CN114480138B

CN114480138B - Beauveria bassiana LZ2-1a and application thereof

Info

Publication number: CN114480138B
Application number: CN202210025276.XA
Authority: CN
Inventors: 翟立峰; 幸月; 李景明; 张美鑫; 李嘉利; 李昌满; 张元珍; 张嘉渝
Original assignee: Yangtze Normal University
Current assignee: Yangtze Normal University
Priority date: 2022-01-11
Filing date: 2022-01-11
Publication date: 2023-08-18
Anticipated expiration: 2042-01-11
Also published as: CN114480138A

Abstract

The invention discloses beauveria bassiana LZ2-1a and application thereof, and relates to the technical field of biological control. The strain of the invention is preserved with the preservation number of CCTCC M20211576. The invention also provides application of the strain in preventing and controlling fruit tree insect lygus lucorum; and a biocontrol microbial agent, the active ingredient is spore suspension prepared by the strain of beauveria bassiana; the viable count of beauveria bassiana strain in the spore suspension is not less than 3×10 ⁵ cfu/mL. The beauveria bassiana LZ2-1a is separated from the lygus batryticatus killed by pathogenic fungi, the strain infects healthy lygus officinalis beetles through conidium to cause lygus officinalis beetles to die, the pests die to form stiff worms and grow spores from insect bodies, the spores can spread in the field by wind and rain to further infest more lygus officinalis beetles, so that the damage of lygus officinalis beetles to litchi and longan is effectively controlled, the strain is harmless to ecological environment, the drug resistance of the pests is not caused, the culture condition is simple, and the strain is easy to store.

Description

Beauveria bassiana LZ2-1a and application thereof

Technical Field

The invention belongs to the technical field of biological control, and particularly relates to beauveria bassiana LZ2-1a and application thereof.

Background

Lychee stinkbugTessaratoma papillosaDrury) is also called stinky, belongs to the family of stinky (Hemiptera) bugs, and is one of main pests which harm the production of litchi and longan fruit trees. The insect is widely distributed in south Asia, southeast Asia, chinese Fujian, taiwan, guangdong, guangxi, hainan, yunnan, guizhou, sichuan and Chongqing etc. areas, and mainly hosts such as litchi, longan, goldenrain tree, soapberry family plants, etc. The insects are used for sucking tender tips, flowers and fruits of litchi and longan by using adults and nymphs to cause flower and fruit dropping; adults and nymphs above 3 years old are disease-transmitting mediator insects for transmitting the pathogen of the longan ghost broom disease, and wounds caused by the nymphs are easy to cause downy mildew. The stink liquid emitted when being disturbed is in the positions of tender leaves, young fruits and the like, so that the stink liquid is burnt, and can cause withering of the pistil and the tender leaves or brown zooming of the shells, thereby reducing the quality of the fruits and changing the shells into brown; the odor liquid touches eyes and skin of people, which can cause burning pain, inflammation and inflammation, and affect the operation of the orchard. When the generation is large, the yield of litchi and longan is seriously affected.

In areas such as Fujian, guangdong, guangxi, hainan and the like, lychee bugs can live through winter in a sexually immature adult form for 1 time a year, the lychee bugs usually live through winter in a relatively dense crown-leaf cluster of the lychee tree, until the next 3 th ten days, when the outdoor temperature exceeds 16 ℃, the overwintering adults begin to recover gradually, juice is sucked from the lychee branch tips or the flowers to feed, and when the lychee bugs reach sexual maturity, the lychee bugs can cross and lay eggs, in general, the worm eggs can be laid on the leaf backs of the lychee tree, and a few worm eggs can be laid on the branch tips. 4-5 months each year, new adults will appear successively from the full period of stinkbug spawning to about 6 middle ten days. The adult life is 200-300 d, the total egg laying amount of single female is about 190 grains, and the adult life is about 80-d, and the adult life shows obvious aggregation, phototropism, chromotropism and tenderizing tip tendency in habit.

Because of seasonal restriction and occurrence of lygus bug source as harmful region restriction, the control of the lygus bug is still a strategy taking chemical control as main and agricultural control, physical control and biological control as auxiliary. Among them, the use of pesticides such as organic phosphorus and pyrethroid is still most common, but the damage of the pesticides can be well controlled by multiple treatments and multiple applications of chemical pesticides in one growth cycle in control. The insects have stronger drug resistance, and the dosage and the use times are increased year by year, so that the pesticide residue of fruits exceeds standard, and the pollution-free production of litchi and longan is affected. Therefore, the search for new economic, efficient, green and environment-friendly control technology and path has become the urgent problem to be solved by the current litchi and longan planting industry.

More than 1000 pathogens have been isolated from insects today, and many pathogens have the potential to develop into nuisance free effective pesticides. Up to now 13 species or subspecies of entomopathogenic fungi have been formulated and registered as fungal pesticides (mycins), mainly metarhizium anisopliae of ascomycetesMetarhizium anisopliae) And beauveria bassiana (Beauveria bassiana)Beauveria bassiana). Beauveria bassiana belongs to the phylum of Deuteromycotina, class Cellularomyces, order Combretales, family Combretaceae and genus BeauveriaBeauveria). The beauveria bassiana has the advantages of low production cost, good control effect, high safety to people and livestock, difficult generation of drug resistance to pests, reproducibility, compatibility and the like, and has long been used as an important means for biological pest control, and is widely used for biological pest control of agricultural and forestry pests. The beauveria bassiana has a large specificity on the toxicity of a host, and the toxicity of separate strains from different insect bodies of the same host also has a certain difference, so that the selection of the strain with high toxicity on target pests has become a key for controlling the pests.

Therefore, the beauveria bassiana can prevent and treat plant pests differently according to different strains, and predictability and corresponding implications are not provided.

At present, related researches on beauveria bassiana for preventing lychee stink from damaging lychee and longan are still in a blank stage.

On the planting of litchi and longan, stinkbug happens seriously all the year round, mainly harmful litchi, longan shoots, young stems, flowers and fruits and leaves, resulting in slow growth of plants, falling off of flowers and fruits and spreading of longan ghost viruses, and serious yield reduction of litchi and longan and even no harvest of the whole plant. Because of seasonal restriction and occurrence of lygus bug source as harmful region restriction, the control of the lygus bug is still mainly chemical control.

However, chemical pesticides are not only time-consuming and expensive to prevent, but also have poor prevention and control effects, and influence pollution-free production of longan. Therefore, the application of the beauveria bassiana strain LZ2-1a in lygus lucorum prevention and treatment is developed and disclosed. The biocontrol microbial inoculum provided by the invention has the advantages of simple preparation, low cost, easiness in industrial production, good control effect, no environmental pollution, capability of replacing chemical pesticides to control litchi stinkbug harm fruit trees and good development and application prospects. Ensure pollution-free production of litchi and longan and improve the yield and quality.

Disclosure of Invention

The invention aims to provide beauveria bassiana LZ2-1a and application thereof, so as to solve the existing problems: in the prior art, chemical control is mainly used for controlling the stinkbug of litchis and longans, so that the time and the cost are wasted, the control effect is poor, and pollution-free production is influenced.

In order to solve the technical problems, the invention is realized by the following technical scheme:

the invention provides a beauveria bassiana strain (Beauveria bassiana) LZ2-1a, which is preserved in a preservation unit: china center for type culture Collection; deposit unit address: chinese university of Wuhan; preservation date: 2021, 12, 9; preservation number: cctccc M20211576.

The beauveria bassiana LZ2-1a is applied to the prevention and control of fruit tree pests.

In the application, the fruit tree pests are lygus lucorum.

The active ingredient of the biocontrol microbial agent is spore suspension prepared from the beauveria bassiana LZ2-1a strain.

Further preferred is: the viable count of the beauveria bassiana strain LZ2-1a in the spore suspension is not less than 3 multiplied by 10 ⁵ cfu/mL。

A method of preparing a spore suspension comprising the steps of:

activating the beauveria bassiana strain LZ2-1a on a PDA plate, and then re-suspending the beauveria bassiana strain LZ2-1a by using a sterile PD liquid culture medium to obtain spore and mycelium suspension;

and inoculating the bacterial suspension into PD liquid culture medium in an inoculum size of 1%, shaking and culturing at 100-250rpm and 25-30 ℃ for 48 h-72 h, and obtaining the spore suspension by fermentation liquor.

Further preferred is: wherein 48 h-72 h are cultured in a shaking way at 100-250rpm and 25-30 ℃, and the method comprises the following steps:

60h was cultured with shaking at 200rpm and 25 ℃.

The invention has the following beneficial effects:

1. the beauveria bassiana LZ2-1a is separated from the stiff worm of the lygus lucorum which is killed by pathogenic fungi, the strain infects healthy lygus lucorum through conidium to cause death of lygus lucorum, the stiff worm is formed after death of pests, spores grow out of the worm body, the spores can spread in the field by wind and rain, and further infects more lygus lucorum bodies, so that the damage degree of lygus lucorum on lygus lucorum and longan can be inhibited.

2. After the beauveria bassiana LZ2-1a spore suspension is used for treating healthy lychee bugs, the feeding activity of the lychee bugs is obviously reduced, then the worms die and generate a large number of conidia, and the beauveria bassiana LZ2-1a can effectively inhibit the harm of the lychee bugs, has a good biological control effect on preventing and controlling the harm of the lychee bugs to the lychee bugs and the longan, has good effect on preventing and controlling the harm of the lychee bugs to the lychee bugs, is harmless to the ecological environment, does not cause the drug resistance of pests, has simple culture conditions and is easy to store.

3. The biocontrol microbial inoculum provided by the invention has the advantages of simple preparation, low cost, easiness in industrial production, good control effect, no environmental pollution, capability of replacing chemical pesticides to control litchi stinkbug damage fruit trees and good development and application prospects.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a characteristic diagram of stiff worms in lygus lucorum fields (arrows indicate fungal hyphae);

FIG. 2 is a colony morphology chart of beauveria bassiana LZ2-1a (A, colony morphology in culture 7 d; enlargement of front surface of colony; enlargement of back surface of colony);

FIG. 3 is a chart of the morphology of conidia of beauveria bassiana LZ2-1 a;

FIG. 4 is an ITS sequence-based evolution analysis chart of beauveria bassiana LZ2-1 a;

FIG. 5 is a diagram showing the symptoms of the litchi bug inoculated with the spore suspension of beauveria bassiana LZ2-1a at different concentrations.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The invention aims to provide the paenibacillus LZ2-1a used for preparing the critibuerger, and the strain can prevent and treat the damage of lygus bugs to lychee and longan.

The invention provides a beauveria bassiana strain which is beauveria bassiana strain @Beauveria bassiana) LZ2-1a, deposited in Chinese classicalType culture collection, accession number: the preservation date of the university of Wuhan, wuhan is 2021, 12 months and 9 days, and the preservation number is CCTCC M20211576.

The invention also provides application of the beauveria bassiana strain LZ2-1a in controlling fruit tree insect lygus bugs.

The invention also discloses a biocontrol microbial agent, the active ingredient of which is the beauveria bassiana strain LZ2-1a. The beauveria bassiana strain LZ2-1a is culture spore suspension of the strain. And the viable count of the beauveria bassiana strain LZ2-1a in the spore suspension is not less than 3 multiplied by 10 ⁵ cfu/mL。

In addition, the spore suspension was prepared using the following steps: activating beauveria bassiana strain LZ2-1a on a PDA flat plate, re-suspending with a sterile PD liquid culture medium to obtain spore and mycelium suspension, inoculating the mycelium suspension into the PD liquid culture medium with an inoculum size of 1%, and carrying out shake culture at 120-200 rpm and 25 ℃ for 48 h-72 h, thus obtaining the spore suspension.

For further explanation of the invention, the following specific examples are now provided:

example 1 isolation screening and identification of the Strain beauveria bassiana LZ2-1a

The separation method comprises the following steps: collecting lygus lucorum dead worm killed by pathogenic fungi from Hejiang county in Luzhou, sichuan province (figure 1), sterilizing 75% alcohol surface, cutting 5 mm square tissue blocks, sequentially treating with sodium hypochlorite for 1 min,75% alcohol for 1 min, washing with sterile water for 3 times, air drying with sterile filter paper, inoculating to PDA solid medium (potato 200 g, glucose 20 g, agar 15 g, distilled water 1L), and culturing. The plate was incubated at 25℃for 5-7 days. Different fungi were selected according to the morphology, mycelium color, etc. of the fungus colonies screened on the plate and transferred to fresh PDA plates for cultivation.

The identification method comprises the following steps: the morphological characteristics of the isolated and purified strain LZ2-1a were identified, and the bacterial colonies on the front side of the strain plate were observed to be milky white in the initial stage of culture, and then slightly changed to pale yellow, and the spore layers were thick and uniform, covering the whole bacterial colonies (FIG. 2A). Fewer spores were found at the edge of the colonies and a small amount of mycelium was seen (FIG. 2B). When 7. 7 d was incubated at 25℃on PDA medium, the colony diameter reached 30.1. 30.1 mm, and concentric rings were raised from the center to 1/2 of the edge of the colony (FIG. 2B). The back of the colonies was yellow (FIG. 2C). The nutritional mycelium is colorless, the conidiophore is on the nutritional mycelium, the conidiophore is on mycelium or vesicle cluster, the conidiophore is transparent, smooth, spherical or nearly spherical, and the diameter is 2.3-3.5 μm (figure 3).

The DNA of the strain LZ2-1a is extracted by using a fungus genome DNA rapid extraction kit of Shanghai biological engineering Co., ltd, and then PCR amplification is carried out by adopting eukaryote ITS-rDNA universal primers ITS1 and ITS4 to obtain an amplified transcription spacer ITS sequence fragment, and the amplified fragment is sequenced, wherein the specific sequence is shown as SEQ ID NO. 1. The sequence is compared with beauveria bassiana by BLAST in GenBankBeauveria bassiana) Closest in relation, the homology is highest. By constructing phylogenetic tree on ITS sequences of LZ2-1a and other representatives of beauveria, the results show that LZ2-1a andBeauveria bassianathe representative strains are gathered on the same branch (figure 4) and are new strains, and the strains are determined to be beauveria bassiana by combining morphological identification resultsBeauveria bassiana) The beauveria bassiana LZ2-1a is named.

EXAMPLE 2 application of the strain Beauveria bassiana LZ2-1a

1. Spore-forming fermentation of beauveria bassiana LZ2-1a strain

Transferring beauveria bassiana LZ2-1a on fresh PDA plate for activating, scraping spores to obtain spore suspension, shaking culturing in equal amount of inoculated PD liquid culture medium (potato 200 g, glucose 20 g, distilled water 1L) at 200rpm, 10deg.C, 15deg.C, 20deg.C, 25deg.C, 30deg.C and 35deg.C, and initial spore concentration of about 4.61×10 ⁴ mu.L of culture medium was taken every 24. 24 h per mL to detect sporulation, and spore concentration of the strain was measured by a hemocytometer. The results show that: the culture solution at 25℃and 30℃became turbid at 24℃ 24 h, but no conidia were produced, only mycelia were found. The culture medium cultured at 10 ℃,15 ℃ and 35 ℃ has no obvious change; at 48h, spores were produced by the strain cultured at 20 ℃,25 ℃ and 30 ℃ and the spore concentration was measuredRespectively about 2.02 x 10 ⁷ 、5.28×10 ⁷ And 1.23×10 ⁸ Only mycelium was seen at 15℃per mL, while only a small amount of spores germinated at 10 ℃. The germination rate of spores at 10deg.C and 35deg.C is 84.66% and 17.02% respectively when 72h is cultured, while the concentration of a large number of conidium in 15 deg.C, 20 deg.C, 25 deg.C and 30 deg.C culture solution reaches 2.75X10 respectively ⁷ 、5.59×10 ⁷ 、8.75×10 ⁸ And 2.09×10 ⁸ Therefore, the proper fermentation spore-producing temperature of beauveria bassiana LZ2-1a is 25-30 ℃.

Will contain spores at a concentration of about 4.61X 10 ⁴ The spore suspension was cultured in shaking at 30℃and a rotational speed gradient of 50rpm, 100 rpm, 150 rpm, 200rpm and 250rpm, and 20. Mu.L of the culture broth was used for culturing 60h to measure spore production, and the spore concentration of the strain was measured by a hemocytometer. The results show that: when 48h was cultured at 50rpm, the PA medium was clear, and flocculent hyphae were present in the medium, and no conidium was produced. The medium became significantly turbid at 100 rpm, 150 rpm, 200rpm and 250rpm, and was milky white, and the concentration of conidia was measured to be 1.72X10 ⁸ 、1.69×10 ⁸ 、2.02×10 ⁸ And 1.68X10 ⁸ Therefore, the fermentation and spore-forming culture speed of beauveria bassiana LZ2-1a is preferably 100-250rpm, but 200rpm is most preferably.

In summary, the spore-forming fermentation conditions of the strain beauveria bassiana LZ2-1 a: culturing at 25-30deg.C and 100-250rpm for 60h to obtain 10 ⁸ The above molecular spores.

2. Living body control effect determination of bacterial strain LZ2-1a

Treating lygus larva and adults by soaking in the solution of 0.05% Tween-80 to obtain 1×10 ⁴ 、1×10 ⁵ 、1×10 ⁶ 、1×10 ⁷ And 1X 10 ⁸ spore/mL spore suspension with 5 concentration gradients, one treatment for each concentration, was treated with sterilized 0.05% tween-80 solution as control. Selecting 3-4-year larva and adult with the same individual size, placing into suspension with spore concentration to be tested, soaking for 30 s, picking, placing on filter paper to absorb excessive water, and transferring to dish bottom to moistenIn a filter paper dish (d=30 cm), enough fresh litchi and longan tender leaves are placed in the dish for feeding. The treated worms were kept in a climatic chamber (25.+ -. 1 ℃ C., RH 80%.+ -. 5%). Each treatment of 10 larvae and adults was repeated 3 times, and observations were started after 24-h inoculations, 6 d were continued, the number of insect deaths recorded daily, and the moist observations were made on the dead larvae to determine whether they were infected with bacteria to cause death. Recording the onset condition of lygus lucorum.

As can be seen from FIG. 5, both lygus lucorum larvae and adults can be infected with strain LZ2-1a after culturing 3 d. In the early stage of bacteria sensing, the feeding behavior of lygus lucorum and the external morphology of the insect body are not different from those of healthy insect bodies. After inoculation of 2 d, larval feeding is significantly reduced or stopped and part of the larvae die. After inoculation with 4 d, both lygus larvae and adults present with beauveria bassiana infection to a lethal individual. After inoculation 6 d, the body surface of the infected insects was covered with a large number of hyphae and conidia, which were white (fig. 5). Measurement of 1×10 ⁶ The viable count of the spore suspension was about 3.19X10 ⁵ cfu/mL. Inoculated spores at a concentration of 1X 10 ⁴ 、1×10 ⁵ And control worms did not develop disease.

In conclusion, the beauveria bassiana of the inventionBeauveria bassiana) The strain LZ2-1a can effectively kill lygus lucorum, has better biological control effect, does not cause environmental pollution, and can replace pesticides to control lygus lucorum.

The preferred embodiments of the invention disclosed above are intended only to assist in the explanation of the invention. The preferred embodiments are not exhaustive or to limit the invention to the precise form disclosed. Obviously, many modifications and variations are possible in light of the above teaching. The embodiments were chosen and described in order to best explain the principles of the invention and the practical application, to thereby enable others skilled in the art to best understand and utilize the invention. The invention is limited only by the claims and the full scope and equivalents thereof.

SEQ ID NO.1

GCCCTCGGGCTTACTCCCTACCCTTCTGTGACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGGCGGGAGGAACCACCTAATACCTCT

Sequence listing

<110> Yangtze Master school

<120> beauveria bassiana LZ2-1a and application thereof

<130> FA1606

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 555

<212> DNA

<213> Beauveria bassiana (Beauveria bassiana)

<400> 1

gccctcgggc ttactcccta cccttctgtg acctacctat cgttgcttcg gcggactcgc 60

cccagcccgg acgcggactg gaccagcggc ccgccgggga cctcaaactc ttgtattcca 120

gcatcttctg aatacgccgc aaggcaaaac aaatgaatca aaactttcaa caacggatct 180

cttggctctg gcatcgatga agaacgcagc gaaatgcgat aagtaatgtg aattgcagaa 240

tccagtgaat catcgaatct ttgaacgcac attgcgcccg ccagcattct ggcgggcatg 300

cctgttcgag cgtcatttca accctcgacc tccccttggg gaggtcggcg ttggggaccg 360

gcagcacacc gccggccctg aaatggagtg gcggcccgtc cgcggcgacc tctgcgtagt 420

aatacagctc gcaccggaac cccgacgcgg ccacgccgta aaacacccaa cttctgaacg 480

ttgacctcga atcaggtagg actacccgct gaacttaagc atatcaaaag gcgggaggaa 540

ccacctaata cctct 555

Claims

1. Beauveria bassiana (Beauveria bassiana) LZ2-1a, characterized by: the beauveria bassiana LZ2-1a is preserved in China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC M20211576 in the 12 th month 9 of 2021.

2. The use of beauveria bassiana LZ2-1a according to claim 1 for controlling fruit tree pests, which are lygus bugs.

3. A biocontrol microbial agent is characterized in that: the active ingredient of the biocontrol microbial agent is spore suspension prepared from the beauveria bassiana LZ2-1a strain in claim 1.

4. The biocontrol microbial agent of claim 3, wherein: the viable count of the beauveria bassiana strain LZ2-1a in the spore suspension is not less than 3 multiplied by 10 ⁵ cfu/mL。

5. A method for preparing a spore suspension, characterized by: the method comprises the following steps:

activating beauveria bassiana LZ2-1a according to claim 1 on a PDA plate, and then re-suspending the activated beauveria bassiana LZ2-1a on a sterile PD liquid medium to obtain spore and mycelium suspension;

inoculating the spore and mycelium suspension into PD liquid culture medium with 1% of inoculation amount, shake culturing at 100-250rpm and 25-30deg.C for 48-72 h, and fermenting to obtain the spore suspension.

6. The method of manufacturing according to claim 5, wherein: the conditions of the shaking culture are as follows:

shaking culture was performed at 200rpm and 25℃for 60 hours.