CN114525284A

CN114525284A - Red-peel longan anthocyanin biosynthesis regulation gene DlMYB1-HP and application thereof

Info

Publication number: CN114525284A
Application number: CN202210073997.8A
Authority: CN
Inventors: 杜丽娜; 赖彪; 李昌满; 丁峰; 魏永赞; 徐思; 郭平; 桂秋林
Original assignee: Yangtze Normal University
Current assignee: Yangtze Normal University
Priority date: 2022-01-21
Filing date: 2022-01-21
Publication date: 2022-05-24
Anticipated expiration: 2042-01-21
Also published as: CN114525284B

Abstract

The invention relates to the technical field of biological gene engineering, in particular to a red-skinned longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof. The nucleotide sequence of the red-peel longan anthocyanin biosynthesis regulation gene DlMYB1-HP is shown as SEQ ID No. 1; the amino acid sequence of the red-peel longan anthocyanin biosynthesis regulation gene DlMYB1-HP is shown as SEQ ID No. 2. The invention also discloses application of the red-peel longan anthocyanin biosynthesis regulation gene DlMYB1-HP, which is used for regulating anthocyanin biosynthesis; the gene has a strong function of promoting anthocyanin synthesis, so that the gene DlMYB1-HP has good application prospect and commercial value in regulating and promoting anthocyanin synthesis.

Description

Red-peel longan anthocyanin biosynthesis regulation gene DlMYB1-HP and application thereof

Technical Field

The invention relates to the technical field of biological gene engineering, in particular to a red-peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof.

Background

Anthocyanin is a water-soluble flavonoid compound widely existing in plants, is synthesized in cytoplasm and accumulated in vacuole, so that plant flower color, fruit and partial leaf show different colors, has strong antioxidant capacity and certain anti-inflammatory, antibacterial and antiviral activities, and plays a very important role in the physiological activities of plants. In recent decades, with the intensive research on anthocyanin, the physiological activity, function and action mechanism principle of anthocyanin gradually become the hot points of research of numerous scholars, and meanwhile, anthocyanin also receives wide attention and acceptance of people due to the edible and medicinal values of anthocyanin, including the effects of antioxidation, anti-inflammation, bacteriostasis, anti-aging, anti-cancer and the like and the protective effect of anthocyanin on liver, cardiovascular and cerebrovascular diseases and eyesight.

MYB transcription factors widely exist in eukaryotes, a large number of MYB transcription factor genes are found in plant genomes, for example, 199 MYB transcription factor members are found in Arabidopsis, 191 MYB genes are identified from poplar, more than 200 MYB transcription factors are found in cotton, and corresponding R2R3-MYB transcription factors are also found in other plants. The common characteristic is that a section of specific conservative DNA binding structural domain at the N end is widely involved in the physiological and biochemical processes of plants, including differentiation of plant epidermal cells, development of stomata, synthesis of flavonoid organisms, abiotic stress, pathogen resistance and the like. The first MYB transcription factor Colorless (C1) in plants was isolated and identified from maize, and later studies found that C1 was primarily involved in regulating anthocyanin biosynthesis in maize, and subsequently, in the model plant Arabidopsis, AtPAP1(AtMYB75) and AtPAP2(AtMYB90) involved in anthocyanin biosynthesis regulation were also isolated in succession.

The invention discovers a gene for regulating and controlling DlMYB-HP from a red-peel longan, and the separately expressed DlMYB-HP gene has very strong function of regulating and controlling anthocyanin biosynthesis in various plants.

Disclosure of Invention

The invention aims to provide a red-peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof, so that the red-peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP can be applied to anthocyanin biosynthesis regulation.

In order to achieve the purpose, the invention adopts the following technical scheme:

the application of a red peel longan anthocyanin biosynthesis regulation gene DlMYB1-HP, wherein the synthesis gene DlMYB1-HP is used for regulating anthocyanin biosynthesis.

The nucleotide sequence of the red peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP is shown in SEQ ID No. 1.

The amino acid sequence of the red-peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP is shown in SEQ ID No. 2.

The invention has at least the following beneficial effects:

the gene DlMYB1-HP regulating anthocyanin biosynthesis is discovered from the red-peel longan, the gene is expressed in each tissue of the red-peel longan, and can be instantly expressed in tobacco or stably transgenically expressed by constructing an over-expression vector, so that a large amount of anthocyanin can be accumulated on the original anthocyanin-free leaves, and the gene has a very strong function of promoting anthocyanin synthesis, so that the gene DlMYB1-HP has good play in the aspect of regulating and promoting anthocyanin synthesis and has good prospect and commercial value.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is the alignment chart of the amino acid sequences of longan DlMYB1-HP and longan DlMYB 1-XS;

FIG. 2 is a schematic diagram showing target bands amplified from the DlMYB1-HP gene and the DlMYB1-XS gene;

FIG. 3 is a schematic diagram showing the phenotype and anthocyanin content of transiently expressed DlMYB1-XS and DlMYB1-HP in tobacco leaves, wherein A is the phenotype of the tobacco leaves transiently expressing DlMYB1-XS and DlMYB1-HP genes of Shixia longan, and B is the anthocyanin content.

FIG. 4 is a schematic representation of DlMYB1-XS and DlMYB1-HP longan tobacco phenotypes, A being control and transgenic tobacco leaf phenotypes, and B being anthocyanin content.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The invention relates to a red-peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof.

1. Materials and methods

1.1. Material

The different tissues of the red longan and the Shixia longan comprise fruit peel, fruit pulp, leaves, seeds and stems.

RNA extraction and reverse transcription

Total RNA of different tissues of longan is extracted by using a polysaccharide polyphenol plant total RNA extraction Kit (cat number: DP441) of Tiangen Biochemical technology (Beijing) Co., Ltd, and then cDNA is synthesized by reverse transcription according to HiScript III 1st Strand cDNA Synthesis Kit (+ gDNA wiper) Kit (cat number: R312-01) of Nanjing Nodezaki.

1.3. Construction and sequencing analysis of gene overexpression vector

Specific primers CTAGTGGATCCAAAGATGTCGCATTTACTTGGTGTAAG and ACTCTAGAAGTACTCCTACTTTGCATTGTCTTCTTCTGAAC are designed, and a DlMYB1-HP gene sequence of the red-peel longan is amplified by taking the red-peel longan pericarp cDNA as a template; specific primers CTAGTGGATCCAAAGATGTTGGATTTACTTGATGCAAG and ACTCTAGAAGTACTCCTAAATTAGATTATTGTCTTCTTCTG are designed, and the gene sequence of the longan DlMYB1-SX of Shixia is amplified by taking longan young leaf cDNA of Shixia as a template.

After PCR amplification is finished, agarose gel electrophoresis detection is carried out, then gel DNA recovery kit (cat # 2001050) of Simgen company is used for recovering amplified target DNA, DlMYB1-HP and DlMYB1-HP-SX are assembled on pSAK277 vectors cut by EcoR I and Xho I through a seamless cloning method and are respectively named as pSAK277-DlMYB1-HP and pSAK277-DlMYB1-SX overexpression vectors, furthermore, products assembled by Gibsion are transformed into escherichia coli, after PCR detection of bacteria liquid, plasmids are extracted according to quick plasmid DNA minikit (cat # 1005250) of Simgen company, and the plasmids are sent to Huada gene company for sequencing. And after the sequencing result is returned, comparing the nucleotide and amino acid sequence difference between the two genes by using clustal software.

Specifically, referring to fig. 1, the sequence alignment finds that the amino acid sequences coded by DlMYB1-HP and DlMYB1-SX are greatly different, the amino acid sequences at a plurality of positions are different, and the amino acid sequences are also greatly different from the amino acid sequence of an anthocyanin key regulatory gene LcMYB1 of litchi of the same family.

2. Tobacco transient expression and transgene experiments

2.1. The obtained pSAK277-DlMYB1-HP and pSAK277-DlMYB1-XS overexpression vectors are transformed into agrobacterium GV3101 competence by an electrotransformation method, and PCR detection is carried out on specific primers AGAAGACGTTCCAACCACGTCT and TCATAGGCGTCTCGCATATCTC bacterial liquid for later use. Agrobacterium containing the pSAK277-DlMYB1-HP and pSAK277-DlMYB1-XS overexpression vectors was picked. Agrobacterium of pSAK277-DlMYB1-HP and pSAK277-DlMYB1-XS overexpression vectors were inoculated in liquid LB medium containing kanamycin (100mg/L), cultured at 28 ℃ and 300rpm to OD₆₀₀About 2, centrifuging the cultured broth at 4000rpm for 5min, and collecting the thallus with MAA (10mM MES (2- [ N-morpholino)]ethanesulfonic acid)pH 5.6，10mM MgCl ₂100. mu.M Acetostyringone) suspension of microbial cells OD₆₀₀To about 1.0; agrobacterium containing pSAK277-DlMYB1-HP and pSAK277-DlMYB1-XS expression vectors were injected separately into the tobacco back side using a syringe without needle. Injection 5 ^ eAnd after 6d, observing and photographing, and collecting a sample to analyze the anthocyanin content.

Specifically, refer to FIG. 3, wherein A in FIG. 3 is the tobacco leaf phenotype of transiently expressing DlMYB1-XS and DlMYB1-HP genes of Shixia longan, and B is the anthocyanin content.

2.2. Stable genetic transformation of tobacco

Preparing agrobacterium: on a clean bench, YEP broth was taken, added to the corresponding antibiotic, and then dispensed into 50mL centrifuge tubes, approximately 5mL per tube. 100 μ L of correctly detected Agrobacterium were placed in the above medium and incubated overnight on a shaker at 28 ℃. Taking out the bacterial liquid, and centrifuging the bacterial liquid at 6000rpm for 5 min. The supernatant was decanted and the cells were resuspended in approximately 50mL MSB broth for use.

Firstly, healthy and mature leaves with medium size are put in tap water.

② 10min is sterilized by 0.5 percent sodium hypochlorite.

And thirdly, washing for 3 times by using sterilized water.

Fourthly, pouring a small amount of sterilized water (only a thin layer) into the culture dish, and cutting the leaves into about 0.5cm in the sterilized water²About 90 explants are required for the size of the explant (the marginal part of the leaf and the main vein are removed).

Fifthly, the cut explants are soaked and dyed in the resuspended bacterial liquid for about 10 min.

Sixthly, spreading a sterilized filter paper on the pre-prepared co-culture medium, and spreading the explant with the front side upwards on the co-culture medium after the dip dyeing is finished.

Seventhly, marking and recording, placing the culture medium which completes the experiment in a lightproof paper box for dark culture at 28 ℃ for 2d, and taking out the culture medium, wherein the edge of the explant is slightly curled and is slightly whitish.

After 2 days of co-culture, the explants are transferred to a screening medium for selective culture (note that the leaves are right side up).

And ninthly, transferring the leaves to a screening culture medium for culture after 2 weeks, and subculturing every 2 weeks later.

And (3) if the cut is found to be upwards warped in the culture process, repositioning the blade, and contacting the cut with the surface of the culture medium as much as possible. So as to fully absorb the nutrients in the culture medium. The period is regularly observed, and the pollution is timely replaced.

After about four weeks (r), resistant buds are induced on the screening medium, and when the resistant buds grow to 1-2cm (may be a little larger), the resistant buds are cut off and transferred to a rooting medium to induce the formation of roots. When the resistant bud grows to root and the height of the seedling is more than 2/3, taking out the seedling, cleaning the culture medium at the root, putting the culture medium in clear water, and putting the culture medium on a window sill for hardening the seedling. The utility model can be in contact with the natural environment to adapt to the illumination, temperature and humidity in the natural environment. Hardening the seedlings for about 2-3 days, transplanting the seedlings into the pot soil of the greenhouse, and watering the seedlings thoroughly.

The cultivation in each stage is as follows:

MSB liquid culture Medium: 4.4g/L MS +30g/L sucrose +2.0 mg/L6-BA +0.1mg/L NAA + 100. mu.M As pH 5.7. And sterilizing in multiple bottles for later use.

② co-culture medium: 4.4g/L MS +30g/L sucrose +8g/L agar +2.0 mg/L6-BA +0.1mg/L NAA +100 mu M As pH5.7, sterilizing and packaging for later use.

③ screening the culture medium for the first time: 4.4g/L MS +30g/L sucrose +8g/L agar +2.0 mg/L6-BA +0.1mg/L NAA +100mg/L Km +400mg/L Cef pH5.7, sterilizing and packaging for later use.

Fourthly, rooting culture medium: 4.4g/L MS +30g/L sucrose +8g/L agar +100mg/L Km +400mg/L Cef pH 5.7.

The anthocyanin content of the part of the tobacco leaf which is transiently transformed into the DlMYB1-HP gene is 0.016mg/g, and the anthocyanin content of the part of the transient transformed DlMYB1-XS gene is as follows: 0.001 mg/g.

The DNA of the resistant candidate plant is extracted by a plant DNA kit (3201050) of Hangzhou Xinjing biology company, and a target gene is amplified by using specific primers ATGCCGGAAAAGCTGTAGATTG and CATGCGATCATAGGCGTCTCGCAT to detect whether the target gene is integrated into tobacco. As can be seen from FIG. 2, the tobacco DNA of the three genes DlMYB1-HP and DlMYB1-SX selected by us can amplify the target band size, while the wild type W38 and H₂The O control could not be amplified, indicating that both the DlMYB1-HP gene and the DlMYB1-SX gene were successfully transferred into W38 tobacco.

The leaves of stably transformed DlMYB1-HP gene plants accumulate a large amount of anthocyanin which is 0.0262mg/g and is red, while the leaves of stably transformed DlMYB1-SX gene only accumulate a small amount of anthocyanin which is only 0.0042mg/g, and the anthocyanin content of the leaves of the stably transformed DlMYB1-HP gene plants is 62 times that of the leaves of the stably transformed DlMYB1-SX gene.

The results are shown in FIG. 4. (anthocyanin content is measured by pH differential method, see Wrolstad et al (1982) test method, which comprises the steps of taking 0.1g of radish tissue, leaching in 3mL of leaching solution (methanol; water: concentrated hydrochloric acid 85: 12: 3) sufficiently in the dark at room temperature (about 5-6 hours), preparing Buffer 1 and Buffer 2, Buffer 1: 0.2mol/L KCl-0.2mol/L HCl (25: 67), pH 1, Buffer 2: 1mol/L NaAc-0.4mol/L HCl (100: 150), pH5, adding 2mL of Buffer 1 and Buffer 2 to a test tube, respectively, taking 0.5mL of leaching solution, and measuring the absorbance at 530nm by ultraviolet light.

The results were calculated from empirical formulas as follows: anthocyanin content (mg/g) ═ Δ OD₅₃₀X 5X 3X 445.2/29600X 0.1, wherein 5 is the dilution factor, 3 is the volume of the extracting solution, and 445.2 is the relative molecular mass of cyanidin-3-glucoside; 29600 is the absorption coefficient (mol) of cyanidin-3-glucoside^-1.mL^-1) And 0.1 represents the sample weight. )

From this, it can be seen that, in combination:

the invention discovers a gene DlMYB1-HP for regulating anthocyanin biosynthesis from red-peel longan, the gene is expressed in each tissue of the red-peel longan, and the original anthocyanin-free leaves can accumulate a large amount of anthocyanin by constructing an over-expression vector to be instantaneously expressed in tobacco or stably transgenically expressing, so that the gene has a strong function of promoting anthocyanin synthesis, and theoretical and technical bases are provided for utilizing the gene to carry out molecular genetic concepts.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are merely illustrative of the principles of the invention, but that various changes and modifications may be made without departing from the spirit and scope of the invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> Changjiang college of teachers and schools

<120> red peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 846

<212> DNA

<213> Red longan (Red longan)

<400> 1

atgtcgcatt tacttggtgt aagtgcatat agtgccacat ctatggaggg ttacgtagga 60

gttcgaaaag gtacatggac cgaagaagaa gataatcttc tgaggaaatg tattgaaatt 120

tatggcgagc aaaaatggca tcaagttcct gttagagcag ggctaaatcg atgccggaaa 180

agctgtagat tgagatggct gaattatctg aagccaaata tcaaaagagg ggaattcatg 240

gaagatgaag ttgatctgat tttgaggctg cataaactgt tggggaatag atggtcattg 300

attgctggta ggcttcctgg aagaacagct aatgatatca agaactattg gaacacacga 360

ttacgcaaaa aagctgttgc ttcaaagcaa gaatcgaaaa caatgacaag tactactact 420

actcaaagca cacaaaaaat taatgtaata aagcctcaac ctcgaacctt ctcccaaaaa 480

aaatctgaat ggttgaatgc caaaataacc atggaggaaa acagcagaga ccattttggg 540

catccaaatc tttgcacggc gtcatcatca acttcactgg atacaccaga taataatgaa 600

atgatcttgt gttgggagag gctgttagag actggtcaat ttgagctaga aactccaaat 660

tctatgggat ggtcagagtg gcctaccata tccaactttt gggctgaaat atcacctccg 720

agaacaatgt gtgcgggtag cgatggtttt gaagtgaacc agaactgctt ggacaaacat 780

catgacttgg attttgatgc gaccctttgg aatcttctga gttcagaaga agacaatgca 840

aagtag 846

<210> 2

<211> 281

<212> PRT

<213> Red longan (Red longan)

<400> 2

Met Ser His Leu Leu Gly Val Ser Ala Tyr Ser Ala Thr Ser Met Glu

1 5 10 15

Gly Tyr Val Gly Val Arg Lys Gly Thr Trp Thr Glu Glu Glu Asp Asn

20 25 30

Leu Leu Arg Lys Cys Ile Glu Ile Tyr Gly Glu Gln Lys Trp His Gln

35 40 45

Val Pro Val Arg Ala Gly Leu Asn Arg Cys Arg Lys Ser Cys Arg Leu

50 55 60

Arg Trp Leu Asn Tyr Leu Lys Pro Asn Ile Lys Arg Gly Glu Phe Met

65 70 75 80

Glu Asp Glu Val Asp Leu Ile Leu Arg Leu His Lys Leu Leu Gly Asn

85 90 95

Arg Trp Ser Leu Ile Ala Gly Arg Leu Pro Gly Arg Thr Ala Asn Asp

100 105 110

Ile Lys Asn Tyr Trp Asn Thr Arg Leu Arg Lys Lys Ala Val Ala Ser

115 120 125

Lys Gln Glu Ser Lys Thr Met Thr Ser Thr Thr Thr Thr Gln Ser Thr

130 135 140

Gln Lys Ile Asn Val Ile Lys Pro Gln Pro Arg Thr Phe Ser Gln Lys

145 150 155 160

Lys Ser Glu Trp Leu Asn Ala Lys Ile Thr Met Glu Glu Asn Ser Arg

165 170 175

Asp His Phe Gly His Pro Asn Leu Cys Thr Ala Ser Ser Ser Thr Ser

180 185 190

Leu Asp Thr Pro Asp Asn Asn Glu Met Ile Leu Cys Trp Glu Arg Leu

195 200 205

Leu Glu Thr Gly Gln Phe Glu Leu Glu Thr Pro Asn Ser Met Gly Trp

210 215 220

Ser Glu Trp Pro Thr Ile Ser Asn Phe Trp Ala Glu Ile Ser Pro Pro

225 230 235 240

Arg Thr Met Cys Ala Gly Ser Asp Gly Phe Glu Val Asn Gln Asn Cys

245 250 255

Leu Asp Lys His His Asp Leu Asp Phe Asp Ala Thr Leu Trp Asn Leu

260 265 270

Leu Ser Ser Glu Glu Asp Asn Ala Lys

275 280

<210> 3

<211> 837

<212> DNA

<213> Shixia longan (Shek Kip longan)

<400> 3

atgttggatt tacttgatgc aagtgcatat agtgccacat ctatggaggg ttatgtagga 60

gttcgaaaag gtgcatggac tgaagaagaa gatactcttt tgaggaaatg cattgaaaag 120

tatggcaaac taaaatggca tgaagttcct gttagagcag ggctaaatcg atgccggaaa 180

agctgtagat tgagatggct aaattatctg aagccaaata tcaaaagagg ggagttcaca 240

gaagatgaag ttgatctgac tttgaggctg caaaaactgt tggggaatag atggtcattg 300

attgctggca ggcttcctgg aagaacagct aatagtgtca agaactattg gaacacacat 360

ttacgcaaaa aagctgttgc ttcaaagcaa gaatcgaaag caatgacaag cactactcaa 420

aacacacaaa aaatcaatgt aataaagcct caacctctaa ccttctccaa aaaaacatct 480

gcatgggtga atgccaaaat caccatggag gagaccagca gataccattt aggacagcca 540

aatctttgca aggcatcatc atcaacttca ttggatacac cagataatac tgaaatgatc 600

atgtggtggg agaggctgtt agagagtggt gatcaacttg tgcaagaaac tccaaattct 660

atgggatggt cagacgggat gtccaacttt tggcctgaaa aatctcctct gagaacaacg 720

tttgcaggtg gtgctggttt cgaagtgaac cacaacagct tggacaaaca tcctgacgtg 780

gatttcgatg ccgacctttg gaatcttctg agttcagaag aagacaataa tctaatt 837

<210> 4

<211> 279

<212> PRT

<213> Shixia longan (Shek Kip longan)

<400> 4

Met Leu Asp Leu Leu Asp Ala Ser Ala Tyr Ser Ala Thr Ser Met Glu

1 5 10 15

Gly Tyr Val Gly Val Arg Lys Gly Ala Trp Thr Glu Glu Glu Asp Thr

20 25 30

Leu Leu Arg Lys Cys Ile Glu Lys Tyr Gly Lys Leu Lys Trp His Glu

35 40 45

Val Pro Val Arg Ala Gly Leu Asn Arg Cys Arg Lys Ser Cys Arg Leu

50 55 60

Arg Trp Leu Asn Tyr Leu Lys Pro Asn Ile Lys Arg Gly Glu Phe Thr

65 70 75 80

Glu Asp Glu Val Asp Leu Thr Leu Arg Leu Gln Lys Leu Leu Gly Asn

85 90 95

Arg Trp Ser Leu Ile Ala Gly Arg Leu Pro Gly Arg Thr Ala Asn Ser

100 105 110

Val Lys Asn Tyr Trp Asn Thr His Leu Arg Lys Lys Ala Val Ala Ser

115 120 125

Lys Gln Glu Ser Lys Ala Met Thr Ser Thr Thr Gln Asn Thr Gln Lys

130 135 140

Ile Asn Val Ile Lys Pro Gln Pro Leu Thr Phe Ser Lys Lys Thr Ser

145 150 155 160

Ala Trp Val Asn Ala Lys Ile Thr Met Glu Glu Thr Ser Arg Tyr His

165 170 175

Leu Gly Gln Pro Asn Leu Cys Lys Ala Ser Ser Ser Thr Ser Leu Asp

180 185 190

Thr Pro Asp Asn Thr Glu Met Ile Met Trp Trp Glu Arg Leu Leu Glu

195 200 205

Ser Gly Asp Gln Leu Val Gln Glu Thr Pro Asn Ser Met Gly Trp Ser

210 215 220

Asp Gly Met Ser Asn Phe Trp Pro Glu Lys Ser Pro Leu Arg Thr Thr

225 230 235 240

Phe Ala Gly Gly Ala Gly Phe Glu Val Asn His Asn Ser Leu Asp Lys

245 250 255

His Pro Asp Val Asp Phe Asp Ala Asp Leu Trp Asn Leu Leu Ser Ser

260 265 270

Glu Glu Asp Asn Asn Leu Ile

275

Claims

1. The application of the red peel longan anthocyanin biosynthesis regulation gene DlMYB1-HP is characterized in that the synthesis gene DlMYB1-HP is used for regulating anthocyanin biosynthesis.

2. The use of claim 1, wherein the nucleotide sequence of the red-peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP is shown as SEQ ID No. 1.

3. The use of claim 1, wherein the amino acid sequence of the red-peel longan anthocyanin biosynthesis regulatory gene DlMYB1-HP is shown as SEQ ID No. 2.