461B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011356693.XA CN114561461B (en) 2020-11-27 2020-11-27 Composition for detecting cervical cancer, kit and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011356693.XA CN114561461B (en) 2020-11-27 2020-11-27 Composition for detecting cervical cancer, kit and application thereof

Publications (2)

Publication Number Publication Date
CN114561461A true CN114561461A (en) 2022-05-31
CN114561461B CN114561461B (en) 2024-01-30

Family

ID=81711167

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011356693.XA Active CN114561461B (en) 2020-11-27 2020-11-27 Composition for detecting cervical cancer, kit and application thereof

Country Status (1)

Country Link
CN (1) CN114561461B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080311570A1 (en) * 2007-06-15 2008-12-18 National Defense Medical Center Cancer screening method
WO2010118559A1 (en) * 2009-04-17 2010-10-21 Lai Hung-Cheng A method for screening cancer
CN101974645A (en) * 2010-11-24 2011-02-16 张秀茹 Kit for detecting cervical carcinoma and detection method
US20110045465A1 (en) * 2009-08-18 2011-02-24 Hung-Cheng Lai Cancer Screening Method
US20150337386A1 (en) * 2012-08-28 2015-11-26 Istat Biomedical Co., Ltd. Test composition for screening cancers
CN110607357A (en) * 2019-11-07 2019-12-24 益善生物技术股份有限公司 Human PCDH10 gene methylation detection kit

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080311570A1 (en) * 2007-06-15 2008-12-18 National Defense Medical Center Cancer screening method
WO2010118559A1 (en) * 2009-04-17 2010-10-21 Lai Hung-Cheng A method for screening cancer
US20110045465A1 (en) * 2009-08-18 2011-02-24 Hung-Cheng Lai Cancer Screening Method
CN101974645A (en) * 2010-11-24 2011-02-16 张秀茹 Kit for detecting cervical carcinoma and detection method
US20150337386A1 (en) * 2012-08-28 2015-11-26 Istat Biomedical Co., Ltd. Test composition for screening cancers
CN110607357A (en) * 2019-11-07 2019-12-24 益善生物技术股份有限公司 Human PCDH10 gene methylation detection kit

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHENG CHANG CHANG 等: "High methylation rate of LMX1A, NKX6-1, PAX1, PTPRR, SOX1, and ZNF582 genes in cervical adenocarcinoma", INTERNATIONAL JOURNAL OF GYNECOLOGICAL CANCER, vol. 24, no. 2, pages 201 - 209 *
国宏莉 等: "PCDH10基因甲基化与宫颈癌的研究进展", 中国热带医学, vol. 12, no. 09, pages 1151 - 1153 *
李恬 等: "宫颈癌相关基因DNA甲基化研究进展", 中外医学研究, vol. 11, no. 05, pages 150 - 154 *
陈娇 等: "宫颈癌筛查方法的现状与研究进展", 医学综述, vol. 22, no. 12, pages 2338 - 2342 *

Also Published As

Publication number Publication date
CN114561461B (en) 2024-01-30

Similar Documents

Publication Publication Date Title
US20190136330A1 (en) Method for screening cancer
CN107760788B (en) Nucleic acid combination for detecting cervical cell gene methylation, kit and application
CN111534600B (en) Esophageal cancer gene methylation detection primer probe combination, kit and application thereof
CN113943799B (en) Composition for detecting bladder cancer, kit and application thereof
CN114561462B (en) Cervical cancer gene methylation detection primer probe combination, kit and application thereof
CN116555427A (en) Methylation gene combination, primer, probe and kit for early detection of cervical cancer
CN108949923B (en) Method for amplifying MSF1 gene, kit and application
CN115807087A (en) Primer probe combination for methylation detection of cervical cancer PAX1-SOX1-SFRP1 gene and application thereof
CN114561461B (en) Composition for detecting cervical cancer, kit and application thereof
CN115820850A (en) Biomarker of endometrial cancer, probe primer combination and kit
CN115976202A (en) Primer probe combination and kit for detecting methylation of cervical cancer related genes
CN114540489B (en) Cervical cancer early screening detection kit and application thereof
CN113528657B (en) Composition for detecting esophageal cancer, kit and application thereof
CN114634981B (en) Liver cancer gene methylation detection primer probe combination, kit and application thereof
CN114085905B (en) Composition for detecting colorectal cancer, kit and application thereof
CN113774129B (en) Composition for detecting liver cancer, kit and application thereof
CN114672552B (en) Esophageal cancer gene methylation detection primer probe combination, kit and application thereof
CN114085904B (en) Colorectal cancer gene methylation detection primer probe combination, kit and application thereof
CN116064797B (en) Endometrial cancer gene methylation level detection reagent and application thereof
CN118308481A (en) Biomarker, primer pair, nucleic acid product, kit and application for diagnosing ovarian cancer
CN118581218A (en) Nucleic acid product and kit for HPV negative cervical cancer detection and application
CN117757946A (en) Kit for detecting methylation of cervical cancer
CN115851937A (en) Primer probe composition for multi-gene methylation joint detection of cervical cancer, kit and application
CN115927629A (en) Multi-target methylation gene detection reagent and method for bladder cancer of urine cast-off cells
CN116694765A (en) Kit for detecting endometrial cancer and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant