CN114560921A - OsR5BP1 protein and its coding gene have regulation and control effect on stress tolerance, growth performance and production performance of plant - Google Patents

Abstract

The invention discloses the OsR5BP1 protein and the regulation and control function of the coding gene thereof on the stress tolerance, the growth performance and the production performance of plants. The invention protects the application of OsR5BP1 protein in regulating and controlling the stress tolerance of plants, wherein the regulation is negative regulation, namely, the content of OsR5BP1 protein is reduced, and the stress tolerance of plants is enhanced. The invention also protects the application of the OsR5BP1 protein in regulating and controlling the growth performance and/or the production performance of plants. The regulation is negative regulation, namely OsR5BP1 protein content is reduced, and the growth performance and/or the production performance of the plant are improved. The invention can be used for improving plant traits and has great application and popularization values for plant breeding, particularly rice breeding.

Description

OsR5BP1 protein and its coding gene have regulation and control effect on stress tolerance, growth performance and production performance of plant

Technical Field

The invention belongs to the technical field of biology, and relates to a OsR5BP1 protein and a regulation and control effect of a coding gene thereof on stress tolerance, growth performance and production performance of plants.

Background

Rice is native to china and india. Is one of the main grain crops in the world. The rice seeding surface of China accounts for 1/4 of food crops all over the country, and the yield accounts for more than half. The cultivation history is 14000-18000 years. Is an important grain crop; besides the edible caryopsis, the rice bran can be used for preparing starch, brewing wine and vinegar, and the rice bran can be used for preparing sugar, extracting oil and extracting furfural for industrial and medical use; the rice straw is a good feed, paper making raw material and weaving material, and the rice sprout and rice root can be used for medicine.

In recent years, the rapid development of biotechnology has greatly promoted the innovation of plant breeding research means and the continuous improvement of research level, and the breeding of plant by biotechnology for resisting diseases and insects and resisting herbicides has already entered the practical stage. The exogenous insecticidal and herbicide-resistant genes are introduced into the plant genome by a biotechnology means, so that the natural barrier that plant species and even species are difficult to hybridize is broken, and the transfer of the insect-resistant and herbicide-resistant genes is realized, so that the plant can rapidly and directionally obtain insect resistance and mechanized weeding, and the original good agronomic characters can be reserved. Because each plant of the transgenic corn has a certain degree of resistance, the insect-resistant and herbicide-resistant effects of the transgenic corn are better and more stable than the control effects of artificial control, and the transgenic corn can also save the investment of manpower and material resources and effectively save social resources. The development and application of other agronomic character improved transgenic plants are not as ideal as insect-resistant and herbicide-resistant characters, mainly because of the lack of excellent character improved genes, most agronomic characters are mainly caused by the control of a plurality of micro-effective genes, and no ideal genes are operated all the time.

Disclosure of Invention

The invention aims to provide the OsR5BP1 protein and the coding gene thereof, which have the function of regulating the stress tolerance, the growth performance and the production performance of plants.

The invention discloses application of OsR5BP1 protein in regulation and control of plant stress tolerance

The regulation is negative regulation, namely OsR5BP1 protein content is reduced, and the stress tolerance of the plant is enhanced.

The invention also protects the application of OsR5BP1 protein or OsR5BP1 gene as an inhibition target in plant breeding; the goal of such plant breeding is to develop plants with enhanced stress tolerance.

The invention also protects the application of a substance inhibiting OsR5BP1 gene and/or a substance inhibiting OsR5BP1 protein in plant breeding; the goal of such plant breeding is to develop plants with enhanced stress tolerance.

Specifically, the substance for inhibiting the OsR5BP1 gene is a plasmid for inhibiting OsR5BP1 gene.

Specifically, the substance inhibiting OsR5BP1 gene is a plasmid inhibiting OsR5BP1 gene based on Cas9 system.

The invention also provides a plant breeding method for cultivating the plant with enhanced stress tolerance, which comprises the following steps: carrying out gene editing on OsR5BP1 gene in a receptor plant to obtain a gene editing plant; the stress tolerance of the gene-edited plant is enhanced as compared to the recipient plant.

The invention also provides a method for preparing a plant with enhanced stress tolerance, which comprises the following steps: replacement of "CCGGGCGCAAAGGTCTAGTC" in OsR5BP1 gene in plant genomic DNA with "CCGAGGCGCAAAGGTCTAGTC" or "CCGGCGCAAAGGTCTAGTC" resulted in plants with enhanced stress tolerance.

The stress resistance is heat resistance and/or salt resistance.

The invention also protects the application of the OsR5BP1 protein in regulating and controlling the growth performance and/or the production performance of plants.

The regulation is negative regulation, namely OsR5BP1 protein content is reduced, and the growth performance and/or the production performance of the plant are improved.

The invention also protects the application of OsR5BP1 protein or OsR5BP1 gene as an inhibition target in plant breeding; the goal of plant breeding is to cultivate plants with improved growth performance and/or improved production performance.

The invention also protects the application of a substance inhibiting OsR5BP1 gene and/or a substance inhibiting OsR5BP1 protein in plant breeding; the goal of plant breeding is to cultivate plants with improved growth performance and/or improved production performance.

Specifically, the substance inhibiting OsR5BP1 gene is a plasmid inhibiting OsR5BP1 gene.

Specifically, the substance for inhibiting OsR5BP1 gene is a plasmid for inhibiting OsR5BP1 gene based on Cas9 system.

The invention also provides a plant breeding method, which comprises the following steps: carrying out gene editing on OsR5BP1 gene in a receptor plant to obtain a gene editing plant; the gene-edited plant has improved growth performance and/or improved productivity as compared to the recipient plant.

The invention also provides a method for producing a plant with improved growth performance and/or improved production performance, comprising the steps of: replacement of "CCGGGCGCAAAGGTCTAGTC" in the OsR5BP1 gene in plant genomic DNA with "CCGAGGCGCAAAGGTCTAGTC" or "CCGGCGCAAAGGTCTAGTC" results in plants with improved growth performance and/or improved production performance.

The improvement in growth performance refers to an increase in tiller number and/or spike length and/or an increase in the number of branches.

The number of the branches is the number of the first-stage branches and/or the number of the second-stage branches.

The productivity improvement refers to yield improvement.

The improved productivity refers to the improved yield of the single plant.

The improved production performance refers to the improved number of grains.

The improvement of the production performance refers to the improvement of the number of single-ear grains.

The OsR5BP1 gene is used for inhibiting the activity of OsR5BP1 gene and/or reducing the abundance of OsR5BP1 gene. Reducing the abundance of the OsR5BP1 gene can be achieved by rendering RNA non-transcribable. Reduction of the abundance of the OsR5BP1 gene can be achieved by gene editing. The gene editing may specifically be a Cas9 system based gene editing. In the Cas9 system, the target sequence binding region in sgRNA is shown as sequence 7 in the sequence table. In the Cas9 system, sgRNA is shown as sequence 6 in the sequence table. The gene editing is realized by introducing a recombinant plasmid shown in a sequence 4 of a sequence table into a plant.

Any of the OsR5BP1 inhibiting proteins is used for inhibiting the activity of OsR5BP1 protein and/or reducing the abundance of OsR5BP1 protein. The reduction in abundance of OsR5BP1 protein can be achieved by rendering OsR5BP1 protein non-expressible.

Any of the above gene edits may specifically be a Cas9 system-based gene edit. Specifically, the sgRNA and Cas9 proteins can be used as a substance for gene editing of the OsR5BP1 gene. Specifically, the substance for gene editing of OsR5BP1 gene can be a DNA molecule encoding sgRNA and a DNA molecule encoding Cas9 protein. The substance for gene editing of OsR5BP1 gene can be specifically an expression vector having a DNA molecule encoding sgRNA and an expression vector having a DNA molecule encoding Cas9 protein. The substance for gene editing of OsR5BP1 gene can be specifically an expression vector having a DNA molecule encoding sgRNA and a DNA molecule encoding Cas9 protein. The target sequence binding region in the sgRNA is shown as a sequence 7 in a sequence table. The sgRNA is shown as a sequence 6 in a sequence table. The DNA molecule of the sgRNA is shown as a sequence 5 in a sequence table. The substance for gene editing of OsR5BP1 gene is specifically a recombinant plasmid shown in sequence 4 of a sequence table.

The substitutions are homozygous, i.e. the same substitution occurs in homologous chromosomes.

Any one of the OsR5BP1 proteins is (a1) or (a2) or (a3) or (a 4):

(a1) protein shown as a sequence 1 in a sequence table;

(a2) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);

(a3) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues in (a1) and related to the stress tolerance and/or the growth performance and/or the production performance of plants;

(a4) a protein derived from rice, having 98% or more identity to (a1), and being involved in stress tolerance, growth performance and/or productivity of plants.

Any one of the OsR5BP1 genes is a gene for coding OsR5BP1 protein.

Any one of the OsR5BP1 genes is (b1), (b2), (b3) or (b 4):

(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;

(b2) DNA molecule shown in sequence 3 in the sequence table;

(b3) a DNA molecule derived from rice and having 95% or more identity to (b1) or (b2) and encoding the protein;

(b4) a DNA molecule which hybridizes with the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

Any of the Cas9 proteins is a protein encoded by nucleotides 2697-6968 in sequence 4 of the sequence table.

Any of the above plants is a monocot or a dicot. Any of the above plants is a gramineae plant. Any of the above plants is a plant of the genus oryza. Any of the above plants is rice, for example, Nipponbare.

The invention can be used for improving plant traits and has great application and popularization values for plant breeding, particularly rice breeding.

Drawings

FIG. 1 is a schematic diagram of the structure of a recombinant plasmid.

FIG. 2 shows the sequencing results of the mutation sites and their peripheral nucleotides of Osr5bp1-1 plant and Osr5bp1-2 plant.

FIG. 3 is a photograph of plant phenotype.

FIG. 4 shows the statistical results of plant height.

FIG. 5 shows the statistics of tillering number.

FIG. 6 shows the statistics of the yield of individual plants.

FIG. 7 is a photograph of spike phenotype.

FIG. 8 shows the statistical results of spike length.

Fig. 9 shows the statistics of the number of single ear grains.

FIG. 10 shows the statistics of the number of branches.

FIG. 11 is a photograph of plant phenotype in heat stress test.

Fig. 12 is a survival rate statistic for the heat stress test.

FIG. 13 is a photograph of plant phenotype in salt stress test.

FIG. 14 is a statistical result of survival rate of salt stress test.

FIG. 15 shows RNA m⁵At the level of C modificationAnd (4) obtaining the result.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged.

OsR5BP1 protein is shown as sequence 1 in the sequence table. In the cDNA of Nipponbare of rice, CDS of coded OsR5BP1 protein is shown as a sequence 2 in a sequence table. In the genomic DNA of the rice Nipponbare, a gene coding OsR5BP1 protein is shown as a sequence 3 in a sequence table. The function of the OsR5BP1 protein is unknown in the prior art.

Example 1 preparation of Gene-edited plants

Construction of recombinant plasmid

Preparing a recombinant plasmid (circular plasmid) which is shown as a sequence 4 in a sequence table. The recombinant plasmid expresses Cas9 protein and a specific sgRNA. In the sequence 4 of the sequence table, the nucleotides 2697-6968 encode Cas9 protein. The coding region of the specific sgRNA is shown as sequence 5 in the sequence table (i.e. nucleotide 519-614 in sequence 4 of the sequence table). The specific sgRNA is shown as a sequence 6 in a sequence table, and a target sequence binding region in the sgRNA is shown as a sequence 7 in the sequence table. The structure of the recombinant plasmid is schematically shown in FIG. 1.

Secondly, genetic transformation is carried out and regeneration plants are obtained

And (3) introducing the recombinant plasmid prepared in the step one into agrobacterium EHA105 to obtain recombinant agrobacterium. Carrying out genetic transformation on the embryogenic callus of Nipponbare rice by recombinant agrobacterium by adopting an agrobacterium impregnation method, then screening resistant callus (the resistance screening adopts 100mg/L hygromycin), then carrying out differentiation regeneration culture, and then carrying out rooting culture to obtain a regeneration plant.

Thirdly, obtaining the gene editing plant and the progeny plant thereof

And D, identifying the regenerated plant obtained in the step two as follows: taking leaves, extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of a primer F1 and a primer R1, and sequencing the PCR amplification product.

F1：5’-GCTCGTCAGGGCGCGCCTCG-3’；

R1：5’-GTGGATCAATGTCAGCCACT-3’。

Through the identification, two homozygous mutant plants (homozygous mutants, namely, two chromosome-generated mutations are consistent) are obtained by screening from the regenerated plants obtained in the step two and are named as Osr5bp1-1 plants and Osr5bp1-2 plants respectively. As proved by sequencing, compared with the genomic DNA of Nip, the Osr5BP1-1 plant is different only in that a nucleotide is inserted into the gene coding OsR5BP1 protein (frame shift mutation is caused and termination is carried out in advance), and the sequencing results of the mutation site and the peripheral nucleotides are shown in figure 2. Through sequencing identification, compared with the genomic DNA of Nip (expressed by Nip), the Osr5BP1-2 plant is different only in that a nucleotide deletion (causing frame shift mutation and early termination) occurs in the gene coding OsR5BP1 protein, and the sequencing results of the mutation site and the peripheral nucleotides are shown in figure 2.

Osr5bp1-1 plants are selfed and seeds are harvested, and the seeds are cultivated into plants, namely T1 generation plants. T1 generation plants are self-crossed and harvested to obtain seeds, namely T2 generation seeds. Osr5bp1-1 plant and its selfed progeny are called strain Osr5bp 1-1.

Osr5bp1-2 plants are selfed and seeds are harvested, and the seeds are cultivated into plants, namely T1 generation plants. T1 generation plants are self-crossed and harvested to obtain seeds, namely T2 generation seeds. Osr5bp1-2 plant and its progeny after selfing are called strain Osr5bp 1-2.

Example 2 growth Performance of plants

The test seeds were: nipponbare seeds of rice, T2 generation seeds of Osr5bp1-1 strain and T2 generation seeds of Osr5bp1-2 strain.

The test plants were cultured under parallel conditions, specifically: taking seeds, germinating in a greenhouse and culturing seedlings (counting time from white exposure, culturing for 3 weeks) to obtain 3-week seedlings; transplanting the 3-week seedlings to a field of a Hebei corridor and carrying out normal cultivation management.

Photographs of the plants in the grain filling stage are shown in FIG. 3.

The plant height statistics of plants in the mature period are shown in FIG. 4 (average of 15 plants). The plant heights of the Nipponbare plants of rice, Osr5bp1-1 strains of plants and Osr5bp1-2 strains of plants have no obvious difference.

The statistical results of tillering number of plants in the mature period are shown in FIG. 5 (average of 15 plants). Compared with the Nipponbare plants of rice, the tillering number of the plants of Osr5bp1-1 line and Osr5bp1-2 line is obviously increased.

And (4) collecting seeds of the single plant of the plant in the mature period, airing and weighing to obtain the single plant yield. The statistics of individual plant yields are shown in FIG. 6 (average of 15 plants). Compared with the Nipponbare plants of rice, the yield of each plant of Osr5bp1-1 strain and Osr5bp1-2 strain is obviously increased.

And (4) observing the spike phenotype of the plant in the mature period, taking a picture, and counting the spike length and the number of grains per spike. The photograph is shown in FIG. 7. The statistics of spike length are shown in FIG. 8 (average of 15 plants). The statistics of the number of kernels per panicle are shown in FIG. 9 (average of 15 plants). Compared with the Nipponbare plants of rice, the panicle length of the plants of Osr5bp1-1 line and Osr5bp1-2 line is obviously increased. Compared with the Nipponbare plants of rice, the number of seeds per spike of the plants of Osr5bp1-1 strain and Osr5bp1-2 strain is obviously increased.

And observing the spike part of the plant in the mature period, and counting the number of the first-grade and second-grade branches. The results are shown in FIG. 10 (average of 15 plants). Compared with the Nipponbare plants of rice, the number of the primary branches and the number of the secondary branches of the plants of Osr5bp1-1 strain and the plants of Osr5bp1-2 strain are both obviously increased.

Example 3 stress tolerance of plants

First, Heat stress test

The test seeds were: nipponbare seeds of rice, T2 generation seeds of Osr5bp1-1 strain and T2 generation seeds of Osr5bp1-2 strain.

The test plants were cultured under parallel conditions, specifically: seeds were taken, germinated and cultivated in a greenhouse using Hoagland nutrient solution to the trefoil stage (time point a, photographed), then transferred to a 45 ℃ incubator for 50 hours (time point B, photographed), then transferred back to the greenhouse and cultivated for 7 days (time point C, photographed), and then the survival rates were counted (at least 24 plants were counted per test plant). The greenhouse conditions were: at 28 ℃ 10 hours light/14 hours dark.

The photographs of the plants are shown in FIG. 11, with the left corresponding to time point A, the middle corresponding to time point B, and the right corresponding to time point C.

The survival results are shown in figure 12. The survival rate of the Nipponbare plants is about 18.5 percent, the survival rate of Osr5bp1-1 plant is about 56.2 percent, and the survival rate of Osr5bp1-2 plant is about 52.3 percent. Compared with Nipponbare, the heat resistance of Osr5bp1-1 strain plants and Osr5bp1-2 strain plants is obviously improved.

Salt stress test

The test seeds were: nipponbare seeds of rice, T2 generation seeds of strain Osr5bp1-1 and T2 generation seeds of strain Osr5bp 1-2.

The test plants were cultured under parallel conditions, specifically: seeds are taken, germinated and cultured in a greenhouse by using Hoagland nutrient solution to the trefoil stage (time point A, photographed), then cultured for 5 days by using Hoagland nutrient solution containing 150mM NaCl (time point B, photographed), then seedlings are washed, then cultured for 7 days by using Hoagland nutrient solution (time point C, photographed), and finally the survival rate is counted (at least 24 plants are counted for each plant to be tested). The greenhouse conditions were: 10 hours light/14 hours dark at 28 ℃.

The photographs of the plants are shown in FIG. 13, with the left corresponding to time point A, the middle corresponding to time point B, and the right corresponding to time point C.

The survival results are shown in figure 14. The survival rate of the Nipponbare plants is 19.7 percent, the survival rate of Osr5bp1-1 strain plants is about 39.6 percent, and the survival rate of Osr5bp1-2 strain plants is about 33.8 percent. Compared with Nipponbare, the salt tolerance of Osr5bp1-1 strain plants and Osr5bp1-2 strain plants is obviously improved.

Example 4 RNA m⁵Level of C modification

The test seeds were: nipponbare seeds of rice, T2 generation seeds of Osr5bp1-1 strain and T2 generation seeds of Osr5bp1-2 strain.

The test plants were cultured under parallel conditions, specifically: taking seeds, germinating in a greenhouse, culturing to a three-leaf stage, taking overground parts, and extracting total RNA.

Total RNA was collected and subjected to RNA Dot-blot (Dot blot hybridization). The specific antibody adopted is anti-m⁵C antibody (Diagenode, C15200081). The amount of RNA was set at 100, 200 or 400 ng/. mu.l, respectively.

Taking total RNA, and detecting m by triple quadrupole liquid chromatography-mass spectrometry (UHPLC-MS/MS)⁵Abundance of C modifications. An Agilent 6400 triple quadrupole liquid chromatography-mass spectrometer was used, drochen distilled water (0.1% formic acid) and acetonitrile (0.1% formic acid) were used as mobile phases, a GOLDaQ column (100 mm. times.2.1 mm) had a pore size of 1.9 μm, and ion pair sampling was set for detection.

The results are shown in FIG. 15.

The results show that compared with Nipponbare, RNA m of Osr5bp1-1 strain plant and Osr5bp1-2 strain plant⁵The level of C modification increased.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> OsR5BP1 protein and its coding gene have regulation and control effects on stress tolerance, growth performance and production performance of plants

<130> GNCYX220722

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 465

<212> PRT

<213> Oryza sativa

<400> 1

Met Leu Arg Ala Cys Gly Gly Ala Ser Pro Ala Ala Ala Ala Ala Ala

1 5 10 15

Val Pro Ala Leu Val Arg Ala Arg Leu Ala Lys Gln Ala Ser Ser Ala

20 25 30

Ala His Ala Ala Ala Thr Ala Thr Ala Ser Ala Ser Ser Ser Leu Ser

35 40 45

Ala Leu Gly Glu Val Ala Ala Gly Arg Lys Gly Leu Ala Arg Val Val

50 55 60

Leu Lys Lys Gly Lys Thr Gln Ile Phe Arg Asp Gly Ser Pro Met Val

65 70 75 80

Tyr Ser Gly Ala Val Asp Arg Ile Ile Gly Arg Pro Pro Pro Lys Thr

85 90 95

Gly Asp Val Val Leu Val Ala Asp Gly Ala Glu Lys Pro Ile Gly Trp

100 105 110

Gly Leu Tyr Asn Ser Val Ser Met Phe Cys Val Arg Leu Met Gln Leu

115 120 125

Glu Glu Glu Ala Lys Arg Asp Pro Thr Cys Ala Leu Asn Met Glu Arg

130 135 140

Leu Leu Glu Ala Arg Ile Leu Ser Ala Val Asp Leu Arg Arg Ser Leu

145 150 155 160

Gly Leu Pro Ser Val His Thr Asn Ala Tyr Arg Leu Ile Asn Ser Glu

165 170 175

Gly Asp Arg Leu Ser Gly Leu Ile Val Asp Ile Phe Ala Asp Val Ala

180 185 190

Val Val Ala Ser Ser Ala Ala Trp Val Glu Lys Tyr Arg His Glu Ile

195 200 205

Gln Phe Leu Val Asn Lys Val Ser Asp Val Asn His Ile Lys Trp Arg

210 215 220

Ser Ser Thr Asp Ile Leu Lys Glu Glu Gly Leu Asp Val Ser Glu Gln

225 230 235 240

Lys Asp Pro Glu Ser Ser Ser His Cys Gly Thr Val Glu Val Met Glu

245 250 255

Asn Asp Val Leu Tyr Leu Val Ser Leu Glu Gly Gln Lys Thr Gly Phe

260 265 270

Tyr Ala Asp Gln Arg Glu Asn Arg His Phe Ile Ser Thr Leu Ser Lys

275 280 285

Asp Gln Arg Val Leu Asp Leu Cys Cys Tyr Ser Gly Gly Phe Ala Leu

290 295 300

Asn Ala Ala Lys Gly Gly Ala Asn Asn Val Ile Gly Ile Asp Ser Ser

305 310 315 320

Ala Ser Ala Leu Asp Leu Ala Asn Lys Asn Ile Ile Leu Asn Lys Leu

325 330 335

Asp Thr Gln Arg Ile Ser Phe Val Lys Glu Asp Ala Thr Ala Phe Met

340 345 350

Lys Gly Ala Ile Ser Arg Asn Glu Val Trp Asp Leu Val Ile Leu Asp

355 360 365

Pro Pro Lys Leu Ala Pro Arg Lys Lys Val Leu Gln Ser Ala Ser Gly

370 375 380

Met Tyr Arg Ser Leu Asn Ala Leu Ala Met Gln Val Val Lys Pro Gly

385 390 395 400

Gly Leu Leu Met Thr Cys Ser Cys Ser Gly Ala Met Thr Gln Ser Gly

405 410 415

Leu Phe Leu Arg Thr Ile Gln Gly Ala Ala Ser Met Thr Gly Arg Lys

420 425 430

Val Thr Val Leu Arg Gln Ala Gly Ala Ala Cys Asp His Pro Val Asp

435 440 445

Pro Ala Tyr Pro Glu Gly Arg Tyr Leu Ser Asn Tyr Leu Leu Arg Val

450 455 460

Thr

465

<210> 2

<211> 1398

<212> DNA

<213> Oryza sativa

<400> 2

atgctgcgcg cttgcggcgg cgcgtcgccg gcggcggcgg cggcggcggt gcccgcgctc 60

gtcagggcgc gcctcgcgaa gcaggcctcc tccgcagccc acgcggccgc caccgccacc 120

gcctccgctt cctcctccct ctccgcgctg ggagaggtcg ccgccgggcg caaaggtttg 180

gcaagagtag tattaaagaa aggaaagacc caaatatttc gagatgggag tccgatggtg 240

tatagtggtg ctgttgatag aataattggt cgacctcctc caaaaactgg tgatgttgtt 300

cttgtagctg atggggcaga gaaacctatt ggatggggtc tctataactc tgtgtccatg 360

ttttgtgttc ggctgatgca actagaagaa gaggcaaaaa gggatccaac atgtgcacta 420

aatatggaaa gactgcttga ggcaaggatt ttatctgctg tggatttacg gcgcagttta 480

ggtctccctt cagttcacac aaatgcttat cgtctcatca acagtgaagg ggacagattg 540

tctggtctaa tagtggatat ctttgctgat gttgctgtag ttgcttcatc tgctgcttgg 600

gttgagaaat ataggcatga aatccagttc cttgttaaca aagtcagtga tgtgaaccat 660

ataaagtgga gatcatcaac agatattcta aaagaagaag gattagatgt atcagaacaa 720

aaggatcctg aatcgtcttc acactgtgga acagtggagg tcatggagaa tgatgttctc 780

tatctagtct cattggaggg gcagaaaaca gggttttatg cagatcaacg tgagaaccgt 840

catttcatat caacactctc aaaggaccaa agggttcttg atctgtgctg ctatagtggt 900

ggttttgctc taaatgcagc aaagggtggt gctaataatg tcattggcat tgattcatca 960

gcatcagcac tagaccttgc caataagaat attatcctga ataagcttga cacccaaagg 1020

atttcgtttg taaaagaaga tgcgactgca ttcatgaaag gtgctatctc aagaaatgag 1080

gtctgggact tggtaatcct tgatcctcca aagttggcac ctcgaaaaaa ggtgctacaa 1140

agtgcctcgg gtatgtacag aagcttgaac gctcttgcga tgcaagtggt aaagccaggg 1200

gggttactca tgacatgctc atgctctgga gctatgaccc aaagcggcct cttcctcaga 1260

accattcagg gtgctgcatc aatgaccggc cgaaaggtta cagttctacg ccaagcaggg 1320

gcagcctgtg atcatcccgt agatcctgca taccctgaag gccgatatct cagcaattac 1380

ttgctccgag tgacctga 1398

<210> 3

<211> 4185

<212> DNA

<213> Oryza sativa

<400> 3

atgctgcgcg cttgcggcgg cgcgtcgccg gcggcggcgg cggcggcggt gcccgcgctc 60

gtcagggcgc gcctcgcgaa gcaggcctcc tccgcagccc acgcggccgc caccgccacc 120

gcctccgctt cctcctccct ctccgcgctg ggagaggtcg ccgccgggcg caaaggtcta 180

gtctagtctc tgcggcattt tgccgaacgg ctgtcggtcg cgccgcgaaa gtgtcctctc 240

ccatcttgct tcttctgatt acgcggcgaa accgctcgcg ccatggcggt tgcttgcgct 300

tgcggaaatg ctcaagtgga ttgtggctgc atttacctgc gacgctgcag ttcgttcttg 360

ttgagtggct gacattgatc cactcatcgt ttgattcacc tgtaactgta accagtaatc 420

attaatatct attgttaatt gtagctgact tccagaagca tatttgcttt gttgaaacta 480

attgtatgag aagcgaggtt ttgtgtagag atgtgcctaa tcattgctct atagaactaa 540

taggttggtc ctcattaacc ctctagagtc aggggttagc aattctctag agtttttttt 600

cctttcggca taatgcagag tactctggtg ttgcattatc cataattata ccgttctgta 660

cagtaagtat tatgaagtgg tgatagtcct cttatgtcaa aaatagtttt atgtctccta 720

gagatggctc ataattagtt ttggaagttt taaatcatta taatgcctaa gcacaaagtg 780

gagttgaatt ttccaattgg aatgcattgt ctatttgttg tctagatctc tcttgtattg 840

tcaaactgga aataaagcat agctgattct tccttttttg ggttaataat aggctatggt 900

taggagctac tagacttgga ggctggaatc tttttttttt ctttcacttg agttgacata 960

aagactaact tcaaacattt tttttaggtt tggcaagagt agtattaaag aaaggaaaga 1020

cccaaatatt tcgagatggg agtccgatgg tgtatagtgg tgctgttgat agaataattg 1080

gtcgacctcc tccaaaaact ggtgatgttg ttcttgtagc tgatggggca gagaaaccta 1140

ttggatgggg tctctataac tctgtgtcca tgttttgtgt tcggctgatg caactagaag 1200

aagaggcaaa aaggtgacaa ggtcacaagt tgaagttctc tgtttacaga caatttgaga 1260

acatggccta atattttccc tatttttttt gtttacaggg atccaacatg tgcactaaat 1320

atggaaagac tgcttgaggc aaggatttta tctgctgtgg atttacggcg cagtttaggt 1380

ctcccttcag ttcacacaaa tgcttatcgt ctcatcaaca gtgaagggga caggtatata 1440

ttattcttga gtctcgactt atgttatatg gtcaaggtca ccaaaggtac catgtcaaga 1500

tcaatcatca caagaagtgt aatcagtgca gaactatttg gacttctagt tctagagtat 1560

atttgacctc caaaatccaa attgcattgt tccaatatat tcgcacgaag aataattttt 1620

attattgttt tgaaatgcag attgtctggt ctaatagtgg atatctttgc tgatgttgct 1680

gtagttgctt catctgctgc ttgggttgag aaatataggc atgaaatcca gttccttgtt 1740

aacaaagtca gtgatgtgaa ccatataaag tggagatcat caacagatat tctaaaagaa 1800

gaaggattag atgtatcaga acaaaaggat cctgaatcgt cttcacactg tggaacagtg 1860

gaggtgaacc aacttagtaa ttattgaaac aaagccatta aatttggttt acctttatta 1920

ctaatttcaa gagagagatg gcattcatgc actctattca gcacatcaat cagcttggtt 1980

tttcagattt gacaatcttt tcttcttcct atgttatgtt gcctgttgtt ccaacacctc 2040

tcaattgctg ctcttacttt caggtcatgg agaatgatgt tctctatcta gtctcattgg 2100

aggggcagaa aacagggttt tatgcagatc aacgtgagaa ccgtcatttc atatcaacac 2160

tctcaaagga ccaaagggtt cttgatctgt gctgctatag tggtggtttt gctctaaatg 2220

cagcaaaggg tggtgctaat aatgtcattg gtataatacc atatgctagc gaacctttta 2280

gtcctttgtt gatcttttca tatgcgtcaa ttgttcaatt gaatcattga tcatgaaacc 2340

cacaaaagag tataacatta tacatgtttg gctgctaagg aaaatataat tagtgtatcc 2400

tttttcaggc attgattcat cagcatcagc actagacctt gccaataaga atattatcct 2460

gaataagctt gacacccaaa ggatttcgtt tgtaaaagaa gatgcgactg cattcatgaa 2520

aggtgctatc tcaagaaatg aggtctggga cttggtaatc cttgatcctc caaagttggc 2580

acctcgaaaa aaggtaagca tacaatagag catttaccat tagtctctaa tttgacttca 2640

aatgagatat cttttcatcc atggatctga agtggcaaag aatgttacat atccagcagt 2700

tcgcgaatct tcgatttctt atcagaagac acccaaagta ccctttagca tatgaacatc 2760

agttagcttc tttggctggt tgaccctagt ttactgttag tacataatcc atttggccct 2820

atataatcat gtctgttgaa gcatctgtat aagttcattg agggtttcca atcaataaaa 2880

tggaaagtgt gcagcagaat tttgaatcat agtattttgc ttcaaaagaa ataaagaaat 2940

taagtaagga gcatgtctta gatataccta ttttagagga agtcatgcgc tttatgggta 3000

cttaaaactt tagatgggtg aacaagtcaa atagaacctc tttataagac cagacggaat 3060

caaatagaac ctctttataa gaccagacgg aggatctggt tccagtttac caggtgttta 3120

ccagaagcaa aaaaccattg gttttctgaa acttgagctt gctagtgctc tacttttagt 3180

aactgcttcg attattatct gtcctgttgt atttaggtgc tacaaagtgc ctcgggtatg 3240

tacagaagct tgaacgctct tgcgatgcaa gtggtaaagc caggggggtt actcatgaca 3300

tgctcatgct ctggagctat gacccaaagc ggcctcttcc tcagaaccat tcaggtatgt 3360

cttttgatca tgttgcataa ccaagtaatc agcatacacc ttgtcaccca tatgtatcca 3420

agcaactaac accttatagt aacaataaca tcaattgaaa ggaacatcca ataatggtcc 3480

aatctaatta tttccagctt gacaaactgt aaacattcaa cagaaaaaaa attggacaaa 3540

acacaatgcc catatctagc ttccaactca agatttccct ttttttgggt agaaggtttg 3600

caatgtaaat tcatgcccca ttccagccgt catattggct ataggtccaa ggtggtaaaa 3660

ttgttttttt tttgtaatga tacatattgg attcaataat agtgttttac atcggaaatt 3720

gccatcaagt tatgcacatc gatgataaca ttatctcttt tgtttttaat ttcaagggtg 3780

ctgcatcaat gaccggccga aaggttacag ttctacgcca agcaggggca gcctgtgatc 3840

atcccgtaga tcctgcatac cctgaaggcc gatatctcag caattacttg ctccgagtga 3900

cctgaaggaa aaaaaaaaag gcttagaagc cttctactga ccaattaccg cacagcattt 3960

tcctaagagc tgatgctttg aagttatagt tcagtttcat ttcatttttt aagtcatact 4020

tgttagatca agaaactttc cgaaggaaag atgtatgatg atatagattt tgaagattat 4080

ttgttaattt ctagcgcaga tcattattta cccttgttga gattaacgtt tttaacactt 4140

ttttatatat ggaatatgga agatgtgtaa atcattcaca tggtg 4185

<210> 4

<211> 15898

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taaacgctct tttctcttag gtttacccgc caatatatcc tgtcaaacac tgatagttta 60

aactgaaggc gggaaacgac aatctgatcc aagctcaagc tgctctagca ttcgccattc 120

aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 180

gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 240

cgacgttgta aaacgacggc cagtgccaag cttggatcat gaaccaacgg cctggctgta 300

tttggtggtt gtgtagggag atggggagaa gaaaagcccg attctcttcg ctgtgatggg 360

ctggatgcat gcgggggagc gggaggccca agtacgtgca cggtgagcgg cccacagggc 420

gagtgtgagc gcgagaggcg ggaggaacag tttagtacca cattgcccag ctaactcgaa 480

cgcgaccaac ttataaaccc gcgcgctgtc gcttgtgtcc gggcgcaaag gtctagtcgt 540

tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg 600

caccgagtcg gtgctttttt gttttagagc tagaaatagc aagttaaaat aaggctagtc 660

cgtagcgcgt gcgccaattc tgcagacaaa tggccccggg cctgcaggtg cagcgtgacc 720

cggtcgtgcc cctctctaga gataatgagc attgcatgtc taagttataa aaaattacca 780

catatttttt ttgtcacact tgtttgaagt gcagtttatc tatctttata catatattta 840

aactttactc tacgaataat ataatctata gtactacaat aatatcagtg ttttagagaa 900

tcatataaat gaacagttag acatggtcta aaggacaatt gagtattttg acaacaggac 960

tctacagttt tatcttttta gtgtgcatgt gttctccttt ttttttgcaa atagcttcac 1020

ctatataata cttcatccat tttattagta catccattta gggtttaggg ttaatggttt 1080

ttatagacta atttttttag tacatctatt ttattctatt ttagcctcta aattaagaaa 1140

actaaaactc tattttagtt tttttattta ataatttaga tataaaatag aataaaataa 1200

agtgactaaa aattaaacaa atacccttta agaaattaaa aaaactaagg aaacattttt 1260

cttgtttcga gtagataatg ccagcctgtt aaacgccgtc gacgagtcta acggacacca 1320

accagcgaac cagcagcgtc gcgtcgggcc aagcgaagca gacggcacgg catctctgtc 1380

gctgcctctg gacccctctc gagagttccg ctccaccgtt ggacttgctc cgctgtcggc 1440

atccagaaat tgcgtggcgg agcggcagac gtgagccggc acggcaggcg gcctcctcct 1500

cctctcacgg cacggcagct acgggggatt cctttcccac cgctccttcg ctttcccttc 1560

ctcgcccgcc gtaataaata gacaccccct ccacaccctc tttccccaac ctcgtgttgt 1620

tcggagcgca cacacacaca accagatctc ccccaaatcc acccgtcggc acctccgctt 1680

caaggtacgc cgctcgtcct cccccccccc ccctctctac cttctctaga tcggcgttcc 1740

ggtccatggt tagggcccgg tagttctact tctgttcatg tttgtgttag atccgtgttt 1800

gtgttagatc cgtgctgcta gcgttcgtac acggatgcga cctgtacgtc agacacgttc 1860

tgattgctaa cttgccagtg tttctctttg gggaatcctg ggatggctct agccgttccg 1920

cagacgggat cgatttcatg attttttttg tttcgttgca tagggtttgg tttgcccttt 1980

tcctttattt caatatatgc cgtgcacttg tttgtcgggt catcttttca tgcttttttt 2040

tgtcttggtt gtgatgatgt ggtctggttg ggcggtcgtt ctagatcgga gtagaattct 2100

gtttcaaact acctggtgga tttattaatt ttggatctgt atgtgtgtgc catacatatt 2160

catagttacg aattgaagat gatggatgga aatatcgatc taggataggt atacatgttg 2220

atgcgggttt tactgatgca tatacagaga tgctttttgt tcgcttggtt gtgatgatgt 2280

ggtgtggttg ggcggtcgtt cattcgttct agatcggagt agaatactgt ttcaaactac 2340

ctggtgtatt tattaatttt ggaactgtat gtgtgtgtca tacatcttca tagttacgag 2400

tttaagatgg atggaaatat cgatctagga taggtataca tgttgatgtg ggttttactg 2460

atgcatatac atgatggcat atgcagcatc tattcatatg ctctaacctt gagtacctat 2520

ctattataat aaacaagtat gttttataat tattttgatc ttgatatact tggatgatgg 2580

catatgcagc agctatatgt ggattttttt agccctgcct tcatacgcta tttatttgct 2640

tggtactgtt tcttttgtcg atgctcaccc tgttgtttgg tgttacttct gcagccatgg 2700

actataagga ccacgacgga gactacaagg atcatgatat tgattacaaa gacgatgacg 2760

ataagatggc cccaaagaag aagcggaagg tcggtatcca cggagtccca gcagccgaca 2820

agaagtacag catcggcctg gacatcggca ccaactctgt gggctgggcc gtgatcaccg 2880

acgagtacaa ggtgcccagc aagaaattca aggtgctggg caacaccgac cggcacagca 2940

tcaagaagaa cctgatcgga gccctgctgt tcgacagcgg cgaaacagcc gaggccaccc 3000

ggctgaagag aaccgccaga agaagataca ccagacggaa gaaccggatc tgctatctgc 3060

aagagatctt cagcaacgag atggccaagg tggacgacag cttcttccac agactggaag 3120

agtccttcct ggtggaagag gataagaagc acgagcggca ccccatcttc ggcaacatcg 3180

tggacgaggt ggcctaccac gagaagtacc ccaccatcta ccacctgaga aagaaactgg 3240

tggacagcac cgacaaggcc gacctgcggc tgatctatct ggccctggcc cacatgatca 3300

agttccgggg ccacttcctg atcgagggcg acctgaaccc cgacaacagc gacgtggaca 3360

agctgttcat ccagctggtg cagacctaca accagctgtt cgaggaaaac cccatcaacg 3420

ccagcggcgt ggacgccaag gccatcctgt ctgccagact gagcaagagc agacggctgg 3480

aaaatctgat cgcccagctg cccggcgaga agaagaatgg cctgttcgga aacctgattg 3540

ccctgagcct gggcctgacc cccaacttca agagcaactt cgacctggcc gaggatgcca 3600

aactgcagct gagcaaggac acctacgacg acgacctgga caacctgctg gcccagatcg 3660

gcgaccagta cgccgacctg tttctggccg ccaagaacct gtccgacgcc atcctgctga 3720

gcgacatcct gagagtgaac accgagatca ccaaggcccc cctgagcgcc tctatgatca 3780

agagatacga cgagcaccac caggacctga ccctgctgaa agctctcgtg cggcagcagc 3840

tgcctgagaa gtacaaagag attttcttcg accagagcaa gaacggctac gccggctaca 3900

ttgacggcgg agccagccag gaagagttct acaagttcat caagcccatc ctggaaaaga 3960

tggacggcac cgaggaactg ctcgtgaagc tgaacagaga ggacctgctg cggaagcagc 4020

ggaccttcga caacggcagc atcccccacc agatccacct gggagagctg cacgccattc 4080

tgcggcggca ggaagatttt tacccattcc tgaaggacaa ccgggaaaag atcgagaaga 4140

tcctgacctt ccgcatcccc tactacgtgg gccctctggc caggggaaac agcagattcg 4200

cctggatgac cagaaagagc gaggaaacca tcaccccctg gaacttcgag gaagtggtgg 4260

acaagggcgc ttccgcccag agcttcatcg agcggatgac caacttcgat aagaacctgc 4320

ccaacgagaa ggtgctgccc aagcacagcc tgctgtacga gtacttcacc gtgtataacg 4380

agctgaccaa agtgaaatac gtgaccgagg gaatgagaaa gcccgccttc ctgagcggcg 4440

agcagaaaaa ggccatcgtg gacctgctgt tcaagaccaa ccggaaagtg accgtgaagc 4500

agctgaaaga ggactacttc aagaaaatcg agtgcttcga ctccgtggaa atctccggcg 4560

tggaagatcg gttcaacgcc tccctgggca cataccacga tctgctgaaa attatcaagg 4620

acaaggactt cctggacaat gaggaaaacg aggacattct ggaagatatc gtgctgaccc 4680

tgacactgtt tgaggacaga gagatgatcg aggaacggct gaaaacctat gcccacctgt 4740

tcgacgacaa agtgatgaag cagctgaagc ggcggagata caccggctgg ggcaggctga 4800

gccggaagct gatcaacggc atccgggaca agcagtccgg caagacaatc ctggatttcc 4860

tgaagtccga cggcttcgcc aacagaaact tcatgcagct gatccacgac gacagcctga 4920

cctttaaaga ggacatccag aaagcccagg tgtccggcca gggcgatagc ctgcacgagc 4980

acattgccaa tctggccggc agccccgcca ttaagaaggg catcctgcag acagtgaagg 5040

tggtggacga gctcgtgaaa gtgatgggcc ggcacaagcc cgagaacatc gtgatcgaaa 5100

tggccagaga gaaccagacc acccagaagg gacagaagaa cagccgcgag agaatgaagc 5160

ggatcgaaga gggcatcaaa gagctgggca gccagatcct gaaagaacac cccgtggaaa 5220

acacccagct gcagaacgag aagctgtacc tgtactacct gcagaatggg cgggatatgt 5280

acgtggacca ggaactggac atcaaccggc tgtccgacta cgatgtggac catatcgtgc 5340

ctcagagctt tctgaaggac gactccatcg acaacaaggt gctgaccaga agcgacaaga 5400

accggggcaa gagcgacaac gtgccctccg aagaggtcgt gaagaagatg aagaactact 5460

ggcggcagct gctgaacgcc aagctgatta cccagagaaa gttcgacaat ctgaccaagg 5520

ccgagagagg cggcctgagc gaactggata aggccggctt catcaagaga cagctggtgg 5580

aaacccggca gatcacaaag cacgtggcac agatcctgga ctcccggatg aacactaagt 5640

acgacgagaa tgacaagctg atccgggaag tgaaagtgat caccctgaag tccaagctgg 5700

tgtccgattt ccggaaggat ttccagtttt acaaagtgcg cgagatcaac aactaccacc 5760

acgcccacga cgcctacctg aacgccgtcg tgggaaccgc cctgatcaaa aagtacccta 5820

agctggaaag cgagttcgtg tacggcgact acaaggtgta cgacgtgcgg aagatgatcg 5880

ccaagagcga gcaggaaatc ggcaaggcta ccgccaagta cttcttctac agcaacatca 5940

tgaacttttt caagaccgag attaccctgg ccaacggcga gatccggaag cggcctctga 6000

tcgagacaaa cggcgaaacc ggggagatcg tgtgggataa gggccgggat tttgccaccg 6060

tgcggaaagt gctgagcatg ccccaagtga atatcgtgaa aaagaccgag gtgcagacag 6120

gcggcttcag caaagagtct atcctgccca agaggaacag cgataagctg atcgccagaa 6180

agaaggactg ggaccctaag aagtacggcg gcttcgacag ccccaccgtg gcctattctg 6240

tgctggtggt ggccaaagtg gaaaagggca agtccaagaa actgaagagt gtgaaagagc 6300

tgctggggat caccatcatg gaaagaagca gcttcgagaa gaatcccatc gactttctgg 6360

aagccaaggg ctacaaagaa gtgaaaaagg acctgatcat caagctgcct aagtactccc 6420

tgttcgagct ggaaaacggc cggaagagaa tgctggcctc tgccggcgaa ctgcagaagg 6480

gaaacgaact ggccctgccc tccaaatatg tgaacttcct gtacctggcc agccactatg 6540

agaagctgaa gggctccccc gaggataatg agcagaaaca gctgtttgtg gaacagcaca 6600

agcactacct ggacgagatc atcgagcaga tcagcgagtt ctccaagaga gtgatcctgg 6660

ccgacgctaa tctggacaaa gtgctgtccg cctacaacaa gcaccgggat aagcccatca 6720

gagagcaggc cgagaatatc atccacctgt ttaccctgac caatctggga gcccctgccg 6780

ccttcaagta ctttgacacc accatcgacc ggaagaggta caccagcacc aaagaggtgc 6840

tggacgccac cctgatccac cagagcatca ccggcctgta cgagacacgg atcgacctgt 6900

ctcagctggg aggcgacaaa aggccggcgg ccacgaaaaa ggccggccag gcaaaaaaga 6960

aaaagtaagg atcctgattg atcgatagag ctcgaatttc cccgatcgtt caaacatttg 7020

gcaataaagt ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt 7080

tctgttgaat tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag 7140

atgggttttt atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat 7200

atagcgcgca aactaggata aattatcgcg cgcggtgtca tctatgttac tagatcggga 7260

attcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc acaattccac 7320

acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga gtgagctaac 7380

tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc 7440

tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggc tagagcagct 7500

tgccaacatg gtggagcacg acactctcgt ctactccaag aatatcaaag atacagtctc 7560

agaagaccaa agggctattg agacttttca acaaagggta atatcgggaa acctcctcgg 7620

attccattgc ccagctatct gtcacttcat caaaaggaca gtagaaaagg aaggtggcac 7680

ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt caagatgcct ctgccgacag 7740

tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag acgttccaac 7800

cacgtcttca aagcaagtgg attgatgtga taacatggtg gagcacgaca ctctcgtcta 7860

ctccaagaat atcaaagata cagtctcaga agaccaaagg gctattgaga cttttcaaca 7920

aagggtaata tcgggaaacc tcctcggatt ccattgccca gctatctgtc acttcatcaa 7980

aaggacagta gaaaaggaag gtggcaccta caaatgccat cattgcgata aaggaaaggc 8040

tatcgttcaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac ccacgaggag 8100

catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt gatgtgatat 8160

ctccactgac gtaagggatg acgcacaatc ccactatcct tcgcaagacc ttcctctata 8220

taaggaagtt catttcattt ggagaggaca cgctgaaatc accagtctct ctctacaaat 8280

ctatctctct cgagctttcg cagatcccgg ggggcaatga gatatgaaaa agcctgaact 8340

caccgcgacg tctgtcgaga agtttctgat cgaaaagttc gacagcgtct ccgacctgat 8400

gcagctctcg gagggcgaag aatctcgtgc tttcagcttc gatgtaggag ggcgtggata 8460

tgtcctgcgg gtaaatagct gcgccgatgg tttctacaaa gatcgttatg tttatcggca 8520

ctttgcatcg gccgcgctcc cgattccgga agtgcttgac attggggagt ttagcgagag 8580

cctgacctat tgcatctccc gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac 8640

cgaactgccc gctgttctac aaccggtcgc ggaggctatg gatgcgatcg ctgcggccga 8700

tcttagccag acgagcgggt tcggcccatt cggaccgcaa ggaatcggtc aatacactac 8760

atggcgtgat ttcatatgcg cgattgctga tccccatgtg tatcactggc aaactgtgat 8820

ggacgacacc gtcagtgcgt ccgtcgcgca ggctctcgat gagctgatgc tttgggccga 8880

ggactgcccc gaagtccggc acctcgtgca cgcggatttc ggctccaaca atgtcctgac 8940

ggacaatggc cgcataacag cggtcattga ctggagcgag gcgatgttcg gggattccca 9000

atacgaggtc gccaacatct tcttctggag gccgtggttg gcttgtatgg agcagcagac 9060

gcgctacttc gagcggaggc atccggagct tgcaggatcg ccacgactcc gggcgtatat 9120

gctccgcatt ggtcttgacc aactctatca gagcttggtt gacggcaatt tcgatgatgc 9180

agcttgggcg cagggtcgat gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg 9240

tacacaaatc gcccgcagaa gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc 9300

cgatagtgga aaccgacgcc ccagcactcg tccgagggca aagaaataga gtagatgccg 9360

accggatctg tcgatcgaca agctcgagtt tctccataat aatgtgtgag tagttcccag 9420

ataagggaat tagggttcct atagggtttc gctcatgtgt tgagcatata agaaaccctt 9480

agtatgtatt tgtatttgta aaatacttct atcaataaaa tttctaattc ctaaaaccaa 9540

aatccagtac taaaatccag atcccccgaa ttaattcggc gttaattcag tacattaaaa 9600

acgtccgcaa tgtgttatta agttgtctaa gcgtcaattt gtttacacca caatatatcc 9660

tgccaccagc cagccaacag ctccccgacc ggcagctcgg cacaaaatca ccactcgata 9720

caggcagccc atcagtccgg gacggcgtca gcgggagagc cgttgtaagg cggcagactt 9780

tgctcatgtt accgatgcta ttcggaagaa cggcaactaa gctgccgggt ttgaaacacg 9840

gatgatctcg cggagggtag catgttgatt gtaacgatga cagagcgttg ctgcctgtga 9900

tcaccgcggt ttcaaaatcg gctccgtcga tactatgtta tacgccaact ttgaaaacaa 9960

ctttgaaaaa gctgttttct ggtatttaag gttttagaat gcaaggaaca gtgaattgga 10020

gttcgtcttg ttataattag cttcttgggg tatctttaaa tactgtagaa aagaggaagg 10080

aaataataaa tggctaaaat gagaatatca ccggaattga aaaaactgat cgaaaaatac 10140

cgctgcgtaa aagatacgga aggaatgtct cctgctaagg tatataagct ggtgggagaa 10200

aatgaaaacc tatatttaaa aatgacggac agccggtata aagggaccac ctatgatgtg 10260

gaacgggaaa aggacatgat gctatggctg gaaggaaagc tgcctgttcc aaaggtcctg 10320

cactttgaac ggcatgatgg ctggagcaat ctgctcatga gtgaggccga tggcgtcctt 10380

tgctcggaag agtatgaaga tgaacaaagc cctgaaaaga ttatcgagct gtatgcggag 10440

tgcatcaggc tctttcactc catcgacata tcggattgtc cctatacgaa tagcttagac 10500

agccgcttag ccgaattgga ttacttactg aataacgatc tggccgatgt ggattgcgaa 10560

aactgggaag aagacactcc atttaaagat ccgcgcgagc tgtatgattt tttaaagacg 10620

gaaaagcccg aagaggaact tgtcttttcc cacggcgacc tgggagacag caacatcttt 10680

gtgaaagatg gcaaagtaag tggctttatt gatcttggga gaagcggcag ggcggacaag 10740

tggtatgaca ttgccttctg cgtccggtcg atcagggagg atatcgggga agaacagtat 10800

gtcgagctat tttttgactt actggggatc aagcctgatt gggagaaaat aaaatattat 10860

attttactgg atgaattgtt ttagtaccta gaatgcatga ccaaaatccc ttaacgtgag 10920

ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 10980

ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 11040

tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 11100

cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct 11160

gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 11220

gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 11280

tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 11340

ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg 11400

gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 11460

ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 11520

tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 11580

ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct 11640

gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga 11700

acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcctgat gcggtatttt 11760

ctccttacgc atctgtgcgg tatttcacac cgcatatggt gcactctcag tacaatctgc 11820

tctgatgccg catagttaag ccagtataca ctccgctatc gctacgtgac tgggtcatgg 11880

ctgcgccccg acacccgcca acacccgctg acgcgccctg acgggcttgt ctgctcccgg 11940

catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag aggttttcac 12000

cgtcatcacc gaaacgcgcg aggcagggtg ccttgatgtg ggcgccggcg gtcgagtggc 12060

gacggcgcgg cttgtccgcg ccctggtaga ttgcctggcc gtaggccagc catttttgag 12120

cggccagcgg ccgcgatagg ccgacgcgaa gcggcggggc gtagggagcg cagcgaccga 12180

agggtaggcg ctttttgcag ctcttcggct gtgcgctggc cagacagtta tgcacaggcc 12240

aggcgggttt taagagtttt aataagtttt aaagagtttt aggcggaaaa atcgcctttt 12300

ttctctttta tatcagtcac ttacatgtgt gaccggttcc caatgtacgg ctttgggttc 12360

ccaatgtacg ggttccggtt cccaatgtac ggctttgggt tcccaatgta cgtgctatcc 12420

acaggaaaga gtccttttcg acctttttcc cctgctaggg caatttgccc tagcatctgc 12480

tccgtacatt aggaaccggc ggatgcttcg ccctcgatca ggttgcggta gcgcatgact 12540

aggatcgggc cagcctgccc cgcctcctcc ttcaaatcgt actccggcag gtcatttgac 12600

ccgatcagct tgcgcacggt gaaacagaac ttcttgaact ctccggcgct gccactgcgt 12660

tcgtagatcg tcttgaacaa ccatctggct tctgccttgc ctgcggcgcg gcgtgccagg 12720

cggtagagaa aacggccgat gccgggatcg atcaaaaagt aatcggggtg aaccgtcagc 12780

acgtccgggt tcttgccttc tgtgatctcg cggtacatcc aatcagctag ctcgatctcg 12840

atgtactccg gccgcccggt ttcgctcttt acgatcttgt agcggctaat caaggcttca 12900

ccctcggata ccgtcaccag gcggccgttc ttggccttct tcgtacgctg catggcaacg 12960

tgcgtggtgt ttaaccgaat gcaggtttct accaggtcgt ctttctgctt tccgccatcg 13020

gctcgccggc agaacttgag tacgtccgca acgtgtggac ggaacacgcg gccgggcttg 13080

tctcccttcc cttcccggta tcggttcatg gattcggtta gatgggaaac cgccatcagt 13140

accaggtcgt aatcccacac actggccatg ccggccggcc ctgcggaaac ctctacgtgc 13200

ccgtctggaa gctcgtagcg gatcacctcg ccagctcgtc ggtcacgctt cgacagacgg 13260

aaaacggcca cgtccatgat gctgcgacta tcgcgggtgc ccacgtcata gagcatcgga 13320

acgaaaaaat ctggttgctc gtcgcccttg ggcggcttcc taatcgacgg cgcaccggct 13380

gccggcggtt gccgggattc tttgcggatt cgatcagcgg ccgcttgcca cgattcaccg 13440

gggcgtgctt ctgcctcgat gcgttgccgc tgggcggcct gcgcggcctt caacttctcc 13500

accaggtcat cacccagcgc cgcgccgatt tgtaccgggc cggatggttt gcgaccgtca 13560

cgccgattcc tcgggcttgg gggttccagt gccattgcag ggccggcaga caacccagcc 13620

gcttacgcct ggccaaccgc ccgttcctcc acacatgggg cattccacgg cgtcggtgcc 13680

tggttgttct tgattttcca tgccgcctcc tttagccgct aaaattcatc tactcattta 13740

ttcatttgct catttactct ggtagctgcg cgatgtattc agatagcagc tcggtaatgg 13800

tcttgccttg gcgtaccgcg tacatcttca gcttggtgtg atcctccgcc ggcaactgaa 13860

agttgacccg cttcatggct ggcgtgtctg ccaggctggc caacgttgca gccttgctgc 13920

tgcgtgcgct cggacggccg gcacttagcg tgtttgtgct tttgctcatt ttctctttac 13980

ctcattaact caaatgagtt ttgatttaat ttcagcggcc agcgcctgga cctcgcgggc 14040

agcgtcgccc tcgggttctg attcaagaac ggttgtgccg gcggcggcag tgcctgggta 14100

gctcacgcgc tgcgtgatac gggactcaag aatgggcagc tcgtacccgg ccagcgcctc 14160

ggcaacctca ccgccgatgc gcgtgccttt gatcgcccgc gacacgacaa aggccgcttg 14220

tagccttcca tccgtgacct caatgcgctg cttaaccagc tccaccaggt cggcggtggc 14280

ccatatgtcg taagggcttg gctgcaccgg aatcagcacg aagtcggctg ccttgatcgc 14340

ggacacagcc aagtccgccg cctggggcgc tccgtcgatc actacgaagt cgcgccggcc 14400

gatggccttc acgtcgcggt caatcgtcgg gcggtcgatg ccgacaacgg ttagcggttg 14460

atcttcccgc acggccgccc aatcgcgggc actgccctgg ggatcggaat cgactaacag 14520

aacatcggcc ccggcgagtt gcagggcgcg ggctagatgg gttgcgatgg tcgtcttgcc 14580

tgacccgcct ttctggttaa gtacagcgat aaccttcatg cgttcccctt gcgtatttgt 14640

ttatttactc atcgcatcat atacgcagcg accgcatgac gcaagctgtt ttactcaaat 14700

acacatcacc tttttagacg gcggcgctcg gtttcttcag cggccaagct ggccggccag 14760

gccgccagct tggcatcaga caaaccggcc aggatttcat gcagccgcac ggttgagacg 14820

tgcgcgggcg gctcgaacac gtacccggcc gcgatcatct ccgcctcgat ctcttcggta 14880

atgaaaaacg gttcgtcctg gccgtcctgg tgcggtttca tgcttgttcc tcttggcgtt 14940

cattctcggc ggccgccagg gcgtcggcct cggtcaatgc gtcctcacgg aaggcaccgc 15000

gccgcctggc ctcggtgggc gtcacttcct cgctgcgctc aagtgcgcgg tacagggtcg 15060

agcgatgcac gccaagcagt gcagccgcct ctttcacggt gcggccttcc tggtcgatca 15120

gctcgcgggc gtgcgcgatc tgtgccgggg tgagggtagg gcgggggcca aacttcacgc 15180

ctcgggcctt ggcggcctcg cgcccgctcc gggtgcggtc gatgattagg gaacgctcga 15240

actcggcaat gccggcgaac acggtcaaca ccatgcggcc ggccggcgtg gtggtgtcgg 15300

cccacggctc tgccaggcta cgcaggcccg cgccggcctc ctggatgcgc tcggcaatgt 15360

ccagtaggtc gcgggtgctg cgggccaggc ggtctagcct ggtcactgtc acaacgtcgc 15420

cagggcgtag gtggtcaagc atcctggcca gctccgggcg gtcgcgcctg gtgccggtga 15480

tcttctcgga aaacagcttg gtgcagccgg ccgcgtgcag ttcggcccgt tggttggtca 15540

agtcctggtc gtcggtgctg acgcgggcat agcccagcag gccagcggcg gcgctcttgt 15600

tcatggcgta atgtctccgg ttctagtcgc aagtattcta ctttatgcga ctaaaacacg 15660

cgacaagaaa acgccaggaa aagggcaggg cggcagcctg tcgcgtaact taggacttgt 15720

gcgacatgtc gttttcagaa gacggctgca ctgaacgtca gaagccgact gcactatagc 15780

agcggagggg ttggatcaaa gtactttgat cccgagggga accctgtggt tggcatgcac 15840

atacaaatgg acgaacggat aaaccttttc acgccctttt aaatatccgt tattctaa 15898

<210> 5

<211> 96

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccgggcgcaa aggtctagtc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 6

<211> 96

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccgggcgcaa aggucuaguc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugc 96

<210> 7

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccgggcgcaa aggucuaguc 20

Claims (10)

1, OsR5BP1 protein in regulating and controlling plant stress tolerance;

the OsR5BP1 protein is (a1) or (a2) or (a3) or (a 4):

(a1) protein shown as a sequence 1 in a sequence table;

(a2) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);

(a3) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues in (a1) and related to the stress tolerance and/or the growth performance and/or the production performance of plants;

(a4) a protein derived from rice, having 98% or more identity to (a1), and being involved in stress tolerance, growth performance and/or productivity of plants.

2, OsR5BP1 protein or its coding gene as the suppression target in plant breeding; the plant breeding aims at cultivating plants with enhanced stress tolerance; the OsR5BP1 protein is the OsR5BP1 protein described in claim 1.

3. The application of a substance inhibiting OsR5BP1 gene and/or a substance inhibiting OsR5BP1 protein in plant breeding; the plant breeding aims at cultivating plants with enhanced stress tolerance; the OsR5BP1 protein is the OsR5BP1 protein of claim 1; the OsR5BP1 gene is a gene which codes for the OsR5BP1 protein.

4. A plant breeding method for breeding a plant with enhanced stress tolerance, comprising the steps of: carrying out gene editing on OsR5BP1 gene in a receptor plant to obtain a gene editing plant; (ii) an increased stress tolerance of the gene-edited plant as compared to the recipient plant; the OsR5BP1 gene is a gene coding OsR5BP1 protein, and the OsR5BP1 protein is OsR5BP1 protein as claimed in claim 1.

5. A method of making a plant with enhanced stress tolerance comprising the steps of: replacing "CCGGGCGCAAAGGTCTAGTC" in OsR5BP1 gene in plant genome DNA by "CCGAGGCGCAAAGGTCTAGTC" or "CCGGCGCAAAGGTCTAGTC" to obtain a plant with enhanced stress tolerance; the OsR5BP1 gene is a gene coding OsR5BP1 protein, and the OsR5BP1 protein is OsR5BP1 protein as claimed in claim 1.

6, OsR5BP1 protein in regulating and controlling the growth performance and/or production performance of plants; the OsR5BP1 protein is the OsR5BP1 protein described in claim 1.

7, OsR5BP1 protein or its coding gene as the suppression target in the plant breeding application; the goal of plant breeding is to cultivate plants with improved growth performance and/or improved production performance; the OsR5BP1 protein is the OsR5BP1 protein described in claim 1.

8. The application of a substance inhibiting OsR5BP1 gene and/or a substance inhibiting OsR5BP1 protein in plant breeding; the goal of plant breeding is to cultivate plants with improved growth performance and/or improved production performance; the OsR5BP1 protein is the OsR5BP1 protein described in claim 1; the OsR5BP1 gene is a gene which codes for the OsR5BP1 protein.

9. A plant breeding method for breeding plants with improved growth performance and/or improved production performance, comprising the steps of: carrying out gene editing on OsR5BP1 genes in a receptor plant to obtain a gene editing plant; an increase in growth performance and/or an increase in production performance of the gene-edited plant as compared to the recipient plant; the OsR5BP1 gene is a gene coding OsR5BP1 protein, and the OsR5BP1 protein is OsR5BP1 protein as claimed in claim 1.

10. A method of producing a plant with enhanced growth performance and/or enhanced production performance comprising the steps of: replacing "CCGGGCGCAAAGGTCTAGTC" in OsR5BP1 gene in plant genome DNA with "CCGAGGCGCAAAGGTCTAGTC" or "CCGGCGCAAAGGTCTAGTC" to obtain a plant with improved growth performance and/or improved production performance; the OsR5BP1 gene is a gene coding OsR5BP1 protein, and the OsR5BP1 protein is OsR5BP1 protein as claimed in claim 1.

Images