CN112625913A

CN112625913A - Beauveria bassiana, application thereof in preventing and treating tea tree leaf-eating beetles and microbial inoculum

Info

Publication number: CN112625913A
Application number: CN202011331734.XA
Authority: CN
Inventors: 王定锋; 李良德; 李兆群; 吴光远
Original assignee: Tea Research Institute Fujian Academy of Agricultural Sciences
Current assignee: Tea Research Institute Fujian Academy of Agricultural Sciences
Priority date: 2020-11-24
Filing date: 2020-11-24
Publication date: 2021-04-09

Abstract

The invention belongs to the technical field of biological control of agricultural and forestry pests, and particularly relates to beauveria bassiana, application thereof in controlling tea tree leaf eating beetles and a microbial inoculum, wherein the beauveria bassiana is named as FJBb1338, and the preservation number is as follows: CGMCC No. 20253. The invention provides an application of beauveria bassiana in prevention and treatment of tea tree leaf-eating beetles. The invention also provides a microbial inoculum for preventing and controlling the tea tree leaf eating beetles. The invention has the beneficial effects that: the beauveria bassiana FJBb1338 strain has high growth speed and strong spore production capacity, and the microbial inoculum using the strain can obviously reduce the population quantity of the leaf-feeding beetles in tea gardens. Meanwhile, the strain can be stored in a tea garden for a long time, has strong secondary infection capacity, and is suitable for biological control of leaf-eating beetles in the tea garden.

Description

Beauveria bassiana, application thereof in preventing and treating tea tree leaf-eating beetles and microbial inoculum

Technical Field

The invention belongs to the technical field of biological control of agricultural and forestry pests, and particularly relates to beauveria bassiana, application of the beauveria bassiana in control of tea tree leaf-eating beetles and a microbial inoculum thereof.

Background

Tea tree leaf eating beetles are coleoptera pests (such as tea leaf weevil, tea large ash weevil, tea aphid thick leg weevil, tea horn chest leaf beetle and the like) eating tea tree buds and leaves, and the pests are widely distributed in each main tea production area in China and often outbreak disasters in local tea gardens. The pests occur one generation in one year, and the leaves of the tea trees are bitten by adults to cause notches or holes, so that the yield and the quality of the tea leaves are seriously influenced. Wherein the Chaliwenxiangjia and Chaihei are harmful to Camellia oleifera, Camellia japonica, Mandarin orange, fructus Pyri, and fructus Persicae, etc.

For a long time, the prevention and control of the beetles mainly takes chemical prevention and control as well as agricultural prevention and control and physical prevention and control. The agricultural 3R problem caused by long-term large-scale use of chemical pesticides seriously damages the ecological environment and harms human health. In recent years, with the growing concern of people on the safety problem of tea food and the rising of organic tea planting, how to safely and effectively control the pests in the tea production process becomes a problem to be solved urgently.

Beauveria bassiana (hereinafter referred to as "Beauveria bassiana") belongs to the classes of Hyphomycetes, Moniliales and Moniliaceae and is a broad-spectrum entomopathogenic fungus. Beauveria bassiana is reported to parasitize more than 700 insects and acarids of 149 order, and plays an important role in the biological control of agricultural and forestry pests.

Disclosure of Invention

The invention provides beauveria bassiana, application thereof in preventing and controlling tea tree leaf-eating beetles and a microbial inoculum thereof.

The technical scheme of the invention is as follows: providing Beauveria bassiana (Beauveria bassiana) named FJBb1338, which is preserved in China General Microbiological Culture Collection Center (CGMCC) at 31.8.2020, and addresses: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, with the deposit number: CGMCC No. 20253.

Further, the culture characteristics of the beauveria bassiana are as follows: the bacterial colony grows for 5 days on a Sabouraud's medium at 25 +/-1 ℃, the diameter of the bacterial colony is 17.83mm, the diameter of the bacterial colony reaches 51.5mm after 15 days, the bacterial colony is white to milky white, the bacterial colony is felty at the beginning, a creamy spore layer is formed at the later stage, and the spore layer is thick and uniform.

Further, the above beauveria bassiana is characterized in that: hyphae are branched and have lattices, are colorless and smooth, spore-forming cells densely cluster on short and expanded stem cells, are in a bottle shape, are in a zigzag shape at the upper part of the spore-forming cells, and the top ends of the spore-forming cells become slender; the conidium is spherical or nearly spherical, single cell, transparent and smooth.

The other technical scheme of the invention is as follows: provides an application of the beauveria bassiana in preventing and controlling tea tree leaf-eating beetles.

Further, the method of the above application is: and directly sprinkling powder containing conidia of the beauveria bassiana in the rhizosphere soil of the tea trees in 1-2 months each year.

Further, the method of the above application is: spraying a spore suspension containing conidia of the beauveria bassiana between tea lines at 4-5 months per year.

The invention also adopts the technical scheme that: there is provided a fungicide for controlling tea tree leaf eating beetle comprising beauveria bassiana according to claim 1.

Furthermore, in the microbial inoculum for controlling tea tree leaf eating beetle, the microbial inoculum is spore suspension, and the concentration of the spore suspension is 5.0 multiplied by 10⁷Spores/ml.

Further, in the microbial inoculum for controlling tea tree leaf eating beetle, the microbial inoculum is powder, and the spore content of the powder is (1.0-1.6) multiplied by 10¹⁰Spores/g microbial inoculum.

The invention has the beneficial effects that: the beauveria bassiana FJBb1338 strain has high growth speed and strong spore production capacity, has strong pathogenicity to tea tree leaf eating beetles (tea leaf weevil, tea large ash weevil, tea aphid crusty weevil and tea horned and thorny leaf beetles), and is inoculated with 5.0 multiplied by 10 by an insect immersion method in indoor bioassay⁷The cumulative corrected mortality rates of spore/ml spore suspension, beauveria bassiana FJBb1338 to tea leaf spot weevil, tea leaf large ash weevil, tea aphid coarse leg weevil and tea horn leaf beetle are respectively 100%, 9%1.41%, 84.85% and 100%; the stiff worm rate reaches 77.78 percent, 63.89 percent and 86.11 percent; LT (LT)₅₀Days 4.03, 4.38 and 3.32.

Ditching between tea rows in the tea garden in 1-2 months each year, mixing 3-5 jin of solid fermentation product (powder) with fine soil, uniformly spreading the mixture in the soil, and covering the soil. Direct broadcast may also be possible if the tea row is not trenched. The powder is directly spread, and the late period of the inhibition rate of the emergence of the pseudolarix theophyllum can reach more than 80 percent. Preparing the solid fermentation product into about 4.0 × 10 in the period of 4-5 months per year when the beautiful line weevil of tea is out of soil⁸The prevention and treatment effect on the phyllorhinus chaxinus can reach more than 95 percent 14 days after the interline spraying of spore/ml spore suspension tea.

The microbial inoculum obtained by the strain can be used for preventing and treating and can obviously reduce the population quantity of the tea garden with the pseudopteroma lanciformis. Meanwhile, the strain can be stored in a tea garden for a long time, has strong secondary infection capacity, and is suitable for biological control of the beautiful striated weevil in the tea garden.

Drawings

FIG. 1 shows an imago of West tea West beetle and its infection with Beauveria bassiana FJBb1338 according to an embodiment of the present invention;

FIG. 2 is a colony morphology chart of FJBb1338 strain cultured on SDAY medium at 25. + -. 1 ℃ for 14 days;

FIG. 3 is a phylogenetic tree of FJBb1338 based on ITS sequences;

biological preservation

The invention discloses Beauveria bassiana (Beauveria bassiana) named as FJBb1338, which is preserved in China General Microbiological Culture Collection Center (CGMCC) at 31.8.2020, and the address is as follows: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, with the deposit number: CGMCC No. 20253.

Detailed Description

In order to explain technical contents, structural features, and objects and effects of the present invention in detail, the following detailed description is given with reference to the accompanying drawings in conjunction with the embodiments.

Example 1

The beauveria bassiana provided by the invention has the following chemical name: beauveria bassiana (balls.) Vuill, named FJBb1338, has the following characteristics: the strain is separated from a stiff larva of the weevil tea collected in a tea garden tested by the institute of tea research of agriculture academy of sciences of Oneka, Fujian, province, and the like, and grows on a Sasa medium (SDAY) at 25 +/-1 ℃ for 5 days, wherein the diameter of a colony is 17.83mm, and the diameter of the colony is 51.5mm in 15 days. The colony is white to milk white, felt at the beginning, and forms a creamy spore layer at the later stage, and the spore layer is thick and uniform. Hyphae are branched, have lattices, are colorless and smooth and sometimes grow in clusters; the spore-forming cells (phialides) are densely clustered on short and expanded stalk cells, are in a bottle shape, are in a zigzag shape at the upper part of the spore-forming cells, and have slender tops. The conidiophore is spherical or nearly spherical, single cell, transparent, smooth, 1.8-2.8 × 2-2.7 μm. The optimal growth temperature is 23-28 ℃.

The invention also provides a microbial inoculum for preventing and controlling the tea tree leaf-eating beetles. The microbial inoculum is specifically spore suspension or powder. Wherein the concentration of spore suspension is 5.0 × 10⁷Spore/ml, powder spore content of 1.0-1.6 × 10¹⁰Spores/g microbial inoculum. The effective component of the microbial inoculum provided by the invention is conidium of the Beauveria bassiana (Beauveria bassiana) FJBb 1338.

Conidia in the microbial inoculum provided by the invention are obtained by taking the Beauveria bassiana (Beauveria bassiana) FJBb1338 strain as a strain and performing solid fermentation culture. After the Beauveria bassiana (Beauveria bassiana) FJBb1338 strain is subjected to liquid fermentation and inoculated on a solid culture medium consisting of wheat bran, rice husk and sawmilling powder for solid fermentation for 10-14 days, the sporulation amount of a fermentation product is 10-16 multiplied by 10⁹Spores per gram of powder.

The Beauveria bassiana (Beauveria bassiana) FJBb1338 provided by the invention has the following beneficial effects: the strain has high growth speed and strong spore production capability, and has strong pathogenicity to tea tree leaf eating beetle (such as tea leaf weevil, tea ash weevil, tea aphid crusty weevil and tea horn leaf beetle), and indoor bioassay adopts an insect immersion method to inoculate 5.0 × 10⁷Spore/ml spore suspension, the cumulative corrected mortality of beauveria bassiana FJBb1338 to the three-spotted pangolin, the three-spotted pangolin and the three-spotted branchlet of tea aphid are respectively 100%, 91.41%, 84.85% and 100%; stiff insectThe rate reaches 77.78%, 63.89%, 63.89% and 86.11%; LT (LT)₅₀Days 4.03, 4.38 and 3.32. Using beauveria bassiana FJBb1338 as a strain, performing shake flask culture on a potato liquid culture medium for 3 days, inoculating the strain on a solid culture medium consisting of wheat bran, rice husk and sawmilling powder, performing solid fermentation for 14 days, and obtaining a fermentation product with the spore yield of 1.0-1.6 multiplied by 10¹⁰Spores per gram of powder. The solid fermentation product (powder) is directly scattered in the rhizosphere soil of the tea trees in 1 to 2 months per year, and the late-stage tea beautiful line weevil emergence inhibition rate can reach more than 80 percent. Preparing the solid fermentation product into about 4.0 × 10 in the period of 4-5 months per year when the beautiful line weevil of tea is out of soil⁸The prevention and treatment effect on the phyllorhinus chaxinus can reach more than 95 percent 14 days after the interline spraying of spore/ml spore suspension tea. The microbial inoculum using the strain can obviously reduce the quantity of the pseudopteroma theophragmatis population in the tea garden. Meanwhile, the strain can be stored in a tea garden for a long time, has strong secondary infection capacity, and is suitable for biological control of the beautiful striated weevil in the tea garden.

Referring to FIGS. 1 and 2, FIG. 1 shows an adult Leptospira xylostella and its infection with Beauveria bassiana (FJBb 1338). FIG. 2 is a colony morphology chart of FJBb1338 strain cultured on SDAY medium at 25. + -. 1 ℃ for 14 days.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The media in the following examples: saki medium (SDAY): 4% glucose, 1% yeast, 1% peptone, 2% agar, pH 7.0. Sterilizing the autoclave at 121 ℃ for 20 min.

Example 2 isolation and identification of Beauveria bassiana FJBb1338 of the present invention

1. Isolation of Beauveria bassiana FJBb1338

A test strain is obtained from a tea garden of the institute of tea, agricultural and scientific institute of Olympic institute of Fujian province, Fujian city, Kouyanzhou province, and the test strain is obtained by collecting adult bodies of the insect of the Hemophilus giganteus, disinfecting the surfaces of the bodies with a 5% sodium hypochlorite solution, cutting the bodies into small pieces with a scalpel, inoculating the small pieces into a selective medium of multi-fruit oats, separating and purifying, and obtaining a pure culture of the strain named as Beauveria bassiana (Beauveria basssana) FJBb 1338.

2. Identification of beauveria bassiana FJBb1338

(1) Morphological identification

The beauveria bassiana FJBb1338 colony on the SDAY culture medium is white felt-shaped, and a white spore layer is formed from the center of the colony after 5 days of culture. The strain was cultured at 25 ℃ for 14D at 12L/12D and the colony diameter was about 60 mm. Hypha is branched, colorless and smooth; spore-forming cells (phialides) frequently cluster densely on hyphae or conidiophores, are in the shape of a bottle, and are usually characterized by a long filament at the neck, 1 μm thick, and a spore-forming axis as long as 15 μm. Conidia are transparent, smooth, mostly spherical or nearly spherical, with a diameter of about 2.0-3.0 μm, and often grow on zigzag curved peduncles.

(2) Molecular biological identification

The rDNA-ITS sequence of the strain is amplified by PCR by using genomic DNA of beauveria bassiana FJBb1338 as a template and adopting fungus universal primers ITS5(5'-GGAAGTAAAAGTCGTAACAAGG-3' (SEQ ID No: 1)) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID No: 1)) designed by White and the like. The PCR reaction system is as follows: 10 XEx Taq Buffer (Mg)²⁺Plus) 5. mu.L, d NTP Mix (2.5 mM each) 4. mu.L, template DNA 1.5. mu.L, primers (10mmoL) 1.5. mu.L each, TaKaRa Ex Taq (5U/. mu.L) 0.5. mu.L, ddH²O36. mu.L, 50. mu.L in total. The PCR reaction program is: 5min at 94 ℃; 30s at 94 ℃ and 30s at 56 ℃; 30s at 70 ℃ for 30 cycles; extension at 70 ℃ for 5 min. The PCR product is recovered and purified after being detected by 1 percent agarose gel electrophoresis, and is sent to the company Limited of biological engineering (Shanghai) for sequencing to obtain a gene fragment of 594 bp.

The gene sequence is as follows: 5'

GGAAGTAAAAATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA 3’(SEQ ID No：3)

Homology analysis of the gene fragment with the gene sequence in GenBank was carried out by the Blastn program (http:// blast. ncbi. nlm. nih. gov/blast. cgi), and most of the sequences having 99% similarity to the rDNA-ITS sequence of strain FJBb1338 were found to be Beauveria bassiana. To further clarify the relationship between strain FJBb1338 and other common entomogenous fungi, ITS sequences of several representative Beauveria bassiana strains published in GenBank were selected, and outer groups of Cordyceps militaris ARSEF 5050 and Isaria tendipes ARSEF 4096 were used, after alignment by ClustalX, phylogenetic trees were constructed by the MEGA4.0 software adjacency method (Bootstrap value 1000). Phylogenetic trees showed that FJBb1338 was clustered with other beauveria bassiana strains on a smaller molecule with a recent relationship (see figure 3 for ITS sequence-based FJBb1338 phylogenetic trees). And (3) identifying the strain FJBb1338 as beauveria bassiana by combining the identification results of morphology and molecular biology.

Example 3 growth rate, spore yield and spore germination rate of beauveria bassiana FJBb1338 strain according to the present invention

0.2mL of spore suspension (1.0X 10) was added using a triangular glass rod⁶spores/mL) were spread evenly on SDAY plates for 5D, then fresh clumps were punched out of the plates with a 6mm diameter punch and seeded on SDAY plates, and cultured at 25 ℃, under 12L/12D light conditions, 3 replicates. The colony diameters were measured by the ruler cross method for 5 days, 10 days and 15 days of culture. The results of the assay showed that the colony diameter of the beauveria bassiana strain FJBb1338 cultured on SDAY plates for 15 days could reach 51.5mm (Table 1). A piece of the colony cultured on the SDAY plate for 14d is randomly punched from the center to the edge 1/2 by a punch with the diameter of 6mm, the piece of the colony is placed into a triangular flask (50mL) containing 20mL of germination solution, the mixture is fully stirred by a magnetic stirrer and then placed at 130r/min and 25 ℃ for shake-flask culture for 18 h. Counting by using a blood counting chamber, and calculating the spore yield and the spore germination rate. The determination result shows that the beauveria bassiana strain FJBb1338 is cultured on an SDAY plate for 14d, and thenThe spore yield per unit area is 2.81X 10⁶Spores/mm 2; the spore germination rate was 90.94% (table 2).

TABLE 1 growth rates of the strains

TABLE 2 spore production and spore germination rates of the strains

Example 4 the virulence of beauveria bassiana FJBb1338 on tea tree leaf-feeding beetles

The beauveria bassiana FJBb1338 is used for indoor live test of tea tree leaf eating beetles (tea leaf weevil, tea large ash weevil, tea aphid crunchy weevil and tea horn thoraca) and treated by an insect soaking method, and the tea leaf weevil, the tea large ash weevil, the tea aphid crunchy weevil and the tea horn thoraca adult are inoculated with bacteria (5.0 multiplied by 10)⁷spores/mL) were placed in a 1L plastic cup and fed with fresh tea shoots coated on their bases with moistened sterile cotton wool. Sealing the plastic cup mouth with gauze, placing in a climatic chamber with 25 deg.C, 95% humidity, and 12L/12D photoperiod, and replacing new tea shoot for 1 time every 2D. Each beetle was treated with 1 treatment, 12 adults each, 3 replicates, and 0.05% tween-80 solution was used as a control. The death of the leaf beetles was investigated once a day, starting at 2d after the inoculation treatment. If dead insects are found, the dead insects are removed from the plastic cup and placed in a sterile culture dish for moisture preservation and culture, and whether hyphae grow on the dead insects or not is observed. The median lethal time was calculated using the probit method in the SPSS software (LT 50). The mortality, corrected mortality and botany rate (macroscopic hyphae and spores growing on the insect corpses) were calculated as follows:

cumulative mortality (%). mortality vs. total number of worms treated x 100.

Cumulative corrected mortality (%) — cumulative mortality of treatment group-cumulative mortality of control group)/(1-cumulative mortality of control group) × 100.

The stiff insect rate (%) — the number of worms that form stiff insects after death/total number of treated insects × 100.

Indoor bioassay results show (tables 3-6), the total corrected mortality rates of beauveria bassiana FJBb1338 on the three-spotted pangolin, the three-spotted pangolin and the three-spotted branchlet of tea aphid are respectively 100%, 91.41%, 84.85% and 100% after inoculation for 7 days; the stiff worm rate reaches 77.78 percent, 63.89 percent and 86.11 percent; LT (LT)₅₀Days 4.03, 4.38 and 3.32.

TABLE 3 pathogenicity of Beauveria bassiana FJBb1338 to the West Chaxinus Linnaeus

TABLE 4 pathogenicity of Beauveria bassiana FJBb1338 to tea large ashbya

TABLE 5 pathogenicity of Beauveria bassiana FJBb1338 to Calliopsis chayote

TABLE 6 virulence of Beauveria bassiana FJBb1338 on Camellia sinensis

EXAMPLE 5 production of beauveria bassiana FJBb1338 powder

1. The culture of liquid spawn includes the following steps:

1.1 slant culture: the beauveria bassiana FJBb1338 strain is taken out from a-80 ℃ refrigerator and is transferred to a slant culture medium (potato dextrose agar medium, PDA) to be activated at 25 ℃. The method can be used when the surface of the inclined plane is full of spores.

1.2 rice seed culture: transferring the spores obtained in the step 1 into a sterilized rice culture medium, and culturing at 25 ℃ for 7 days. And (5) carrying out the next operation when the rice culture medium is full of spores.

1.3 liquid medium: preparing potato glucose liquid culture medium (PDA without agar component), subpackaging in 1L triangular flasks each containing 500mL of culture medium, and sterilizing at 121 deg.C under high temperature with steam for 25 min. Cooling and then standby. In the sterile operating station, the sporulated rice seeds were inoculated directly into the liquid medium. Culturing for 72h in a constant temperature shaking incubator at 25 + -1 deg.C under shaking (100rpm/min), inoculating into solid culture medium after viscous mycelium grows, and performing Beauveria bassiana solid fermentation.

2, solid fermentation, comprising the following steps:

2.1 formula and preparation of solid culture medium:

the formula of the beauveria bassiana solid culture medium comprises the following components: wheat bran by volume ratio: rice husks: sawmilling powder is 55%: 40%: 5 percent, and after being mixed evenly, 400ml of water is added into every 500g of culture medium for even mixing.

The preparation method comprises the following steps: weighing each component of the solid culture medium respectively, adding water, stirring, placing into polyethylene bag, placing into autoclave, sterilizing with steam at 121 deg.C for 50min, and cooling.

2.2 inoculation:

the culture is carried out in a closed room which is subjected to space sterilization in advance, liquid strains are poured into a solid culture medium according to the inoculation amount of 15 percent, are uniformly stirred, are filled into an iron basin (the thickness of the culture medium is 8cm) which is subjected to surface sterilization in advance, and are then transferred to a shelf of a fermentation room for culture.

2.3 solid culture:

controlling the temperature of the fermentation chamber at 22 +/-1 ℃, and after 4 days, carrying out solid cultureThe substrate is full of mycelia. And (3) from the 5 th day, controlling the temperature in the culture room to be 25 +/-2 ℃ and the humidity to be about 80%, continuously culturing, and after 10 days, placing the fermentation product in a cool and ventilated place to be dried to obtain coarse powder after white or pale yellowish white spores grow inside and outside the solid material. The coarse powder is crushed by a crusher to obtain the beauveria bassiana powder. Weighing 5g of Beauveria bassiana powder at random, diluting with 0.05% Tween-80 solution, counting with blood counting chamber, and measuring the spore content of the Beauveria bassiana powder at 1.0-1.6 × 10¹⁰The spore/g of the microbial inoculum.

Example 6 field control of Beauveria bassiana FJBb1338 on Wedelia theophylla

In 2016, 1 month and 10 days, a beauveria bassiana field broadcasting control effect test is carried out in a tea garden tested by tea institute of rural institute of Fujian province in Town of Fuan city, and the variety of the tea tree is Fuyun No. 8. Processing and ditching tea rows in the tea garden, mixing fine soil with 4 jin of powder per mu of tea garden, uniformly spreading the mixture into the soil, and covering the soil. The control group tea garden was dusted with fine soil (no bacterial powder). About 150m per process (cell)²Three replicates. On 15 days in 4 months, five-point sampling method is adopted, and each cell is 5 and 1m²And (4) surveying the number of the emerged weevil imagoes by using a plastic film paving and beating method. The investigation shows that the inhibition rate of the emergence of the pseudopteroma esculentum in the treated group can reach more than 80 percent (table 7).

TABLE 7 inhibition of the soil emergence of the pseudolarix theophylla by broadcast application of FJBb1338 fungal powder

In 2017, the tea tree variety is Fuyun No. 6, wherein the tea tree variety is Fuyun 10, 5-9, and the beauveria bassiana field spray control effect test is carried out in a tea garden tested by tea institute of Nocko, Fujian province and agricultural academy of Tokyo, Fuan city. The tea garden is divided into a spray area and a blank control area, and each treatment (cell) is about 100m²Three replicates. The method adopts a leaf surface spraying method for preventing and treating, and comprises the following specific operations: the medicine is dispensed by a medicine barrel, and the amount of the medicine liquid is 45-75 kilograms per mu. The preparation method comprises the following steps: adding 1 jin of microbial inoculum into 15 kg of water, adding 15mL of Tween-80, stirring, scrubbing the scum sufficiently, filtering with double-layer medical gauze, and spraying the filtrate in a backpack mannerThe device is used for spraying the pesticide in a forward mode according to a spraying method. After spraying, 3 hours. In each cell, a five-point sampling method is adopted, 15 weevils are collected at each sampling point and are arranged in a nylon tuck net with the length of 35cm multiplied by 25 cm. Randomly collecting 5-8 tea shoots in a tea spraying garden, placing the tea shoots in each net bag, and hanging the net bags on the middle lower parts of the tea trees in sampling points. And investigating the death number of insect mouths in the net bag at 7d and 14d after spraying, and investigating the stiff insect rate after treating for 30 days. Adding a proper amount of fresh branch tips into the net bag for feeding according to the feeding condition after each investigation. A tea garden sprayed with 0.1% Tween-80 in water was used as a Control (CK). The sampling and investigation method is the same as the tea garden sprayed with the microbial inoculum. The test result of the Liwenjia tea garden community shows that the corrected mortality rate is 49.93% when the tea garden is treated for 7 d; corrected mortality was 95.59% at treatment 14 d; the treatment group catalepsy rate was 98.0% at 30d treatment (table 8).

TABLE 8 field control of Beauveria bassiana FJBb1338 on Chaliwensis

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes performed by the present specification and drawings, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.

SEQUENCE LISTING

<110> tea research institute of agricultural science institute of Fujian province

<120> beauveria bassiana, application thereof in preventing and treating tea tree leaf eating beetles and microbial inoculum

<130> 2020

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence

<400> 1

ggaagtaaaa gtcgtaacaa gg 22

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

tcctccgctt attgatatgc 20

<210> 3

<211> 594

<212> DNA

<213> Beauveria bassiana FJBb1338

<400> 3

ggaagtaaaa atcgtaacaa ggtctccgtt ggtgaaccag cggagggatc attaccgagt 60

tttcaactcc ctaacccttc tgtgaaccta cctatcgttg cttcggcgga ctcgccccag 120

cccggacgcg gactggacca gcggcccgcc ggggacctca aactcttgta ttccagcatc 180

ttctgaatac gccgcaaggc aaaacaaatg aatcaaaact ttcaacaacg gatctcttgg 240

ctctggcatc gatgaagaac gcagcgaaat gcgataagta atgtgaattg cagaatccag 300

tgaatcatcg aatctttgaa cgcacattgc gcccgccagc attctggcgg gcatgcctgt 360

tcgagcgtca tttcaaccct cgacctcccc ttggggaggt cggcgttggg gaccggcagc 420

acaccgccgg ccctgaaatg gagtggcggc ccgtccgcgg cgacctctgc gtagtaatac 480

agctcgcacc ggaaccccga cgcggccacg ccgtaaaaca cccaacttct gaacgttgac 540

ctcgaatcag gtaggactac ccgctgaact taagcatatc aataagcgga ggaa 594

Claims

1. Beauveria bassiana (Beauveria bassiana) named FJBb1338, which is preserved in China general microbiological culture Collection center (CGMCC) at 8-31.2020 with the preservation number: CGMCC No. 20253.

2. Beauveria bassiana according to claim 1, which is characterized by being cultured in the presence of: the bacterial colony grows for 5 days on a Sabouraud's medium at 25 +/-1 ℃, the diameter of the bacterial colony is 17.83mm, the diameter of the bacterial colony reaches 51.5mm after 15 days, the bacterial colony is white to milky white, the bacterial colony is felty at the beginning, a creamy spore layer is formed at the later stage, and the spore layer is thick and uniform.

3. Beauveria bassiana according to claim 1, characterized in that its microscopic characteristics are: hyphae are branched and have lattices, are colorless and smooth, spore-forming cells densely cluster on short and expanded stem cells, are in a bottle shape, are in a zigzag shape at the upper part of the spore-forming cells, and the top ends of the spore-forming cells become slender; the conidium is spherical or nearly spherical, single cell, transparent and smooth.

4. Use of beauveria bassiana according to any one of claims 1 to 3 for the control of tea tree beetle defoliators.

5. The application according to claim 4, wherein the method of application is: and sprinkling powder containing conidia of the beauveria bassiana in the rhizosphere soil of the tea trees in 1-2 months each year.

6. The application according to claim 4, wherein the method of application is: spraying a spore suspension containing conidia of the beauveria bassiana between tea lines at 4-5 months per year.

7. A fungicide for controlling tea tree leaf eating beetle, characterized by comprising Beauveria bassiana according to claim 1.

8. The microbial inoculum for controlling tea tree leaf eating beetle according to claim 7, which is spore suspension, and the concentration of the spore suspension is 5.0 x 10⁷Spores/ml.

9. The microbial inoculum for controlling tea tree leaf eating beetle according to claim 7, which is powder, and the spore content of the powder is (1.0-1.6) x 10¹⁰Spores/g microbial inoculum.