CN115927629A - Multi-target methylation gene detection reagent and method for bladder cancer of urine cast-off cells - Google Patents

Abstract

The invention provides a multi-target methylation gene detection reagent and a method for bladder cancer with urine exfoliated cells. The invention discloses a reagent for diagnosing bladder cancer or bladder precancerous lesion, screening the formation or risk of the formation of the bladder cancer or evaluating the progression or prognosis of the bladder cancer, wherein the reagent comprises a reagent for detecting the methylation level of a DNA sequence or a fragment thereof or one or more CpG dinucleotides in a sample of a subject, and the DNA sequence comprises one or more or all of the following gene sequences: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1. The methods, kits and systems of the invention provide a non-invasive, low cost, highly effective, highly sensitive method for early screening of patients with bladder cancer.

Description

Multi-target methylation gene detection reagent and method for bladder cancer with urine exfoliated cells

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a multi-target methylation gene detection reagent and a method for bladder cancer of urine exfoliated cells.

Background

Bladder cancer is the most common malignancy of the urinary system and is one of the leading causes of cancer death in men. Bladder cancer is classified into non-muscle invasive bladder cancer (NMIBC) and Muscle Invasive Bladder Cancer (MIBC). Most bladder cancers (80%) are NMIBC, i.e. the cancer is localized to cells in the bladder lining, is low grade, early diagnosed, easy to treat, and is transferred to muscle invasive MIBC with extremely poor prognosis in the late stage. If bladder cancer can be diagnosed early, the 5-year survival rate of the patient will be as high as 95%, while the 5-year survival rate is only 49% when the bladder cancer develops in multiple locations, or spreads remotely.

Bladder cancer is a tumor with a high recurrence rate, 70% of patients relapse, the tumor with the highest recurrence rate in solid tumors, about 25% of patients relapse and finally develop MIBC, and patients usually need to be subjected to cystoscopy for 3-4 times each year after operation. Because of the continuous follow-up examination and high recurrence rate after operation, the bladder cancer becomes the cancer species with the highest diagnosis and treatment cost.

High recurrence of bladder cancer carries the risk of further deterioration, and early diagnosis, early treatment, and post-operative monitoring are important to improve the survival rate of patients with bladder cancer. How early to discover and how early to monitor the recurrence of bladder tumors after surgery is of great clinical significance.

Cystoscopy is the gold standard for diagnosing bladder cancer. The cystoscope is inserted into the patient's urethra to reveal the bladder wall and a tissue biopsy is performed on the suspicious lesion. The technology is invasive, belongs to traumatic examination, often causes pain and discomfort of patients, has low acceptance degree and high cost, brings certain errors to the results by subjective judgment of operators, has a diagnosis omission rate of up to 10 percent, and is difficult to diagnose at the early stage of tumor. Therefore, cystoscopy is not suitable for screening high risk groups for bladder cancer.

The prior noninvasive bladder cancer detection method comprises the following steps: urine apheresis cytology, fluorescence In Situ Hybridization (FISH), bladder tumor marker (e.g., NMP22 and BTA) detection, and the like. However, these conventional bladder cancer detection methods have disadvantages, such as low sensitivity and specificity, and easy occurrence of missed diagnosis and misdiagnosis, and are difficult to meet clinical requirements.

Urine shedding cytology, a common non-invasive test, has high specificity for high grade bladder cancer but low sensitivity to low grade bladder cancer, only 17%. Cytological examinations must be performed by a specialized pathologist or cytologist who, based on their experience, judges whether there are cancer cells in the urine and has a certain false positive rate due to inflammation or the effects of chemotherapy. The clinical practical application is inconvenient due to the defects of low sensitivity, low positive rate, low clinical detection rate, poor accuracy and the like of urine cytology examination.

Detecting exfoliated cells in urine by Fluorescence In Situ Hybridization (FISH), identifying non-integer ploidy of 3, 7 and 17 chromosomes by using a DNA probe and detecting the loss of a p16 cancer suppressor gene at a 9p21 site. UroVysion (Yapeh corporation) fluorescence in situ hybridization is widely used for routine clinical detection of bladder cancer, and the sensitivity can reach 60-80%, but the sensitivity to low-grade or micro bladder cancer is lower.

Hematuria is the most common symptom in patients with bladder cancer, but among patients with hematuria who have received cystoscopy, only 3-23% of them are finally diagnosed as bladder cancer. The appearance of hematuria does not necessarily indicate bladder cancer, and pink or red urine can be observed after strenuous activity or after eating certain foods or taking medicines (e.g., rifampin and phenazopyridine, etc.). There is overuse of such invasive tests in low risk patients. Every year in the united states, 23 million patients receive unnecessary cystoscopies. Therefore, there is a clinical need for better screening of patients to reduce unnecessary cystoscopy, and noninvasive, highly sensitive, highly specific is the direction of future detection and monitoring of bladder cancer.

In recent years, genetic diagnosis has been widely regarded as important in early diagnosis and prognosis evaluation of various tumors in humans. The research on the bladder cancer related gene also makes the auxiliary diagnosis of bladder cancer possible by detecting the DNA derived from the urine cast-off cell cancer.

DNA methylation is a modification of a methyl group (-CH 3) that occurs at a cytosine nucleotide in a DNA sequence. In normal cells, cpG-rich portions (CpG islands) located in specific promoter regions are generally unmethylated and genes are transcribed, whereas methylation of the regions often leads to gene silencing. The gene methylation is closely related to human development, gene transcription regulation, genetic imprinting and tumor diseases, and particularly, abnormal methylation of CpG islands is related to the transcriptional inactivation of tumor suppressor genes. Aberrant DNA methylation, one of the earliest and most common epigenetic changes during tumorigenesis, can be detected in precancerous lesions.

To date, hypermethylation of over 1000 genes has been found to be associated with cancer. In recent years, DNA methylation markers are widely used for the diagnosis and prognosis evaluation of malignant tumors. Since abnormal DNA methylation occurs at precancerous or early stage of cancer, it has become an ideal marker for early diagnosis of cancer, and can be used as a basis for designing tumor diagnostic reagents.

As with all other tumors, aberrant DNA methylation is also common in bladder cancer. Bladder cancer typically occurs in the epithelial tissue of the bladder, growing first into the bladder, during which there is constant shedding of tumor cells into the bladder and expulsion with the urine. Because tumor cells are faster than normal cells in renewal speed, have poor adhesive force and are easy to fall off, and can be collected in urine (urine sediment), the detection of tumor cell components in the urine sediment can provide a noninvasive bladder cancer screening and diagnosing method. By detecting the unique cancer-derived methylated DNA marker in the DNA of the exfoliated cells, whether bladder cancer cells exist in the urine sample can be judged.

The DNA methylation detection of the urine cast-off cells is used as a noninvasive and noninvasive (only the urine of a patient) method for diagnosing the bladder cancer, has sensitivity far higher than that of cytological examination, can be used for early auxiliary diagnosis and disease monitoring of the bladder cancer, and is particularly suitable for diagnosis and follow-up of the bladder cancer with high recurrence rate. The clinical bladder cancer EpiCheck in Europe judges the recurrence of NMIBC by detecting whether the related gene locus is methylated, and the research on a multicenter large sample shows that the sensitivity is 67 percent and the specificity is 88 percent.

The key of noninvasive detection of bladder cancer is to find a highly sensitive and highly specific biomarker. Due to the diversity of the mechanisms of bladder cancer, the genes that cause abnormal methylation in different bladder cancers are different and have great differences. At present, the number of the reported bladder cancer-associated methylated genes is more than 120, the sensitivity of a single methylated gene is not high generally, and no satisfactory methylated gene specific to bladder cancer exists up to now.

Disclosure of Invention

The object of the present invention is to provide a novel marker for bladder cancer (urine marker). The detection method adopts multi-target gene joint detection, and improves the sensitivity and specificity required by detection by using a mode of combining a plurality of markers on the premise that the specificity of each marker is higher. These specific DNA markers include CpG island cytosine methylation in the SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1 genes.

In a first aspect, the present invention provides an agent for diagnosing bladder cancer or a bladder precancerous lesion, screening for bladder cancer formation or risk of formation, assessing bladder cancer progression or prognosis, the agent comprising an agent for detecting the methylation state or level of at least one CpG dinucleotide of one or more target markers, the one or more target markers comprising a gene or a fragment thereof, the gene comprising 1, 2, 3, 4, 5 or all 6 selected from: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1.

In one or more embodiments, the gene comprises at least 2 selected from the group consisting of: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1.

In one or more embodiments, the genes include ZNF671 and at least 1 selected from the group consisting of: SOX1, HOXA9, VIM, IRAK3, and RASSF1.

In one or more embodiments, the genes include SOX1 and ZNF671, optionally further comprising at least 1 selected from the group consisting of: HOXA9, VIM, IRAK3 and RASSF1. In some such embodiments, the genes comprise SOX1, HOXA9 and ZNF671. In some such embodiments, the genes comprise SOX1, HOXA9, ZNF671 and VIM. In some such embodiments, the genes comprise SOX1, HOXA9, ZNF671, VIM, and IRAK3. In some such embodiments, the genes comprise SOX1, HOXA9, ZNF671, VIM, and RASSF1. In some such embodiments, the genes comprise SOX1, HOXA9, ZNF671, VIM, IRAK3, and RASSF1.

In one or more embodiments, the genes comprise HOXA9 and ZNF671, optionally further comprising at least 1 selected from the group consisting of: SOX1, VIM, IRAK3, and RASSF1. In some such embodiments, the gene comprises HOXA9, ZNF671, IRAK3, RASSF1. In some such embodiments, the gene comprises HOXA9, ZNF671, VIM, IRAK3. In some such embodiments, the gene comprises HOXA9, ZNF671, VIM, IRAK3, RASSF1. In some such embodiments, the gene comprises HOXA9, ZNF671, RASSF1.

In one or more embodiments, the genes include ZNF671, VIM and RASSF1, optionally further comprising at least 1 selected from the group consisting of: SOX1, HOXA9 and IRAK3. In some such embodiments, the gene comprises ZNF671, VIM, IRAK3, RASSF1.

In one or more embodiments, the gene comprises HOXA9 and one or more selected from the group consisting of: SOX1, VIM, RASSF1. In some such embodiments, the gene comprises SOX1, HOXA9. In some such embodiments, the gene comprises SOX1, HOXA9, RASSF1. In some such embodiments, the gene comprises SOX1, HOXA9, VIM, RASSF1. In some such embodiments, the gene comprises HOXA9, RASSF1.

In one or more such embodiments, the gene comprises any one of the groups selected from:

(1) The SOX1 and the ZNF671,

(2) SOX1, HOXA9 and ZNF671,

(3) SOX1, HOXA9, ZNF671 and VIM,

(4) SOX1, HOXA9, ZNF671, VIM and IRAK3,

(5) SOX1, HOXA9, ZNF671, VIM and RASSF1,

(6) SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1.

(7) HOXA9 and ZNF671,

(8) HOXA9, ZNF671, IRAK3 and RASSF1,

(9) HOXA9, ZNF671, VIM and IRAK3,

(10) HOXA9, ZNF671, VIM, IRAK3 and RASSF1,

(11) HOXA9, ZNF671 and RASSF1,

(12) ZNF671, VIM and RASSF1,

(13) ZNF671, VIM, IRAK3, and RASSF1.

(14) The combination of SOX1 and HOXA9,

(15) SOX1, HOXA9 and RASSF1,

(16) SOX1, HOXA9, VIM and RASSF1,

(17) HOXA9 and RASSF1.

In one or more embodiments, the bladder cancer is MIBC and the genes include ZNF671 and at least 1 selected from the group consisting of: SOX1, HOXA9, VIM, IRAK3, and RASSF1, in some such embodiments, the genes comprise SOX1 and ZNF671, optionally further comprising one or more selected from HOXA9, VIM, and IRAK 3; in some such embodiments, the genes comprise HOXA9 and ZNF671, optionally further comprising one or more of IRAK3 and RASSF1; in some such embodiments, the gene comprises ZNF671, VIM, optionally further comprising one or more of IRAK3 and RASSF1; in some such embodiments, the gene comprises HOXA9, RASSF1.

In one or more embodiments, the bladder cancer is MIBC and the gene comprises any one of the group selected from:

(1) The SOX1 and the ZNF671,

(2) SOX1, HOXA9 and ZNF671,

(3) SOX1, HOXA9, ZNF671 and VIM,

(4) SOX1, HOXA9, ZNF671, VIM and IRAK3,

(5) HOXA9, ZNF671 and RASSF1,

(6) HOXA9, ZNF671, IRAK3 and RASSF1,

(7) ZNF671, VIM and RASSF1,

(8) ZNF671, VIM, IRAK3 and RASSF1,

(9) HOXA9 and RASSF1.

In one or more embodiments, the bladder cancer is NMIBC, the genes comprising HOXA9 and at least 1 selected from the group consisting of: SOX1, ZNF671, VIM, IRAK3 and RASSF1.

In one or more embodiments, the bladder cancer is NMIBC, the genes comprising HOXA9 and SOX1, optionally further comprising one or more selected from ZNF671, VIM, IRAK3 and RASSF1; in some embodiments, the genes comprise HOXA9, SOX1 and ZNF671, optionally further comprising one or more selected from VIM, IRAK3 and RASSF1; in some embodiments, the genes comprise HOXA9, SOX1, ZNF671, VIM, optionally further comprising one or more selected from IRAK3 and RASSF1; in some embodiments, the genes comprise HOXA9, ZNF671, optionally further comprising one or more selected from VIM, IRAK3, RASSF1; in some embodiments, the genes comprise HOXA9, ZNF671, VIM, optionally further comprising one or more selected from IRAK3, RASSF1; in some embodiments, the gene comprises HOXA9, RASSF1.

In one or more embodiments, the bladder cancer is NMIBC, and the genes comprise any one of the groups selected from:

(1)HOXA9、SOX1，

(2)HOXA9、SOX1、ZNF671，

(3)HOXA9、SOX1、ZNF671、VIM，

(4)HOXA9、SOX1、ZNF671、VIM、RASSF1，

(5)HOXA9、SOX1、ZNF671、VIM、IRAK3、RASSF1，

(6)HOXA9、SOX1、RASSF1，

(7)HOXA9、SOX1、VIM、RASSF1，

(8)HOXA9、ZNF671，

(9)HOXA9、ZNF671、VIM、IRAK3，

(10)HOXA9、ZNF671、VIM、IRAK3、RASSF1，

(11)HOXA9、RASSF1。

in one or more embodiments, the fragment is a fragment of the gene sequence that includes a CpG island.

In one or more embodiments, the fragment is 1-1000bp in length, preferably 1-700bp in length.

In one or more embodiments, the fragment is a promoter region of a gene sequence.

In one or more embodiments, the fragment comprises at least 1, preferably at least 3 CpG dinucleotides.

In one or more embodiments, the agent is a primer molecule that hybridizes to the target markers or their transformed sequences. The primer molecules are capable of amplifying the target markers or their transformed variants. In one or more embodiments, the primer sequence is methylation specific. The primer molecule is at least 9bp.

In one or more embodiments, the primer has a sequence selected from any of the following groups 1, 2, 3, 4, 5, or all 6: (1) SEQ ID NO:1 and SEQ ID NO:2, (2) SEQ ID NO:3 and SEQ ID NO:4, (3) SEQ ID NO:5 and SEQ ID NO:6, (4) SEQ ID NO:7 and SEQ ID NO:8, (5) SEQ ID NO:9 and SEQ ID NO:10, and (6) SEQ ID NO:11 and SEQ ID NO:12.

In one or more embodiments, the agent is a detection probe that hybridizes to the target markers or their transformed sequences. In one or more embodiments, the detection probe further comprises a detectable substance. In one or more embodiments, the detectable species is a 5 'fluorescent reporter and a 3' labeled quencher. Preferably, the detectable substance is selected from one or more or all of FAM, HEX, ROX, CY5.

In one or more embodiments, the detection probe is a specific fluorescently labeled probe having a sequence set forth in any one or more or all of SEQ ID NOS 15-20.

In one or more embodiments, the sample is from a mammal, preferably a human. Preferably, the sample is from mammalian urine.

The second aspect of the present invention also provides the use of a substance for the manufacture of a kit for diagnosing bladder cancer or a precancerous lesion of the bladder, screening for the formation or risk of formation of bladder cancer, assessing the progression or prognosis of bladder cancer, the substance comprising:

(a) A reagent or device for determining the methylation status or level of at least one CpG dinucleotide of one or more target markers in a sample of a subject, and

optionally (b) a target marker-treated nucleic acid molecule, said treatment converting unmethylated cytosine to uracil,

optionally (c), a conversion reagent for treating the DNA, wherein the conversion reagent is capable of distinguishing between unmethylated sites and methylated sites in the DNA, e.g., converting cytosine capable of being unmethylated to uracil,

the one or more markers of interest comprise a gene or fragment thereof comprising 1, 2, 3, 4, 5, or all 6 selected from: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1. In one or more embodiments, the target marker or gene is as described in the first aspect herein.

In one or more embodiments, the gene comprises any one of the groups selected from: (1) SOX1 and ZNF671, (2) SOX1, HOXA9 and ZNF671, (3) SOX1, HOXA9, ZNF671 and VIM, (4) SOX1, HOXA9, ZNF671, VIM and IRAK3, (5) SOX1, HOXA9, ZNF671, VIM and RASSF1, (6) SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1. (7) HOXA9 and ZNF671, (8) HOXA9, ZNF671, IRAK3 and RASSF1, (9) HOXA9, ZNF671, VIM and IRAK3, (10) HOXA9, ZNF671, VIM, IRAK3 and RASSF1, (11) HOXA9, ZNF671 and RASSF1, (12) ZNF671, VIM and RASSF1, (13) ZNF671, VIM, IRAK3 and RASSF1. (14) SOX1 and HOXA9, (15) SOX1, HOXA9 and RASSF1, (16) SOX1, HOXA9, VIM and RASSF1, (17) HOXA9 and RASSF1.

In one or more embodiments, the bladder cancer is MIBC and the genes include ZNF671 and at least 1 selected from the group consisting of: SOX1, HOXA9, VIM, IRAK3, and RASSF1, in some such embodiments, the genes comprise SOX1 and ZNF671, optionally further comprising one or more selected from HOXA9, VIM, and IRAK 3; in some such embodiments, the genes comprise HOXA9 and ZNF671, optionally further comprising one or more of IRAK3 and RASSF1; in some such embodiments, the gene comprises ZNF671, VIM, optionally further comprising one or more of IRAK3 and RASSF1; in some such embodiments, the gene comprises HOXA9, RASSF1.

In one or more embodiments, the bladder cancer is MIBC and the gene comprises any one of the groups selected from: (1) SOX1 and ZNF671, (2) SOX1, HOXA9 and ZNF671, (3) SOX1, HOXA9, ZNF671 and VIM, (4) SOX1, HOXA9, ZNF671, VIM and IRAK3, (5) HOXA9, ZNF671 and RASSF1, (6) HOXA9, ZNF671, IRAK3 and RASSF1, (7) ZNF671, VIM and RASSF1, (8) ZNF671, VIM, IRAK3 and RASSF1, (9) HOXA9 and RASSF1.

In one or more embodiments, the bladder cancer is NMIBC and the genes include HOXA9 and at least 1 selected from the group consisting of: SOX1, ZNF671, VIM, IRAK3 and RASSF1.

In one or more embodiments, the bladder cancer is NMIBC, the genes comprising HOXA9 and SOX1, optionally further comprising one or more selected from ZNF671, VIM, IRAK3 and RASSF1; in some embodiments, the genes comprise HOXA9, SOX1 and ZNF671, optionally further comprising one or more selected from VIM, IRAK3 and RASSF1; in some embodiments, the genes comprise HOXA9, SOX1, ZNF671, VIM, optionally further comprising one or more selected from IRAK3 and RASSF1; in some embodiments, the gene comprises HOXA9, ZNF671, optionally further comprising one or more selected from VIM, IRAK3, RASSF1; in some embodiments, the genes comprise HOXA9, ZNF671, VIM, optionally further comprising one or more selected from IRAK3, RASSF1; in some embodiments, the gene comprises HOXA9, RASSF1.

In one or more embodiments, the bladder cancer is NMIBC and the gene comprises any one of the groups selected from: (1) HOXA9, SOX1, (2) HOXA9, SOX1, ZNF671, (3) HOXA9, SOX1, ZNF671, VIM, (4) HOXA9, SOX1, ZNF671, VIM, RASSF1, (5) HOXA9, SOX1, ZNF671, VIM, IRAK3, RASSF1, (6) HOXA9, SOX1, RASSF1, (7) HOXA9, SOX1, VIM, RASSF1, (8) HOXA9, ZNF671, (9) HOXA9, ZNF671, VIM, IRAK3, (10) HOXA9, ZNF671, VIM, IRAK3, RASSF1, (11) HOXA9, RASSF1.

In one or more embodiments, the fragment is a fragment of the gene sequence that includes a CpG island.

In one or more embodiments, the fragment is 1-1000bp in length, preferably 1-700bp in length.

In one or more embodiments, the fragment is a promoter region of a gene sequence.

In one or more embodiments, the fragment comprises at least 1, preferably at least 3 CpG dinucleotides.

In one or more embodiments, the reagent of (a) comprises a primer molecule and/or a probe molecule.

In one or more embodiments, (a) the reagent comprises a primer molecule that hybridizes to the target markers or their transformed sequences. The primer molecules are capable of amplifying the target markers or their transformed variants. In one or more embodiments, the primer sequence is methylation specific. The primer molecule is at least 9bp. In one or more embodiments, the primer for SOX1 or a fragment thereof has the sequence shown in SEQ ID NO. 1 and/or SEQ ID NO. 2; the primer aiming at HOXA9 or the fragment thereof has a sequence shown as SEQ ID NO. 3 and/or SEQ ID NO. 4; the primer aiming at ZNF671 or a fragment thereof has a sequence shown by SEQ ID NO. 5 and/or SEQ ID NO. 6; the primer aiming at the VIM or the fragment thereof has a sequence shown as SEQ ID NO. 7 and/or SEQ ID NO. 8; the primer aiming at the IRAK3 or the fragment thereof has a sequence shown by SEQ ID NO. 9 and/or SEQ ID NO. 10; the primer for RASSF1 or its fragment has the sequence shown in SEQ ID NO. 11 and/or SEQ ID NO. 12.

In one or more embodiments, the primer has a sequence selected from any of the following groups 1, 2, 3, 4, 5, or all 6: (1) SEQ ID NO:1 and SEQ ID NO:2, (2) SEQ ID NO:3 and SEQ ID NO:4, (3) SEQ ID NO:5 and SEQ ID NO:6, (4) SEQ ID NO:7 and SEQ ID NO:8, (5) SEQ ID NO:9 and SEQ ID NO:10, (6) SEQ ID NO:11 and SEQ ID NO:12.

In one or more embodiments, (a) the reagent comprises a detection probe that hybridizes to the target markers or their transformed sequences. In one or more embodiments, the detection probe further comprises a detectable substance. In one or more embodiments, the detectable species is a 5 'fluorescent reporter and a 3' labeled quencher. Preferably, the detectable substance is selected from one or more or all of FAM, HEX, ROX, CY5.

In one or more embodiments, the detection probe is a specific fluorescently labeled probe having a sequence set forth in any one or more or all of SEQ ID NOS 15-20.

In one or more embodiments, the detection probe for SOX1 or a fragment thereof has the sequence shown in SEQ ID NO. 15; a detection probe for HOXA9 or a fragment thereof has the sequence shown in SEQ ID NO. 16; the detection probe aiming at ZNF671 or a fragment thereof has a sequence shown as SEQ ID NO. 17; the detection probe aiming at the VIM or the fragment thereof has a sequence shown in SEQ ID NO. 18; the detection probe aiming at the IRAK3 or the fragment thereof has a sequence shown in SEQ ID NO. 19; the detection probe for RASSF1 or its fragment has the sequence shown in SEQ ID NO. 20.

In one or more embodiments, the detection probe for SOX1 or a fragment thereof has a detectable FAM; a detection probe directed to HOXA9 or a fragment thereof has a detectable species HEX; a detection probe directed against ZNF671 or a fragment thereof having the detectable species ROX; a detection probe for VIM or a fragment thereof has a detectable FAM; a detection probe directed against IRAK3 or a fragment thereof has a detectable species HEX; the detection probe for RASSF1 or a fragment thereof has the detectable species ROX.

In one or more embodiments, (c) the conversion reagent comprises a bisulfite reagent. More preferably, the conversion reagent comprises: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

In one or more embodiments, the subject is a mammal, preferably a human.

In one or more embodiments, the sample is from a mammalian urine sample.

In one or more embodiments, the sample comprises genomic DNA.

In one or more embodiments, the marker of interest is converted, wherein unmethylated cytosines are converted to uracils. The conversion is performed using a bisulfite reagent, preferably treated with ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

In one or more embodiments, the kit further comprises PCR reaction reagents. Preferably, the PCR reaction reagent comprises DNA polymerase, PCR buffer solution, dNTP and Mg ²⁺ 。

In one or more embodiments, the kit further comprises additional reagents for detecting DNA methylation, the additional reagents being reagents for one or more methods selected from the group consisting of: bisulfite conversion based PCR (e.g., methylation specific PCR), DNA sequencing (e.g., bisulfite sequencing, whole genome methylation sequencing, simplified methylation sequencing), methylation sensitive restriction enzyme analysis, fluorometry, methylation sensitive high resolution melting curve, chip-based methylation profile analysis, mass spectrometry (e.g., flight mass spectrometry). Preferably, the additional agent is selected from one or more of the following: bisulfite, bisulfite or metabisulfite or derivatives thereof, fluorescent dyes, fluorescence quenchers, fluorescence reporters, internal standards, controls.

In one or more embodiments, the reaction solution for PCR comprises Taq DNA polymerase, PCR buffer, dNTPs, KCl, mgCl ₂ And (NH) ₄ ) ₂ SO ₄ . Preferably, the Taq DNA polymerase is a hot start Taq DNA polymerase.

In one or more embodiments, the kit further comprises sample processing reagents, including urine preservation solutions and/or DNA extraction reagents. The urine preservative solution contains ethylenediaminetetraacetic acid (EDTA) and optionally also contains an antibiotic. The DNA extraction reagent includes QIAamp mini DNA Kits, PBS or TE.

In yet another aspect, the present invention provides a method of diagnosing bladder cancer or a precancerous bladder lesion, screening for the formation or risk of formation of bladder cancer, assessing the progression or prognosis of bladder cancer, comprising: (1) Detecting a methylation level of one or more CpG dinucleotides in one or more target markers in a sample of a subject, (2) comparing the methylation level to a control, thereby effecting said diagnosing, screening and assessing, the one or more target markers comprising genes, or fragments thereof, comprising 1, 2, 3, 4, 5 or all 6 selected from: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1. Wherein an increased level of methylation of the target marker indicates that the individual has, or is at risk of developing, bladder cancer or a precancerous bladder cancer lesion, or a poor prognosis of bladder cancer in the individual. In one or more embodiments, the target marker or gene is as described in the first and second aspects herein.

In one or more embodiments, the control is the methylation level of the target marker of a healthy subject.

In one or more embodiments, the fragment is a fragment of the gene sequence that includes a CpG island.

In one or more embodiments, the fragment is 1-1000bp in length, preferably 1-700bp in length.

In one or more embodiments, the fragment is a promoter region of a gene sequence.

In one or more embodiments, the fragment comprises at least 1, preferably at least 3 CpG dinucleotides.

In one or more embodiments, the method further comprises DNA extraction and/or quality testing.

In one or more embodiments, the method comprises performing the detection using a primer molecule, a detection probe as described herein.

In one or more embodiments, (1) the detecting includes, but is not limited to: PCR based on bisulfite conversion, DNA sequencing, methylation sensitive restriction enzyme analysis, fluorescence quantification, methylation sensitive high resolution melting curve method, chip-based methylation map analysis, and mass spectrum.

In one or more embodiments, the sample is from a mammalian urine sample. The mammal is preferably a human.

In one or more embodiments, the sample comprises genomic DNA.

In one or more embodiments, the target marker is converted, wherein unmethylated cytosines are converted to uracils. The conversion is performed using a bisulfite reagent, preferably treated with ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

In one or more embodiments, step (1) comprises: the step of treating the target marker in the sample with a conversion reagent converts unmethylated cytosine to a base having a lower binding capacity to guanine (uracil), and then PCR-amplifying using primers suitable for amplifying the target marker.

In one or more embodiments, the method further comprises the step of treating the urine sample with a sample treatment reagent. The sample processing reagent comprises a urine preservation solution and/or a DNA extraction reagent. The urine preservative solution contains ethylenediaminetetraacetic acid (EDTA) and optionally also contains an antibiotic. The DNA extraction reagent includes QIAamp mini DNA Kits, PBS or TE.

In one or more embodiments, the method comprises:

(a) Obtaining a biological sample containing DNA from the urine of an individual,

(b) Treating the DNA in the biological sample obtained in step (a) with a conversion reagent, said reagent being capable of distinguishing unmethylated sites from methylated sites in said DNA, thereby obtaining a conversion reagent-treated DNA; preferably, the DNA is treated with a conversion reagent to convert unmethylated cytosine to uracil; the conversion reagent comprises a bisulfite reagent, preferably comprising ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof,

(c) Amplifying with fluorescent quantitative PCR at least a portion of at least one target marker in the treated DNA obtained from step (b), the one or more target markers comprising a gene or fragment thereof, the gene comprising 1, 2, 3, 4, 5, or all 6 selected from the group consisting of: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1; preferably, the fluorescent quantitative PCR amplification is carried out by using the primers of SEQ ID NO. 1-12 and the probe of SEQ ID NO. 15-20; more preferably, the fluorescent quantitative PCR amplification is performed by using the primers described in SEQ ID NO. 1-14 and the probes described in SEQ ID NO. 15-21;

(d) Quantifying the methylation level of the at least one target marker from the DNA obtained in step (c), respectively; preferably, step (d) comprises: determining the methylation level of at least one CpG by the presence or absence of an amplification product, or by sequence identification (e.g., probe-based PCR detection identification or DNA sequencing identification),

(e) Comparing the methylation level of the at least one target marker in step (c) with a corresponding reference level, respectively, to effect said diagnosing, screening and assessing; preferably, the methylation level of the at least one target marker in step (c) and the corresponding reference level are each quantitatively compared, wherein a same or higher methylation level of one or more target markers relative to their corresponding reference levels indicates that the individual has, or is at risk of developing, a bladder cancer or a pre-bladder cancer lesion, or a poor prognosis of the individual's bladder cancer.

In one or more embodiments, the target gene DNA is detected by fluorescent quantitative PCR using the primers shown in SEQ ID NOS: 1 to 12 and the probes shown in SEQ ID NOS: 15 to 20, and if an amplification signal is detected, the subject is diagnosed as having intestinal cancer or a precancerous lesion of intestinal cancer.

In another aspect, the present invention provides a kit for diagnosing bladder cancer or a precancerous lesion of bladder cancer, screening for the formation or risk of formation of bladder cancer, assessing the progression or prognosis of bladder cancer, comprising:

(a) A reagent or device for determining the methylation status or level of at least one CpG dinucleotide of one or more target markers in a sample of a subject, and

optionally (b) a nucleic acid molecule treated with said marker of interest, said treatment converting unmethylated cytosine to uracil,

wherein the one or more target markers comprise genes or fragments thereof, the genes comprising 1, 2, 3, 4, 5, or all 6 selected from: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1. In one or more embodiments, the marker or gene of interest is as described in the first and second aspects herein.

In one or more embodiments, (b) is used as a positive control.

In one or more embodiments, the kit is suitable for use as described in any of the embodiments herein.

In one or more embodiments, the reagent of (a) comprises a primer molecule and/or a detection probe.

In one or more embodiments, (a) the reagent comprises a primer molecule that hybridizes to the target markers or their transformed sequences. The primer molecules are capable of amplifying the target markers or their transformed variants. In one or more embodiments, the primer sequence is methylation specific. The primer molecule is at least 9bp. In one or more embodiments, the primer has a sequence selected from any of the following groups 1, 2, 3, 4, 5, or all 6: (1) SEQ ID NO:1 and SEQ ID NO:2, (2) SEQ ID NO:3 and SEQ ID NO:4, (3) SEQ ID NO:5 and SEQ ID NO:6, (4) SEQ ID NO:7 and SEQ ID NO:8, (5) SEQ ID NO:9 and SEQ ID NO:10, (6) SEQ ID NO:11 and SEQ ID NO:12. In one or more embodiments, the kit further comprises primers for amplifying ATCBs, such as shown in SEQ ID NOS: 13 and 14.

In one or more embodiments, (a) the reagent comprises a detection probe that hybridizes to the target markers or their transformed sequences. In one or more embodiments, the detection probe further comprises a detectable substance. In one or more embodiments, the detectable species is a 5 'fluorescent reporter and a 3' labeled quencher. Preferably, the detectable substance is selected from one or more or all of FAM, HEX, ROX, CY5. In one or more embodiments, the detection probe is a specific fluorescently labeled probe having a sequence set forth in any one or more or all of SEQ ID NOS 15-20.

In one or more embodiments, the kit further comprises a detection probe that hybridizes to ATCB, e.g., as shown in SEQ ID NO: 21.

In one or more embodiments, the detection probe for SOX1 or a fragment thereof has a detectable FAM; a detection probe directed against HOXA9 or a fragment thereof has a detectable HEX; a detection probe directed against ZNF671 or a fragment thereof having the detectable species ROX; a detection probe for VIM or a fragment thereof having a detectable FAM; a detection probe directed against IRAK3 or a fragment thereof has a detectable species HEX; the detection probe for RASSF1 or a fragment thereof has the detectable agent ROX and the probe for ATCB has the detectable agent CY5.

In one or more embodiments, the kit comprises a first container containing primers and detection probes for the genes SOX1, HOXA9, ZNF671 and optionally ACTB and a second container containing primers and detection probes for the genes VIM, IRAK3, RASSF1 and optionally ACTB. Preferably, the first container comprises primers shown in SEQ ID NO. 1-6 and detection probes shown in 15-17, and the second container comprises primers shown in SEQ ID NO. 7-12 and detection probes shown in 18-20; more preferably, the first and second containers further comprise primers shown in SEQ ID NOS: 13 and 14 and detection probes shown in 21, respectively.

In one or more embodiments, the subject is a mammal, preferably a human.

In one or more embodiments, the sample is a urine sample.

In one or more embodiments, the sample comprises genomic DNA.

In one or more embodiments, the kit further comprises a conversion reagent that treats DNA, wherein the conversion reagent is capable of distinguishing between unmethylated sites and methylated sites in the DNA. In one or more embodiments, the conversion reagent converts unmethylated cytosine to uracil. Preferably, the conversion reagent comprises a bisulphite reagent. More preferably, the conversion reagent comprises: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

In one or more embodiments, the kit further comprises PCR reaction reagents. Preferably, the PCR reaction reagent comprises DNA polymerase, PCR buffer solution, dNTP and Mg ²⁺ 。

In one or more embodiments, the kit further comprises reagents for detecting DNA methylation, the reagents being used in one or more of the methods selected from the group consisting of: bisulfite conversion-based PCR (e.g., methylation specific PCR), DNA sequencing (e.g., bisulfite sequencing, whole genome methylation sequencing, simplified methylation sequencing), methylation sensitive restriction enzyme analysis, fluorometry, methylation sensitive high resolution melting curve, chip-based methylation profile analysis, mass spectrometry (e.g., flight mass spectrometry). Preferably, the agent is selected from one or more of: bisulfite and its derivatives, fluorescent dye, fluorescence quencher, fluorescence reporter, internal standard, and reference substance.

In one or more embodiments, the kit further comprises sample processing reagents, including urine preservation solutions and/or DNA extraction reagents. The urine preservative fluid contains ethylenediaminetetraacetic acid (EDTA) and optionally also contains antibiotics. The DNA extraction reagent includes QIAamp mini DNA Kits, PBS or TE.

Detailed Description

It is to be understood that within the scope of the present invention, the above-described technical features of the present invention and the technical features specifically described below (e.g., examples) may be combined with each other to constitute a preferred embodiment.

The invention provides a molecular detection method for diagnosing bladder cancer or screening high risk groups of bladder cancer by using methylation gene combination, aiming at the problems of low sensitivity and specificity or strong invasiveness, potential injury and the like of the existing bladder cancer noninvasive detection method. Specifically, the invention adopts multi-target methylation genes to detect DNA markers related to bladder and bladder precancerous lesion in urine, and the specific DNA markers comprise SRY-related high mobility group protein 1 (SRY-related HMG box 1, SOX1), homeobox A9 (homeobox A9, HOXA 9), zinc finger protein 671 (ZNF 671), vimentin (VIM), interleukin 1receptor-associated kinase 1 (interleukin-1 receptor-associated kinase 1, IRAK1), and CpG island cytosine methylation in RAS-related region family 1 (RAS-association domain family 1, RASSF1) genes. And meanwhile, ACTB is selected as a detection reference gene to evaluate the DNA quality of the urine staff.

Herein, "diagnosing" and "screening" for bladder cancer or a precancerous bladder lesion include: identifying whether the individual has, or is at risk of developing, bladder cancer or a precancerous bladder lesion, or whether the individual has an increased likelihood of having, or is at risk of having, a poor prognosis of bladder cancer or a precancerous bladder lesion.

As used herein, the term "methylation marker" or "marker of interest" refers to a nucleic acid, gene region, or methylation site of interest: the methylation level is indicative of bladder cancer or a precancerous bladder lesion. Thus, a "methylation marker" or "marker of interest" includes as a marker the corresponding gene, its DNA sequence or fragment or their transformed sequences, which have methylation modifications indicative of bladder cancer. Methylation markers should be considered to include all transcriptional variants thereof and all promoter and regulatory elements thereof. In addition, it is understood that methylation markers shall include both the sense strand sequence of a marker or gene and the antisense strand sequence of a marker or gene. The term "methylation marker" as used herein is to be broadly interpreted to include both 1) the original marker (at a particular methylation) found in a biological sample or genomic DNA, and 2) its processed sequence (e.g., the corresponding region after bisulfite conversion). The corresponding region after bisulfite conversion differs from the target marker in the genomic sequence in that one or more unmethylated cytosine residues are converted to uracil bases, thymine bases or other bases that differ in hybridization behavior from cytosine.

The inventors' studies have shown that the nature of bladder cancer is related to methylation of the following genes (e.g., promoter regions): one or more or all of SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1. The invention provides methylation detection of the genes in a sample, and the aim of screening bladder cancer is fulfilled.

The solution of the invention is therefore based on the fact that: the nature of bladder cancer is at least associated with the methylation status or level of at least one CpG dinucleotide of at least 2 target markers selected from: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF.

In some embodiments, the target markers comprise ZNF671 and at least 1 selected from the group consisting of: SOX1, HOXA9, VIM, IRAK3, and RASSF1. Preferably, the target markers include SOX1 and ZNF671, optionally further comprising at least 1 selected from the group consisting of: HOXA9, VIM, IRAK3 and RASSF1; or the target markers comprise HOXA9 and ZNF671, optionally further comprising at least 1 selected from the group consisting of: SOX1, VIM, IRAK3, and RASSF1; or the target markers include ZNF671, VIM and RASSF1, optionally further comprising at least 1 selected from the group consisting of: SOX1, HOXA9 and IRAK3. In other embodiments, the target markers comprise HOXA9 and one or more selected from the group consisting of: SOX1, VIM, RASSF1.

In one or more embodiments, the target marker comprises any one of the group selected from: (1) SOX1 and ZNF671, (2) SOX1, HOXA9 and ZNF671, (3) SOX1, HOXA9, ZNF671 and VIM, (4) SOX1, HOXA9, ZNF671, VIM and IRAK3, (5) SOX1, HOXA9, ZNF671, VIM and RASSF1, (6) SOX1, HOXA9, ZNF671, VIM, irm and RASSF1, (7) HOXA9 and ZNF671, (8) HOXA9, ZNF671, IRAK3 and RASSF1, (9) HOXA9, ZNF671, VIM and IRAK3, (10) HOXA9, ZNF671, VIM, IRAK3 and RASSF1, (11) HOXA9, ZNF671 and RASSF1, (12) sof 1, VIM and rasf 13, (13) ZNF671, 671 and RASSF1. (14) SOX1 and HOXA9, (15) SOX1, HOXA9 and RASSF1, (16) SOX1, HOXA9, VIM and RASSF1, (17) HOXA9 and RASSF1.

In one or more embodiments, the bladder cancer is MIBC and the target marker comprises any one selected from the group consisting of: (1) SOX1 and ZNF671, (2) SOX1, HOXA9 and ZNF671, (3) SOX1, HOXA9, ZNF671 and VIM, (4) SOX1, HOXA9, ZNF671, VIM and IRAK3, (5) HOXA9, ZNF671 and RASSF1, (6) HOXA9, ZNF671, IRAK3 and RASSF1, (7) ZNF671, VIM and RASSF1, (8) ZNF671, VIM, IRAK3 and RASSF1, (9) HOXA9 and RASSF1.

In one or more embodiments, the bladder cancer is NMIBC and the target marker comprises any one of the groups selected from: (1) HOXA9, SOX1, (2) HOXA9, SOX1, ZNF671, (3) HOXA9, SOX1, ZNF671, VIM, (4) HOXA9, SOX1, ZNF671, VIM, RASSF1, (5) HOXA9, SOX1, ZNF671, VIM, IRAK3, RASSF1, (6) HOXA9, SOX1, RASSF1, (7) HOXA9, SOX1, VIM, RASSF1, (8) HOXA9, ZNF671, (9) HOXA9, ZNF671, VIM, IRAK3, (10) HOXA9, ZNF671, VIM, IRAK3, RASSF1, (11) HOXA9, RASSF1.

SRY-related high mobility group protein 1 (SRY-related HMG box 1, SOX1) is located on chromosome 2, and has effects of regulating nervous system and lens development. SOX1 is low-expressed in various tumor tissues due to the increase of methylation level, can regulate and control the proliferation, invasion and metastasis capacities of tumors, and plays an important role in regulating the differentiation process of tumor stem cells.

The homeobox A1 (homeobox A1, HOXA 9) gene is located on chromosome 7 and encodes a DNA-binding transcription factor that regulates gene expression, morphogenesis and differentiation. In recent years, researches show that the gene is closely related to the occurrence of cancers. In some embodiments, methylation of HOXA9 is 80% sensitive to bladder cancer in exfoliated cells in urine.

Zinc finger protein 671 (ZNF 671) is considered to be involved in malignant tumors such as carcinoma of large intestine, cervical cancer, and nasopharyngeal carcinoma. ZNF671 is a potential tumor suppressor whose down-regulation promotes cancer cell proliferation and tumorigenicity by promoting cell cycle progression, and epigenetics is silenced by promoter methylation in cancer. Methylated ZNF671 was detected in urine exfoliated cells in 90% of bladder cancer patients.

The Vimentin (Vimentin) gene is located on chromosome 10 and encodes a protein of the cytoskeleton. VIM is considered a biomarker for mesenchymal-derived cells and cancer cells to undergo epithelial-mesenchymal transition during invasion and metastasis. Methylated VIM was detected in urine shed cells in 60% of bladder cancer patients.

Interleukin-1receptor-associated kinase 1 (IRAK1) is located on an X chromosome, and the IRAK-1 inhibits an NF-kB signal channel through negative feedback regulation, so that invasion and metastasis of cancer cell lines are inhibited. IRAK1 methylation sensitivity in the bladder cancer group ranged from 40% to 50%.

RAS-ASSOCIATION Domain family 1 (RASSF1) gene is located on chromosome 3p21.3, and has abnormal down-regulation of transcription expression in common tumor cell lines and cancer tissues including lung cancer, breast cancer, nasopharyngeal carcinoma, bladder cancer and the like, hypermethylation of a promoter and extremely low point mutation rate. In the bladder cancer urine exfoliated cell sample, the DNA methylation rate is 40%.

As used herein, the term "gene" includes coding and non-coding sequences of the gene in question on its genome. Wherein the non-coding sequence includes introns, promoters and regulatory elements or sequences and the like.

In one or more embodiments, bladder cancer is associated with methylation of the above gene segments. The length of the fragment is 1bp-1kb, preferably 1bp-700bp; the fragments comprise one or more methylation sites in the chromosomal region of the corresponding gene. Such fragments are, for example, the promoter regions of the above-mentioned genes. Typically, the transcription start site is a promoter region. In some embodiments, the fragment detected contains at least 3 CpG dinucleotides. In an exemplary method, the methylation level of the above gene or fragment thereof is detected using bisulfite conversion based PCR.

Accordingly, the present invention relates to a reagent for detecting DNA methylation. Reagents used in methods for detecting DNA methylation are well known in the art. In detection methods involving DNA amplification (e.g., PCR), the reagents for detecting DNA methylation include primers. As used herein, a "primer" refers to a nucleic acid molecule having a specific nucleotide sequence that directs the synthesis of a nucleic acid molecule at the initiation of nucleotide polymerization. The primers are usually at least 9bp. Primer sequences can be methylation specific or non-specific. Typically, primers are designed to amplify a product of 1-2000bp, 10-1000bp, 30-900bp, 40-800bp, 50-700bp, or at least 150bp, at least 140bp, at least 130bp, at least 120bp in length. In an exemplary embodiment, the primer for SOX1 or a fragment thereof has the sequence shown in SEQ ID NO. 1 and/or SEQ ID NO. 2; the primer aiming at HOXA9 or the fragment thereof has a sequence shown as SEQ ID NO. 3 and/or SEQ ID NO. 4; the primer for ZNF671 or a fragment thereof has a sequence shown by SEQ ID NO. 5 and/or SEQ ID NO. 6; the primer aiming at the VIM or the fragment thereof has a sequence shown by SEQ ID NO. 7 and/or SEQ ID NO. 8; the primer aiming at the IRAK3 or the fragment thereof has a sequence shown as SEQ ID NO. 9 and/or SEQ ID NO. 10; the primer for RASSF1 or the fragment thereof has a sequence shown by SEQ ID NO. 11 and/or SEQ ID NO. 12.

The reagent for detecting DNA methylation may further comprise a detection probe that hybridizes to a sequence to be detected. Typically, the sequence of the detection probe is labeled at the 5 'end with a fluorescent reporter group and at the 3' end with a quencher group. As used herein, "hybridization" refers primarily to the pairing of nucleic acid sequences under stringent conditions. Exemplary stringent conditions are hybridization and membrane washing at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS. In an exemplary embodiment, the detection probe for SOX1 or a fragment thereof has the sequence shown in SEQ ID NO. 15; a detection probe for HOXA9 or a fragment thereof has the sequence shown in SEQ ID NO. 16; the detection probe aiming at ZNF671 or a fragment thereof has a sequence shown as SEQ ID NO. 17; the detection probe aiming at the VIM or the fragment thereof has a sequence shown in SEQ ID NO. 18; the detection probe aiming at the IRAK3 or the fragment thereof has a sequence shown in SEQ ID NO. 19; the detection probe for RASSF1 or a fragment thereof has a sequence shown in SEQ ID NO. 20. The detection probe may be a specific fluorescently labelled probe (e.g. TaqMan probe), illustratively a detection probe for SOX1 or a fragment thereof having the detectable species FAM; a detection probe directed to HOXA9 or a fragment thereof has a detectable species HEX; a detection probe directed against ZNF671 or a fragment thereof having the detectable species ROX; a detection probe for VIM or a fragment thereof having a detectable FAM; a detection probe directed against IRAK3 or a fragment thereof has a detectable species HEX; the detection probe for RASSF1 or a fragment thereof has the detectable species ROX.

As described herein, transformation can occur between bases of DNA or RNA. "transformation", "cytosine transformation" or "CT transformation" as used herein is a process of converting an unmodified cytosine base (C) into a base having a lower binding ability to guanine than cytosine, for example, an uracil base (U), by treating DNA with a non-enzymatic method. Non-enzymatic methods of effecting cytosine conversion are well known in the art. The non-enzymatic process is primarily referred to as bisulfite conversion. Exemplary non-enzymatic methods include treatment with a conversion reagent such as bisulfite, or metabisulfite, for example, calcium bisulfite, sodium bisulfite, potassium bisulfite, ammonium bisulfite, and the like. The transformed DNA is optionally purified. DNA purification methods suitable for use herein are well known in the art.

The invention also provides a kit, which comprises the primer and/or the probe, and is used for detecting the methylation level of bladder cancer related genes or sequences in DNA of exfoliative cells of a urine specimen, so as to identify bladder cancer or screen high risk groups of bladder cancer. The kit may further comprise a nucleic acid molecule as described herein, in particular according to the first aspect of the summary, as an internal standard or positive control.

Thus, in a preferred embodiment, the kit comprises the primers shown in SEQ ID NOS: 1-12 and the detection probes shown in SEQ ID NOS: 15-20 described herein. In addition, the kit also includes the ACTB primers shown in SEQ ID NO. 13 and 14 and the ACTB detection probe shown in SEQ ID NO. 21 described herein.

In addition to the primers, probes, nucleic acid molecules, the kit contains other reagents required for detecting DNA methylation. Illustratively, other reagents for detecting DNA methylation may comprise one or more of: bisulfite and its derivative, PCR buffer solution, polymerase, dNTP, primer, probe, mg ²⁺ Fluorescent dye, fluorescence quencher, fluorescence reporter, internal standard and reference substance. The kit can also include a transformed positive standard in which unmethylated cytosines are converted to bases that do not bind guanine. The positive standard may be fully methylated.

In order to preserve DNA in a urine sample, the kit may further include a urine preservation solution containing ethylenediaminetetraacetic acid (EDTA) and antibiotics (e.g., penicillin and streptomycin).

Based on the findings of the inventors, the present invention provides a method for diagnosing bladder cancer or a precancerous bladder lesion, screening for the formation or risk of formation of bladder cancer, evaluating the progression or prognosis of bladder cancer, comprising: (1) Detecting the methylation level of one or more CpG dinucleotides in one or more target markers as described herein in a sample from the subject, (2) comparing the methylation level to a control, thereby effecting said diagnosing, screening and assessing. Wherein an increased level of methylation of the target marker indicates that the individual has, or is at risk of developing, bladder cancer or a precancerous bladder cancer lesion, or a poor prognosis of bladder cancer in the individual. Typically, the method is preceded by: extracting sample DNA, quality inspection and/or converting unmethylated cytosine on DNA into uracil. The sample comprises cells from a mammal, in particular a urine sample.

In a specific embodiment, step (1) comprises: extracting the detected target gene DNA with a DNA capture probe, and treating the genomic DNA with a conversion reagent to convert unmethylated cytosine into uracil; performing PCR amplification using primers suitable for amplifying a transformed sequence of an intestinal cancer-associated sequence as described herein; the methylation level of at least one CpG is determined by the presence or absence of an amplification product, or by sequence identification (e.g., probe-based PCR detection identification or DNA sequencing identification).

In order to obtain DNA from a fecal sample, the method may further comprise the step of treating the urine sample with a sample treatment reagent. Exemplary sample processing reagents include urine preservation solutions and/or DNA extraction reagents. The urine preservative solution contains ethylenediaminetetraacetic acid (EDTA) and optionally also contains an antibiotic. The DNA extraction reagent includes QIAamp mini DNA Kits, PBS or TE.

In one embodiment, the method for screening for bladder cancer or a precancerous bladder lesion comprises the steps of:

(a) Collecting a urine sample: collecting urine of a patient with bladder cancer, and adding urine preservation solution with the volume of 1/20 of that of the urine sample; the urine preservative fluid contains EDTA and antibiotics (e.g., 0.1M EDTA, penicillin, and streptomycin);

(b) Thoroughly mixing the sample (e.g., using a shaker);

(c) Centrifuging to remove supernatant, adding PBS suspension into the cell sediment, and transferring to a centrifuge tube;

(d) The supernatant is removed by centrifugation and the cellular DNA in the pellet is extracted (e.g., using a DNA extraction kit).

As used herein, "methylation level" refers to the level of methylation at a CpG site of interest or the average level of methylation at a plurality or all of the CpG sites in a sequence of interest. In an exemplary embodiment of the invention, the methylation level of a site is generally the percentage of methylated C's at that site, and if all C's at that CpG site are unmethylated, the methylation level is zero. The methylation level can also be other types of calculations, which are within the knowledge of a person skilled in the art. Procedures are known in the art for converting the results obtained from methods for detecting DNA methylation (e.g., simplified methylation sequencing) to methylation levels. For example, the average methylation is calculated based on the detected methylation level of CpG sites in the promoter region of each gene, and is used as the DNA methylation level in the promoter region of the gene.

The present invention will be further described with reference to specific examples. It should be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

Example 1: urine exfoliated cell DNA extraction

The urine exfoliated cell DNA extraction steps are as follows:

(1) Collecting a urine sample: collecting 40ml of urine of 20 patients with bladder cancer, adding 2ml of urine preservation solution, mixing uniformly, and collecting 10 urine samples of normal people as a control; the urine preservative fluid is prepared from 0.1M EDTA, penicillin and streptomycin;

(2) After the sample is received, the container is fully and uniformly mixed on a vibrator;

(3) Centrifuging at 3000g for 10min;

(4) Removing the supernatant, adding 1.5ml PBS into the cell sediment, and transferring the cell sediment to an Eppendorf tube in a suspension manner;

(5) Centrifuging at 3000g for 5min;

(6) Discarding the supernatant and leaving the pellet, and extracting cell DNA by using QIAamp mini DNA Kits (Qiagen 51304);

(7) DNA elution: 40 μ L of TE;

(8) Measuring OD value and quantifying: the DNA concentration is 100-200 ng/. Mu.L, and the OD260/280 value is 1.6-2.0.

Example 2: DNA sulfite conversion treatment

Preparing a sulfite conversion reaction system in a 0.5ml PCR tube, wherein the specific preparation system is as follows:

DNA sample 20. Mu.l

DNA protective solution 10. Mu.l

130. Mu.l of 10M sulfite conversion solution

After the reaction system is prepared, setting a temperature change program in a PCR instrument for carrying out sulfite conversion, wherein the PCR program comprises the following steps: [95 ℃ for 5min,60 ℃ for 20min ] x 2 cycle, and the temperature was maintained at 4 ℃.

The purification steps after DNA sulfite treatment are as follows:

(1) Transferring the reaction system in the tube to a clean 1.5ml centrifuge tube through short centrifugation;

(2) Adding 1ml of 6M guanidine hydrochloride and 40 mu l of magnetic beads, mixing by vortex for 10sec, and standing for 5min at room temperature;

(3) Placing the centrifuge tube on a magnetic frame, standing for 1min, and removing liquid after magnetic beads are adsorbed;

(4) Add 600. Mu.l of rinse (80% ETOH/50mM Tris Buffer) and vortex for 10sec;

(5) Placing the centrifuge tube on a magnetic frame, standing for 1min, and removing liquid after magnetic beads are adsorbed;

(6) Adding 600 μ l of desulfurizing solution (0.3N NaOH/90% EtOH), vortex mixing for 10sec, standing at room temperature for 15min;

(7) Placing the centrifuge tube on a magnetic frame, standing for 1min, and removing liquid after magnetic beads are adsorbed;

(8) Add 600. Mu.l of rinse (80% ETOH/50mM Tris Buffer) and vortex for 10sec;

(9) Placing the centrifugal tube on a magnetic frame, standing for 1min, and removing liquid after magnetic beads are adsorbed;

(10) Rinsing with the rinsing liquid for one time;

(11) Centrifuging for a short time to collect the residual liquid to the bottom of the tube, and removing the liquid as much as possible;

(12) Drying at room temperature for 3-5 min until no liquid residue exists;

(13) Adding 20-40 mul of preheated 1 XTE buffer solution (50 ℃) and mixing the magnetic beads evenly, and placing for 3min at room temperature;

(14) And (3) placing the centrifugal tube on a magnetic frame, standing for 1min, and collecting an elution product (namely the conversion DNA) after the magnetic beads are adsorbed.

Example 3: fluorescence quantitative PCR detection of methylation of 6 target genes

(1) The methylation indexes of bladder cancer urine cast-off cell genes are detected by adopting a fluorescence PCR method, wherein the primers for detecting the methylation genes by adopting the PCR method are as follows:

SEQ ID NO.1:SOX1_MF：TTTTCGGGTATTTGGGATTAGT

SEQ ID NO.2:SOX1_MR：CTATCTCCTTCCTCCTACGCTC

SEQ ID NO.3:HOXA9_MF：ATGAAATTTGTAGTTTTATAATTTT

SEQ ID NO.4:HOXA9_MR：ATTACCCAAAACCCCAATAATAAC

SEQ ID NO.5:ZNF671_MF：CGGAGGACGTAGTATTTATTCGC

SEQ ID NO.6:ZNF671_MR：CTACGTCCCCGATCGAAACG

SEQ ID NO.7:VIM_MF：GCGGCGGTTCGGGTATCG

SEQ ID NO.8:VIM_MR：GCCGTAATCACGTAACTCCGACT

SEQ ID NO.9:IRAK3 MF：AGGAGATCGTTTAGTCGTGGGGTAC

SEQ ID NO.10:IRAK3 MR：ACCTCTACGATAAAAACGAAACTACCG

SEQ ID NO.11:RASSF1_MF：GGGTTTTGCGAGAGCGCG

SEQ ID NO.12:RASSF1_MR：GCTAACAAACGCGAACCG

SEQ ID NO.13:ACTB_MF:TGGTGATGGAGGAGGTTTAGTAAGT

SEQ ID NO.14:ACTB_MR:AACCAATAAAACCTACTCCTCCCTTAA

the TaqMan probes are as follows:

SEQ ID NO.15(SOX1):FAM-AGAAGTTGTAGTTTTCGAGTTGGAGG-BHQ1

SEQ ID NO.16(HOXA9):HEX-GGGTCGGGTCGGGCGGGTTA-BHQ1

SEQ ID NO.17(ZNF671):ROX-CGTGGGCGCGGATAGTTGTCGGGAGCG-BHQ2

SEQ ID NO.18(VIM):FAM-GCAGTCGGTCGAGTT-BHQ1

SEQ ID NO.19(IRAK3):HEX-TTAGTTCGTATTTTGTTTGT-BHQ1

SEQ ID NO.20(RASSF1):ROX-GGGAGGCGTTGAAGTCGGGG-BHQ2

SEQ ID NO.21(ACTB):CY5–TGTGTTTGTTATTGTGTGTTGGGTGGTGGT-BHQ3

(2) DNA transformed by sulfite is used for fluorescent quantitative PCR;

6 target gene detection is divided into 2 groups of PCR reactions, and primer and fluorescent probe mixed solution-1: SOX1, HOXA9, ZNF671, ACTB, primer + fluorescent probe mixture-2: VIM, IRAK3, RASSF1, ACTB, 0.25. Mu.l each of 10. Mu.M primer, 0.125. Mu.l 10. Mu.M fluorescent probe were taken.

The PCR reaction (25. Mu.l) was:

5μl	sulfite conversion of DNA
		6μl	4x HU MP Buffer
2.5μl	Primer + fluorescent probe mixed solution-1/or mixed solution-2
		9.5μl	H 2 O
2μl	Enzyme Mix

At the same time, untransformed DNA was taken as a control. The gene methylation PCR reaction conditions are set as follows: 95 ℃ 5min,45cycles (95 ℃ 15sec,61 ℃ 30 sec), 72 ℃ 30sec.

(3) After the PCR reaction is finished, the fluorescent signal is detected

Methylated ACTB and 6 target genes methylated PCR do not detect amplification signals (Ct value is more than or equal to 38 or countless) in urine sample DNA of patients with bladder cancer and normal people without sulfite transformation.

The methylation ACTB detects the Ct value of an amplification signal between 25 and 32 in the DNA of samples of patients with the transformed bladder cancer and normal people. The Ct value of ACTB is less than or equal to 35, which indicates that the DNA sample to be detected is effective, and the Ct value is more than 35, which indicates that the DNA sample to be detected is ineffective, and the DNA needs to be prepared again.

No amplification signal is seen in 6 target genes in 10 cases of DNA transformed by normal human urine cast-off cells (the Ct value is more than or equal to 38 or countless); the gene methylation detection results of 20 cases of DNA samples transformed by bladder cancer patients with urine exfoliated cells are shown in Table 1, wherein the amplification is performed when the Ct value of 6 target gene methylation detection is less than or equal to 35, the amplification is not performed when the Ct value is greater than or equal to 38, and the critical value is 35-woven Ct value less than 38. The results show that methylation amplification of 2 or more genes in the sample indicates that the case is positive, and 1 gene is suspected for clinical reference.

Table 1: DNA sample methylation detection results

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate. Various modifications and substitutions of those details may be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Claims (10)

1. Use of a substance for the manufacture of a kit for diagnosing bladder cancer or a precancerous bladder lesion, screening for the formation or risk of formation of bladder cancer, assessing the progression or prognosis of bladder cancer, the substance comprising:

(a) A reagent or device for determining the methylation status or level of at least one CpG dinucleotide of one or more target markers in a sample of a subject, and

optionally (b) a target marker-treated nucleic acid molecule, said treatment converting unmethylated cytosine to uracil,

optionally (c), a conversion reagent for treating the DNA, wherein the conversion reagent is capable of distinguishing unmethylated sites from methylated sites in the DNA, for example converting cytosine, which is capable of being unmethylated, to uracil,

the one or more markers of interest comprise a gene or fragment thereof comprising 1, 2, 3, 4, 5, or all 6 selected from: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1.

2. The use of claim 1, wherein the genes comprise at least 2 selected from the group consisting of: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1;

preferably, the first and second electrodes are formed of a metal,

the genes include ZNF671 and at least 1 selected from the group consisting of: SOX1, HOXA9, VIM, IRAK3 and RASSF1, or

The genes include HOXA9 and one or more selected from: SOX1, VIM, RASSF1;

more preferably still, the first and second liquid crystal compositions are,

the genes include SOX1 and ZNF671, optionally further comprising at least 1 selected from the group consisting of: HOXA9, VIM, IRAK3 and RASSF1, or

The genes include HOXA9 and ZNF671, optionally further comprising at least 1 selected from the group consisting of: SOX1, VIM, IRAK3 and RASSF1, or

The genes include ZNF671, VIM and RASSF1, optionally further comprising at least 1 selected from the group consisting of: SOX1, HOXA9 and IRAK3.

3. The use of claim 1, wherein the bladder cancer is MIBC,

the genes include ZNF671 and at least 1 selected from the group consisting of: SOX1, HOXA9, VIM, IRAK3 and RASSF1, or

The genes comprise HOXA9, RASSF1, optionally further comprising at least 1 selected from: SOX1, ZNF671, VIM, IRAK3,

preferably, the first and second electrodes are formed of a metal,

the genes comprise SOX1 and ZNF671, optionally further comprising one or more selected from HOXA9, VIM and IRAK 3;

the genes comprise HOXA9 and ZNF671, optionally further comprising one or more of IRAK3 and RASSF1;

the genes comprise ZNF671, VIM, optionally further comprising one or more of IRAK3 and RASSF1.

4. The use of claim 1, wherein the bladder cancer is NMIBC, and the genes comprise HOXA9 and at least 1 selected from: SOX1, ZNF671, VIM, IRAK3 and RASSF1,

preferably, the first and second liquid crystal display panels are,

the genes comprise HOXA9 and SOX1, and optionally further comprise one or more selected from ZNF671, VIM, IRAK3 and RASSF1;

the genes comprise HOXA9, SOX1 and ZNF671, optionally further comprising one or more selected from VIM, IRAK3 and RASSF1;

the genes comprise HOXA9, SOX1, ZNF671, VIM, and optionally further comprise one or more selected from IRAK3 and RASSF1;

the genes comprise HOXA9, ZNF671 and optionally one or more selected from VIM, IRAK3 and RASSF1;

the genes comprise HOXA9, ZNF671 and VIM, and optionally further comprise one or more selected from IRAK3 and RASSF1;

the genes comprise HOXA9, RASSF1, optionally further comprising at least 1 selected from: SOX1, ZNF671, VIM, IRAK3.

5. The use according to any one of claims 1 to 4,

the fragment is a fragment of the gene sequence comprising a CpG island, and/or

The fragment is a promoter region of a gene sequence, and/or

The fragment comprises at least 1, preferably at least 3 CpG dinucleotides, and/or

(a) The reagent comprises a primer molecule that hybridizes to the target marker or their transformed sequence, and/or

(a) Said reagents comprising detection probes that hybridize to said target markers or their transformed sequences,

preferably, the first and second electrodes are formed of a metal,

the primer has a sequence selected from any one of the following groups 1, 2, 3, 4, 5 or all 6: (1) SEQ ID NO:1 and SEQ ID NO:2, (2) SEQ ID NO:3 and SEQ ID NO:4, (3) SEQ ID NO:5 and SEQ ID NO:6, (4) SEQ ID NO:7 and SEQ ID NO:8, (5) SEQ ID NO:9 and SEQ ID NO:10, (6) SEQ ID NO:11 and SEQ ID NO:12,

the detection probe has a sequence shown by any one or more or all of SEQ ID NO 15-20.

6. The use according to any one of claims 1 to 4,

the subject is a mammal in need thereof,

the sample is derived from a urine sample from a mammal,

the kit also comprises a PCR reaction reagent,

the kit further comprises other reagents for detecting DNA methylation, the other reagents being reagents for one or more of the following methods selected from: PCR based on bisulfite conversion, DNA sequencing, methylation sensitive restriction enzyme analysis, fluorescence quantification, methylation sensitive high-resolution melting curve method, chip-based methylation map analysis, and mass spectrum,

the kit also comprises a sample processing reagent, including a urine preservation solution and/or a DNA extraction reagent.

7. A kit for diagnosing bladder cancer or a precancerous bladder lesion, screening for the formation or risk of formation of bladder cancer, assessing bladder cancer progression or prognosis, comprising:

(a) A reagent or device for determining the methylation status or level of at least one CpG dinucleotide of one or more target markers in a sample of a subject, and

optionally (b) a nucleic acid molecule treated with said marker of interest, said treatment converting unmethylated cytosine to uracil,

wherein the one or more target markers comprise genes or fragments thereof, the genes comprising 1, 2, 3, 4, 5, or all 6 selected from: SOX1, HOXA9, ZNF671, VIM, IRAK3 and RASSF1.

8. The kit of claim 7,

(a) The reagent or device is as described in any of claims 1-7, and/or

The kit further comprises a transformation reagent for treating the DNA, wherein the transformation reagent is capable of distinguishing between unmethylated sites and methylated sites in the DNA; preferably, the conversion reagent comprises a bisulphite reagent; more preferably, the conversion reagent comprises: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

9. The kit of claim 7 or 8,

the kit also comprises a primer for amplifying the ATCB and/or a detection probe hybridized with the ATCB, and/or

The kit comprises a first container containing primers and detection probes for the genes SOX1, HOXA9, ZNF671 and optionally ACTB, and a second container containing primers and detection probes for the genes VIM, IRAK3, RASSF1 and optionally ACTB.

10. The kit of claim 7 or 8,

the subject is a mammal, and/or

The sample is a urine sample, and/or

The kit also comprises PCR reaction reagents, and/or

The kit further comprises reagents for detecting DNA methylation, said reagents being reagents used in one or more of the following methods selected from: bisulfite conversion based PCR, DNA sequencing, methylation sensitive restriction enzyme analysis, fluorometry, methylation sensitive high resolution melting curve, chip-based methylation profile analysis, mass spectrometry, and/or

The kit also comprises a sample processing reagent, including a urine preservation solution and/or a DNA extraction reagent.