CN114540371B - Application of lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves - Google Patents
Application of lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves Download PDFInfo
- Publication number
- CN114540371B CN114540371B CN202210210201.9A CN202210210201A CN114540371B CN 114540371 B CN114540371 B CN 114540371B CN 202210210201 A CN202210210201 A CN 202210210201A CN 114540371 B CN114540371 B CN 114540371B
- Authority
- CN
- China
- Prior art keywords
- leaf
- lettuce
- gene
- lsnrl4
- angle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/20—Reduction of greenhouse gas [GHG] emissions in agriculture, e.g. CO2
- Y02P60/21—Dinitrogen oxide [N2O], e.g. using aquaponics, hydroponics or efficiency measures
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the technical field of plant engineering and discloses lettuceLsNRL4The application of the gene in controlling the green depth and leaf angle of lettuce leaves. The nucleotide sequence of the gene is shown as SEQ ID NO. 1. Knockout in "dark green leaf-leaflet included angle" lettuce by CRISPR-Cas9 technologyLsNRL4The results of the genes indicate that the function is lostLsNRL4The gene can change the receptor lettuce into a 'light green leaf-large leaf angle'. Transformation by Agrobacterium-mediated transformationLsNRL4The result from the gene to the lettuce with the 'light green leaf-big leaf included angle',LsNRL4the recipient lettuce can be changed into a 'dark green leaf-leaflet angle'.LsNRL4The cloning of the gene opens up a new direction for researching chloroplast development, chlorophyll synthesis and leaf angle regulation of plants, and simultaneously provides gene resources and theoretical guidance for variety breeding of lettuce.
Description
Technical Field
The invention belongs to the technical field of plant engineering, and particularly relates to application of a lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves.
Background
Lettuce (Lactuca sativa l.) is a plant of the genus Lactuca of the family compositae, native to the mediterranean region, an important vegetable crop in our country, and has very important economic value. Lettuce can be further classified into leaf lettuce (lactuca sativa Linn. Var. Ramosa Hort.) and stem lettuce (lactuca sativa Linn. Var. Angustata Irish ex Bremer) according to the different forms and eating sites. Lettuce has good taste and rich nutrition, is suitable for water planting and industrial planting, and is favored by growers and consumers. In 2017, the genome sequencing of the lettuce is completed, and convenience is provided for cloning and functional research of different agronomic trait genes of the lettuce.
Applicants found that the leaf green shade and leaf angle traits of a portion of lettuce varieties were controlled by the same locus. Genetic laws of green shade of lettuce leaves and genes controlling development and chlorophyll accumulation of lettuce chloroplasts are freshly reported. Zhang et al cloned a gene LsGLK controlling the green shade of lettuce leaves by genetic mapping, lsGLK being the first gene identified in lettuce to control the green shade trait of leaves, lsGLK could explain the 29.2% variation in chlorophyll content of lettuce (Zhang et al 2022), suggesting that there is an unknown gene involved in regulating the green shade trait of lettuce leaves.
The leaf angle has important significance on the plant type and yield of crops. Genetic rules of the leaf included angle of lettuce and genes for regulating the leaf included angle are not reported yet. In monocotyledonous plants, leaf angle is generally regulated by hormone-related genes such as auxin, cytokinin, brassinolide, etc., but leaf angle regulation networks in dicotyledonous plants are not clear. Therefore, cloning the gene for controlling the lettuce leaf included angle and analyzing the action mechanism has important theoretical and application values.
Disclosure of Invention
The invention aims to provide application of a lettuce LsNRL4 gene in controlling leaf green depth and leaf included angle traits, wherein a CDS sequence of the gene is shown as SEQ ID NO.2, and an encoded protein is shown as SEQ ID NO. 3.
In order to achieve the above object, the present invention adopts the following technical measures:
obtaining a lettuce leaf green shade and leaf angle character related gene LsNRL 4:
the invention obtains F by hybridization of lettuce with the included angle of dark green leaf and small leaf and lettuce with the included angle of light green leaf and large leaf 1 After the generation of hybrid seeds, further selfing to obtain F 2 And (5) generating a population. By F 2 And (3) locating genes for controlling the green depth and leaf included angle of lettuce leaves by combining a colony generation method, a BSR-seq method and a map cloning method. And carrying out gene annotation and candidate gene analysis on the positioning interval to determine candidate genes, and successfully cloning a key gene LsNRL4 for controlling the green depth and leaf angle size characters of lettuce leaves. Sequence analysis shows that the lettuce with the 'light green leaf-big leaf included angle' loses the gene, thereby causing the phenotypes of abnormal chloroplast development, reduced chlorophyll content, enlarged leaf inclusion angle and the like. LsNRL4 differs from its allele in that its sequence is lost in the lettuce genome. The white matter encoded by LsNRL4 gene is shown as SEQ ID NO.3, the CDS is shown as SEQ ID NO.2, and LsNRLThe full length of the 4 gene is shown as SEQ ID NO. 1.
The invention also aims at providing the genetic improvement of the green depth and the leaf included angle of the lettuce leaves and the application of the lettuce leaves in cultivation of new varieties; the method comprises the steps of expressing a gene corresponding to a protein shown in SEQ ID NO.3 in a 'light green leaf-big leaf included angle' lettuce by utilizing a conventional mode in the art, and changing the surface type of an obtained transgenic plant into a 'dark green leaf-small leaf included angle'; or the LsNRL4 is knocked out in the lettuce with the dark green leaf-small leaf included angle by means of mutation, knocking out or gene silencing and the like, and the phenotype of the obtained homozygous knocked-out transgenic plant is the dark green leaf-large leaf included angle.
The protection content of the invention also comprises: detecting nucleotide corresponding to the protein shown in SEQ ID NO.3 for screening or breeding lettuce;
preparing transgenic lettuce with a dark green leaf-small leaf included angle or a light green leaf-big leaf included angle by the nucleotide corresponding to the protein shown as SEQ ID NO.3 or the gene shown as SEQ ID NO. 1;
compared with the prior art, the invention has the following advantages:
the invention separates a gene for controlling the green depth and leaf angle of lettuce leaves for the first time, and has important theoretical significance for breeding lettuce and even other vegetables. Has important theoretical significance on the research on the regulation and control pathway of lettuce chloroplast development, chlorophyll synthesis and leaf angle. Furthermore, up to now, the LsNRL4 gene has never been reported to be involved in the leaf green shade and leaf angle size phenotype of any plant. The gene can provide new gene resources for lettuce in the genus of the family of the asteraceae, and is beneficial to cultivating new lettuce varieties.
Drawings
FIG. 1 is a schematic representation of the phenotypes of "dark green leaf-leaflet angle" lettuce (left) and "light green leaf-leaflet angle" lettuce (right), scale 10cm.
FIG. 2 is a schematic representation of a genetic locus at about 177.5Mb of chromosome IV of lettuce for controlling the green shade and leaf angle of lettuce leaves.
FIG. 3 shows that overexpression of LsNRL4 gene in "light green leaf-high leaf angle" lettuce can change its phenotype to "dark green leaf-low leaf angle", and that knockout of LsNRL4 gene in "dark green leaf-low leaf angle" lettuce can change its phenotype to "light green leaf-high leaf angle".
Wherein: (a) The LsNRL4 gene is over-expressed in the lettuce with the included angle of the light green leaves and the large leaves, so that a positive over-expression transgenic plant LsNRL4-OX#1 is obtained, and the surface type of LsNRL4-OX#1 is changed into the included angle of the light green leaves and the small leaves (left one and left two); knocking out LsNRL4 genes in the lettuce with the included angle of dark green leaves and small leaves to obtain a plant LsNRL4-KO#1 with the homozygous LsNRL4 genes knocked out, wherein the surface type of LsNRL4-KO#1 is changed into the included angle of light green leaves and large leaves (right two and right one); the scale is 10cm;
(b) T of transgenic plant LsNRL4-OX #1 1 Genotyping and phenotyping individual plants of the generation; dgsla represents the "dark green leaf-leaflet angle" phenotype; pglla stands for "light green leaf-large leaf angle" phenotype; the pore canal of the amplified band represents a plant containing an LsNRL4 transgene insert; the wells without amplified bands represent plants without LsNRL4 transgene insertion.
(c) Alignment of the nucleotide sequences of the plants homozygous for the LsNRL4 gene, lsNRL4-ko#1, lsNRL4-ko#2, with the LsNRL4 gene.
Detailed Description
The technical scheme of the invention is a conventional scheme in the field unless specifically stated; the reagents or materials, unless otherwise specified, are commercially available.
Example 1:
obtaining a lettuce LsNRL4 gene:
1. genetic analysis of lettuce leaf green depth and leaf included angle size characters
In order to analyze the genetic rule of the characters of the green depth and the leaf angle of the lettuce leaves, the invention adopts the hybridization of the lettuce S34 with the dark green leaf-small leaf angle and the lettuce S23 with the light green leaf-large leaf angle to obtain F 1 Hybrid of generation (Zhang et al 2017), F 1 F is obtained by selfing the hybrid seeds of the generation 2 And (5) generating a population. For F 2 Each individual in the generation population performs leaf green depth and leaf angle phenotype statistical analysis, and the result shows that all individuals with dark green leaves show small leaf angles,all individuals with pale green leaves showed large leaf angles, F 2 There were no other phenotypes in the generation population. It is demonstrated that in this population, the traits of lettuce leaf green shade and leaf angle size are controlled by one gene or multiple closely linked genes. Of the 94 individuals initially planted, 73 exhibited a "dark green leaf-leaflet angle" phenotype and 21 exhibited a "light green leaf-leaflet angle" phenotype, consistent with a mendelian genetic segregation ratio of 3:1 (χ) 2 ＝0.335<χ 2 (0.05,1)＝3.84，P>0.05). At this F 2 In the population, the phenotype of the 'light green leaf-large leaf included angle' is a recessive character.
Method of combining RNA-seq with BSA for F 2 And carrying out genetic analysis on the leaf green depth and leaf angle characters of the population. At F 2 In the separation group, 20 individuals with the included angle of dark green leaves and small leaves and 20 individuals with the included angle of light green leaves and large leaves are selected to respectively construct a mixing pool. RNA extraction and second generation sequencing analysis were performed on each of the two pools. The sequencing data were aligned to the lettuce reference genome (Lactuca sativa vs Salinas V) and delta (SNP-index) values were calculated for each SNP. The results show that there is a distinct site on chromosome 4 that controls the depth of leaf green and the magnitude of leaf angle.
Map-based cloning of the LsNRL4 Gene
To clone F described above 2 Genes for controlling green depth and leaf angle of lettuce leaves in population, a series of molecular markers are developed by using a map-based cloning method in the research, and F is used 2 The 3168 individuals in the population eventually localized the genes between AGH471 (177.262 Mb) and AGH498 (177.939 Mb), in the range of about 677 Kb. Annotation analysis was performed on the interval sequence, which codes for 9 genes in total, wherein the gene LG4398401 has a significant difference in expression levels in the two pools. LG4402589 encodes an ortholog of the arabidopsis NRL4 gene. Therefore, we have taken this gene as a candidate gene and named LsNRL4. DNA resequencing analysis shows that the lactuca sativa loses LsNRL4 gene (the gene sequence is shown as SEQ ID NO.1, the CDS sequence is shown as SEQ ID NO.2, and the amino acid sequence is shown as SEQ ID NO. 3), thereby leading to the leaf green and leaf included angle of the lactuca sativaIs changed to a "light green leaf-large leaf angle" phenotype.
Example 2:
application of LsNRL4 in regulation of green depth and leaf angle of lettuce leaves:
(1) The DNA of lettuce S34 with the included angle of dark green leaves and small leaves is used as a template, and a primer is used for: AGH553F atgaacag ctcctcattcctt and AGH553R ttaagaagtagatgatctccacct, the amplified target fragment is the sequence shown in SEQ ID NO.1, which is inserted into pRI101 plant expression vector (vector is linearized by EcoRI) by homologous recombination and transformed into "light green leaf-big leaf angle" lettuce under Agrobacterium mediation. Using transgene detection primers: M13F gtaaaacgacggccagt; AGH550F cacggtataaaccatcgtcc the transgenic plants were examined to obtain 3 transgenic plants in total, and the 3 transgenic plants all exhibited a phenotype of "dark green leaf-leaflet angle" (the phenotype of one transgenic plant LsNRL4-OX #1 is shown on the left two sides in FIG. 3 (a)). T for one of the transgenic lines 1 The generation phenotype and genotype analysis shows that the single plant with the transgene insertion shows a dark green leaf-small leaf included angle phenotype, while the single plant without the transgene insertion shows a light green leaf-large leaf included angle phenotype (fig. 3 (b)), which shows that the phenotype of the transgenic plant is separated from the transgene insertion fragment, and further verifies that LsNRL4 has the function of controlling the green depth and leaf included angle of lettuce leaves.
(2) The CRISPR-Cas9 technology is utilized to knock out the LsNRL4 gene in the lettuce S23 with the 'dark green leaf-small leaf included angle', and the gRNA sequence is as follows: aatggattcctgaactctc the gRNA and U6 promoter sequences were inserted by homologous recombination into the BsaI linearized CRISPR-Cas9 knockout vector pKSE401 (Tang et al 2018) and transformed into "deep green leaf-leaflet angle" lettuce under Agrobacterium mediation. Using transgene detection primers: U26F tgtcccaggattagaatgattaggc; and U29R agccctcttctttcgatccatcaac is used for detecting transgenic plants, and 2 homozygous knockout transgenic plants are obtained. Sanger sequencing analysis (fig. 3 (c)) was performed on the knockout event for each strain, and the mutant sequences obtained by sequencing were specifically:
Lsnrl4-KO#1：ccatcatcacacattacgcttccaaatggattcggcgaaccaccatcacctgtcgccccc
Lsnrl4-KO#2：ccatcatcacacattacgcttccaaatggattcctgacaccatcacctgtcgccccc
t for all 2 transgenic lines 1 The generation phenotype and genotype analysis shows that the single plant with the homozygous knockout of the LsNRL4 gene is expressed as a light green leaf-large leaf included angle phenotype, the single plant without knockout or heterozygous knockout of the LsNRL4 gene is expressed as a dark green leaf-small leaf included angle phenotype (the light green leaf-large leaf included angle phenotype of one transgenic plant Lsnrl4-KO#1 shown in the right part of the graph in the figure 3) shows that the LsNRL4 gene knockout event is separated from the leaf green depth and the leaf included angle, and the function of controlling the leaf green depth and the leaf included angle of lettuce is further verified.
Tang T,Yu XW,Yang H,Gao Q,Ji HT,Wang YX,Yan GB,Peng Y,Luo HF,Liu KD,et al.(2018)Development and Validation of an Effective CRISPR/Cas9 Vector for Efficiently Isolating Positive Transformants and Transgene-Free Mutants in a Wide Range of Plant Species.Frontiers in Plant Science 9:
Zhang L,Qian J,Han Y,Jia Y,Kuang H,Chen J.(2022)Alternative splicing triggered by the insertion of a CACTA transposon attenuates LsGLK and leads to the development of pale-green leaves in lettuce.Plant J 109:182-195.
Zhang L,Su W,Tao R,Zhang W,Chen J,Wu P,Yan C,Jia Y,Larkin RM,Lavelle D,et al.(2017)RN Asequencing provides insights into the evolution of lettuce and the regulation of flavonoid biosynthesis.Nat Commun 8:2264。
Sequence listing
<110> university of agriculture in China
Application of <120> lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2317
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgaacagct cctcattcct taccaaattc ctccgccatc accgccacca atacaccaga 60
atgaaccacc taccatcatt ggattcctcc gccagttccc ccaccgacaa atcaaattcc 120
ctcgcctcca aatgctggct tgacgacgcc tgcattgttg acatcgacta cttcgtcaaa 180
acactttccg gcatcaaagc taatggcgta cgaccagacc tcattggttc catcatcaca 240
cattacgctt ccaaatggat tcctgaactc tccggcgaac caccatcacc tgtcgccccc 300
gaactccagt ctctctcaca aagcgccacc gcgtcttggc tcaagaaacg ttttttcata 360
gagactatag tggcggttct accaccggag aaagacgcca ttccctgcag ctttcttctc 420
cggctactca agaacgctaa catggtgggt gtggactcga gttacaagga ggagctggag 480
aaaagagttg catggcggct ggaccaggcg acgttgaaag agctgatgat accgtgtttt 540
agtcatgaca gaagcacgtt gttcgacgtc gagcttatgc tccggttagt gaaaaggttt 600
gtggaattgg agatcgaagg tctcagaacc ggtgccggaa tgtttaaggt tgcaaagctt 660
gtagacgctt atcttgcaga agttgccgtc gattcagagg tggcattgcc ggagtttatg 720
gagcttgccg gagcagttcc tgcacaagcc cgtgccacgg acgatggttt ataccgtgct 780
attgatactt atttaaaagt aagttatttt aaccaaataa tttaattaaa ctattagatt 840
tttaaaattt aattaaatgc gtcagtttat ttctttttat gtaatatatc gtttttgttt 900
taatgaatca ttacgtcaga tatacaaata ttttatataa aaaaaaaaaa aaagttatgc 960
taaatactat aaattatatc ttcatcgaga taaaagaaac cttttagttt taaaaatggc 1020
gtaaattaaa tttaacaata gtttttttaa aacatgtttc attgaacctt agaaaattaa 1080
taaaaataat aaagttaatt aaaaaataga accataaaaa atgataaaat tgaatgaaaa 1140
gtataatcat acaactatat aaaatttaat ataaataccc tgcaaagcca taaaatctaa 1200
taaatgctta aataaataaa ctaataacaa ttagtgtttt attgtgacaa atattatgat 1260
tttataataa aacattgaag tatcactagt tccattttag acaacggcaa gcactcggaa 1320
tacaaaactt ttctgactta tgtaaaattt cattctacat tatacgtttt atattaatta 1380
tctcatgtat caagcaattg acttcaaaga attattttgg ttcaaaataa gtaaaaattt 1440
taatagtttg aaaatgcaac gttttgctaa tatatcaatt attcaataat aaacatttgc 1500
atagtgtttg taatatattt tacgaaataa cttaaataca aaactaataa tttatatact 1560
gtaataaaat attgtactct tgtgttgtca tatgtcatcc ccaccaaatg ataggaataa 1620
ataagataaa agtggtgcac atcggaatta caatttggcc ttttgtttgg cctcccgtga 1680
tgaatgtgac aacttaatta tttcaaatgc gttatttatg ttttcttttt aaatagaaat 1740
ttaattttaa aacatataat aattgcaaat ttcctatgta cagacgcatg tgaacgtgac 1800
aaaacaagaa agaaagagat tatgcaaatt aatcgatagt caaaagttat caaccgaagc 1860
atccattcat gcagctcaaa atgaacgttt accagtaaga tcagtaatcc aagtgctatt 1920
ctctgaacaa gcaaaactga gttcccacac tgattggagt cgatcattca gcactgccag 1980
aagcccgaac ctcagtgtgg acccacacga taggtgccat tcatcaagag atattgcaac 2040
aattcaacaa atggaaatca agaagctaaa agaacatgta acaaagcttg aaaggcaatg 2100
ctactcgatg caaaatcaaa ttgacaagtt atcggagaag aaaagagggt ttttcaattg 2160
gaggaaactg caaatgtcaa cgactctaaa gtctatgagc atagaagtgg ctgacgaaag 2220
taagttggat tcgagtagca ttggaaagca aactcctctc aagggaaaac aagggagaaa 2280
taagactccg aaaaggtgga gatcatctac ttcttaa 2317
<210> 2
<211> 1332
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
atgaacagct cctcattcct taccaaattc ctccgccatc accgccacca atacaccaga 60
atgaaccacc taccatcatt ggattcctcc gccagttccc ccaccgacaa atcaaattcc 120
ctcgcctcca aatgctggct tgacgacgcc tgcattgttg acatcgacta cttcgtcaaa 180
acactttccg gcatcaaagc taatggcgta cgaccagacc tcattggttc catcatcaca 240
cattacgctt ccaaatggat tcctgaactc tccggcgaac caccatcacc tgtcgccccc 300
gaactccagt ctctctcaca aagcgccacc gcgtcttggc tcaagaaacg ttttttcata 360
gagactatag tggcggttct accaccggag aaagacgcca ttccctgcag ctttcttctc 420
cggctactca agaacgctaa catggtgggt gtggactcga gttacaagga ggagctggag 480
aaaagagttg catggcggct ggaccaggcg acgttgaaag agctgatgat accgtgtttt 540
agtcatgaca gaagcacgtt gttcgacgtc gagcttatgc tccggttagt gaaaaggttt 600
gtggaattgg agatcgaagg tctcagaacc ggtgccggaa tgtttaaggt tgcaaagctt 660
gtagacgctt atcttgcaga agttgccgtc gattcagagg tggcattgcc ggagtttatg 720
gagcttgccg gagcagttcc tgcacaagcc cgtgccacgg acgatggttt ataccgtgct 780
attgatactt atttaaaaac gcatgtgaac gtgacaaaac aagaaagaaa gagattatgc 840
aaattaatcg atagtcaaaa gttatcaacc gaagcatcca ttcatgcagc tcaaaatgaa 900
cgtttaccag taagatcagt aatccaagtg ctattctctg aacaagcaaa actgagttcc 960
cacactgatt ggagtcgatc attcagcact gccagaagcc cgaacctcag tgtggaccca 1020
cacgataggt gccattcatc aagagatatt gcaacaattc aacaaatgga aatcaagaag 1080
ctaaaagaac atgtaacaaa gcttgaaagg caatgctact cgatgcaaaa tcaaattgac 1140
aagttatcgg agaagaaaag agggtttttc aattggagga aactgcaaat gtcaacgact 1200
ctaaagtcta tgagcataga agtggctgac gaaagtaagt tggattcgag tagcattgga 1260
aagcaaactc ctctcaaggg aaaacaaggg agaaataaga ctccgaaaag gtggagatca 1320
tctacttctt aa 1332
<210> 3
<211> 443
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
Met Asn Ser Ser Ser Phe Leu Thr Lys Phe Leu Arg His His Arg His
1 5 10 15
Gln Tyr Thr Arg Met Asn His Leu Pro Ser Leu Asp Ser Ser Ala Ser
20 25 30
Ser Pro Thr Asp Lys Ser Asn Ser Leu Ala Ser Lys Cys Trp Leu Asp
35 40 45
Asp Ala Cys Ile Val Asp Ile Asp Tyr Phe Val Lys Thr Leu Ser Gly
50 55 60
Ile Lys Ala Asn Gly Val Arg Pro Asp Leu Ile Gly Ser Ile Ile Thr
65 70 75 80
His Tyr Ala Ser Lys Trp Ile Pro Glu Leu Ser Gly Glu Pro Pro Ser
85 90 95
Pro Val Ala Pro Glu Leu Gln Ser Leu Ser Gln Ser Ala Thr Ala Ser
100 105 110
Trp Leu Lys Lys Arg Phe Phe Ile Glu Thr Ile Val Ala Val Leu Pro
115 120 125
Pro Glu Lys Asp Ala Ile Pro Cys Ser Phe Leu Leu Arg Leu Leu Lys
130 135 140
Asn Ala Asn Met Val Gly Val Asp Ser Ser Tyr Lys Glu Glu Leu Glu
145 150 155 160
Lys Arg Val Ala Trp Arg Leu Asp Gln Ala Thr Leu Lys Glu Leu Met
165 170 175
Ile Pro Cys Phe Ser His Asp Arg Ser Thr Leu Phe Asp Val Glu Leu
180 185 190
Met Leu Arg Leu Val Lys Arg Phe Val Glu Leu Glu Ile Glu Gly Leu
195 200 205
Arg Thr Gly Ala Gly Met Phe Lys Val Ala Lys Leu Val Asp Ala Tyr
210 215 220
Leu Ala Glu Val Ala Val Asp Ser Glu Val Ala Leu Pro Glu Phe Met
225 230 235 240
Glu Leu Ala Gly Ala Val Pro Ala Gln Ala Arg Ala Thr Asp Asp Gly
245 250 255
Leu Tyr Arg Ala Ile Asp Thr Tyr Leu Lys Thr His Val Asn Val Thr
260 265 270
Lys Gln Glu Arg Lys Arg Leu Cys Lys Leu Ile Asp Ser Gln Lys Leu
275 280 285
Ser Thr Glu Ala Ser Ile His Ala Ala Gln Asn Glu Arg Leu Pro Val
290 295 300
Arg Ser Val Ile Gln Val Leu Phe Ser Glu Gln Ala Lys Leu Ser Ser
305 310 315 320
His Thr Asp Trp Ser Arg Ser Phe Ser Thr Ala Arg Ser Pro Asn Leu
325 330 335
Ser Val Asp Pro His Asp Arg Cys His Ser Ser Arg Asp Ile Ala Thr
340 345 350
Ile Gln Gln Met Glu Ile Lys Lys Leu Lys Glu His Val Thr Lys Leu
355 360 365
Glu Arg Gln Cys Tyr Ser Met Gln Asn Gln Ile Asp Lys Leu Ser Glu
370 375 380
Lys Lys Arg Gly Phe Phe Asn Trp Arg Lys Leu Gln Met Ser Thr Thr
385 390 395 400
Leu Lys Ser Met Ser Ile Glu Val Ala Asp Glu Ser Lys Leu Asp Ser
405 410 415
Ser Ser Ile Gly Lys Gln Thr Pro Leu Lys Gly Lys Gln Gly Arg Asn
420 425 430
Lys Thr Pro Lys Arg Trp Arg Ser Ser Thr Ser
435 440
<210> 4
<211> 60
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
ccatcatcac acattacgct tccaaatgga ttcggcgaac caccatcacc tgtcgccccc 60
<210> 5
<211> 57
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
ccatcatcac acattacgct tccaaatgga ttcctgacac catcacctgt cgccccc 57
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
atgaacagct cctcattcct t 21
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
ttaagaagta gatgatctcc acct 24
<210> 8
<211> 17
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gtaaaacgac ggccagt 17
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
cacggtataa accatcgtcc 20
Claims (6)
1. The gene for coding the protein shown in SEQ ID NO.3 or the application of the protein shown in SEQ ID NO.3 in controlling the green depth and leaf angle properties of lettuce leaves.
2. The use according to claim 1, wherein said gene is set forth in SEQ ID NO. 2.
3. The application of the gene for coding the protein shown in SEQ ID NO.3 in lettuce leaf green shade and leaf included angle breeding.
4. The preparation method of the light green leaf-large leaf included angle phenotype lettuce is that the gene encoding the protein shown in SEQ ID NO.3 in the dark green leaf-small leaf included angle phenotype lettuce is knocked out.
5. The preparation method of the dark green leaf-small leaf included angle phenotype lettuce is characterized in that the protein shown in SEQ ID NO.3 is expressed in the light green leaf-large leaf included angle phenotype lettuce.
6. The preparation method of claim 4, wherein the light green leaf-big leaf included angle phenotype lettuce has a gene of SEQ ID NO.4 or SEQ ID NO. 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210210201.9A CN114540371B (en) | 2022-03-04 | 2022-03-04 | Application of lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210210201.9A CN114540371B (en) | 2022-03-04 | 2022-03-04 | Application of lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114540371A CN114540371A (en) | 2022-05-27 |
| CN114540371B true CN114540371B (en) | 2023-10-17 |
Family
ID=81662318
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210210201.9A Active CN114540371B (en) | 2022-03-04 | 2022-03-04 | Application of lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114540371B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110041415A (en) * | 2018-10-17 | 2019-07-23 | 华中农业大学 | Application of the lettuce gene RLL4 in control lettuce leaf color |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140259210A1 (en) * | 2013-03-11 | 2014-09-11 | Vanguard Seed, Inc. | Leaf lettuce mutant allele |
-
2022
- 2022-03-04 CN CN202210210201.9A patent/CN114540371B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110041415A (en) * | 2018-10-17 | 2019-07-23 | 华中农业大学 | Application of the lettuce gene RLL4 in control lettuce leaf color |
Non-Patent Citations (1)
| Title |
|---|
| NCBI Reference Sequence: XM_023873661.2;无;《NCBI》;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114540371A (en) | 2022-05-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164347B (en) | Ideal plant type gene NPT1 for controlling rice stem thickness, tillering number, spike grain number, thousand grain weight and yield and its application | |
| CN112301036B (en) | Gene OsABCG38 for regulating and controlling rice cadmium accumulation and encoding protein and application thereof | |
| CN111763682A (en) | Application of ZmSBP12 gene in regulation of drought resistance, plant height and spike height of corn | |
| CN105602911B (en) | Soybean PUB E3 ubiquitin ligase GmPUB8 and coding gene and application thereof | |
| CN111153974A (en) | Corn disease-resistant gene and molecular marker and application thereof | |
| CN114752579A (en) | Application of ZmMAPK protein and coding gene thereof in regulation and control of low-temperature stress tolerance of plants | |
| CN114369147B (en) | Application of BFNE gene in tomato plant type improvement and biological yield improvement | |
| CN111320679A (en) | ZmPHYCs mutant protein related to maize flowering phase, encoding gene, recombinant vector and application thereof | |
| CN110592134A (en) | Application of SDG40 gene or coding protein thereof | |
| CN109721649A (en) | A kind of plant type of rice regulation related gene, protein and application | |
| CN111826391B (en) | Application of NHX2-GCD1 double gene or protein thereof | |
| CN114540371B (en) | Application of lettuce LsNRL4 gene in controlling green depth and leaf angle traits of lettuce leaves | |
| CN108148845B (en) | Corn ZmKNOLLE gene and protein for enhancing salt tolerance of plants and application | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN112457385B (en) | Application of gene LJP1 for controlling rice growth period | |
| CN110343154B (en) | Clone of key gene SEM1 for controlling rice sink source flow and application thereof | |
| CN111560055B (en) | Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat | |
| CN111394363B (en) | Corn xylan side chain methylation key gene, expression vector and application | |
| CN110894223B (en) | Gene HcLMI1 for controlling kenaf leaf shape and application thereof | |
| CN114395580A (en) | Gene for controlling plant height of corn | |
| CN113462696A (en) | Rice low-temperature sensitive leaf-shaped gene SRNL9 and application thereof | |
| CN108949821B (en) | Method for improving drought resistance of plants by inhibiting expression of COST1 gene | |
| KR102539626B1 (en) | Use of protein nog1 in controlling plant yield and number of grains per ear | |
| CN114540370B (en) | Application of lettuce LsSAW1 gene in control of lettuce knob traits | |
| CN113929756A (en) | Application of GL11 protein and gene for encoding GL11 protein in regulation of rice grain shape and thousand kernel weight |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |