CN111808888B

CN111808888B - Chinese fir endophytic fungi fermentation filtrate and extract thereof, and preparation method and application of Chinese fir endophytic fungi fermentation filtrate and extract

Info

Publication number: CN111808888B
Application number: CN202010761511.0A
Authority: CN
Inventors: 黄麟; 卞金月; 方玉兰; 宋青; 孙美玲; 巨云为
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2020-07-31
Filing date: 2020-07-31
Publication date: 2021-09-03
Anticipated expiration: 2040-07-31
Also published as: CN111808888A

Abstract

The invention discloses a fir endophytic fungi fermentation filtrate, an extract thereof, a preparation method and application. According to the inventionEpicoccum dendrobiiThe fermentation filtrate of SMEL can obviously inhibit the spore germination of the anthrax bacteria of China fir and the development of attachment cells of the anthrax bacteria of China fir;Epicoccum dendrobiithe ethyl acetate extract of the SMEL fermentation filtrate can obviously inhibit the hypha growth of the cunninghamia lanceolata anthracnose, and obviously inhibit the spore germination and the anchorage development of the cunninghamia lanceolata anthracnose; the inoculation test shows that the ethyl acetate extract obviously inhibits the pathogenicity of the cunninghamia lanceolata anthracnose.

Description

Chinese fir endophytic fungi fermentation filtrate and extract thereof, and preparation method and application of Chinese fir endophytic fungi fermentation filtrate and extract

Technical Field

The invention belongs to the field of microbial pesticides, and particularly relates to a fir endophytic fungi fermentation filtrate, an extract thereof, a preparation method and an application.

Background

Fir (1)Cunninghamia lanceolata) The method is widely planted in a plurality of provinces (regions) such as Fujian province, Jiangxi province, Guangxi province, Sichuan province, Hunan province, Anhui province, Jiangsu province and the like, and is an important fast-growing tree species in China due to the characteristics of straight, straight and full dry shape, high growth speed, insect resistance, corrosion resistance, high economic value and the like. The afforestation area and the wood storage amount of the fir are in the 1 st position of the main afforestation tree species in China. ByColletotrichum gloeosporioides (B)Colletotrichum gloeosporioides) The caused anthracnose of the Chinese fir causes serious damage to the growth of the Chinese fir in Chinese fir cultivation areas, when the disease is slight, the needle leaves or the tender tips of Chinese fir seedlings become brown and withered, and when the disease is serious, the Chinese fir young forest is withered and yellow and withered in pieces, thereby causing destructive damage. The mode of nutrition of anthrax fir is a semi-living mode of nutrition depending on anchorage and the like. The process of infecting host plants comprises the following steps: (1) spore germination to form germ tube hypha; (2) differentiating the top of the hyphae of the germ tube to generate attached cells; (3) the attached cells are differentiated to generate infection plugs which penetrate cell walls of plant surface cells and are differentiated to form infection hypha to infect living cells; (4) the infected hyphae are differentiated to generate secondary hyphae which secrete degrading enzymes to kill host cells.

At present, the prevention and treatment of the anthracnose of the fir mainly depends on chemical prevention and treatment, and the method easily causes the problems of environmental pollution, accidental injury of natural enemies, human and animal health risks, drug resistance of germs and the like. The biological control has the advantages of environmental protection, long control effect persistence, no harm to human and livestock and the like, so that the biological control becomes an ideal plant disease and insect pest control approach. One application method of biological control is to directly release microorganisms in the natural environment and exert the biological control effect by the contact of the biological control microorganisms and target diseases and insect pests; the other mode is to purify and apply the bacteriostatic substances generated by the metabolism of the biocontrol microorganism, and the method has the advantages of high control efficiency, small influence of environmental factors and the like, and has wide development and application prospects.Epicoccum dendrobiiIs a fir endophytic fungus, but at present, researches on purification and extraction of bacteriostatic components of the fir endophytic fungus and application of extracts of the fir endophytic fungus are lacked.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a strain of cunninghamia lanceolata endophytic fungiEpicoccum dendrobiiThe SMEL fermentation filtrate and the preparation method of the ethyl acetate extract thereof meet the use requirements of biological control. The invention also aims to provide application of the fir endophytic fungi fermentation filtrate and the ethyl acetate extract.

In order to achieve the purpose, the invention adopts the following technical scheme:

a fir endophytic fungi fermentation filtrate is characterized in that the fir endophytic fungi fermentation filtrate is formed by fermenting and filtering; the fir endophytic fungi is preserved in China Center for Type Culture Collection (CCTCC) with a preservation address of university of Wuhan, China, and is named by classificationEpicoccum dendrobii SMEL, the code of the strain is SMEL, the preservation number is CCTCC No. M2019895, the preservation date is: 11/4/2019.

The preparation method of the fir endophytic fungi fermentation filtrate comprises the following steps: inoculating hypha blocks of the fir endophytic fungi into a culture medium, performing shake culture, and collecting fermentation filtrate; sterile fermentation filtrate is obtained by filtration.

More specifically, inoculating a hypha block of the cunninghamia lanceolata endophytic fungi into a sterile PD culture medium, and performing shake culture at 150rpm for 5d at the temperature of 28 ℃; collecting fermentation filtrate; filtering to obtain sterile fermentation filtrate. It should be noted that the fir endophytic fungi fermentation and filtration under such harsh conditions are not necessarily required to obtain the corresponding fermentation filtrate, and any preparation process capable of obtaining the fir endophytic fungi fermentation filtrate falls within the scope of the present invention.

The invention also provides an ethyl acetate extract of the fir endophytic fungi fermentation filtrate, the fir endophytic fungi is fermented and filtered to form sterile fermentation filtrate, and the sterile fermentation filtrate is extracted by ethyl acetate to obtain the ethyl acetate extract of the fir endophytic fungi fermentation filtrate.

The preparation method of the ethyl acetate extract of the fir endophytic fungi fermentation filtrate can be as follows: inoculating the hypha blocks of the fir endophytic fungi into a culture medium, placing the culture medium in a dark room for shake culture for a certain time, and filtering to obtain sterile fermentation filtrate; adding ethyl acetate into the sterile fermentation filtrate, and then standing; collecting the upper organic phase, distilling the organic phase, dissolving the precipitate with DMSO, and filtering to obtain ethyl acetate extract of the fermentation filtrate. Wherein the distillation operation comprises heating the upper organic phase collected by the separating funnel, vacuumizing, volatilizing the solvent, dissolving the remained precipitate with antibacterial components by DMSO, and filtering to obtain ethyl acetate extract of the fermentation filtrate.

The preparation method of the ethyl acetate extract of the fir endophytic fungi fermentation filtrate comprises the following more specific steps: inoculating hypha blocks of the fir endophytic fungi into a sterile PD culture medium, placing the culture medium in a dark room with a shaking table at 25 ℃, shaking at 130rpm for 40d (in the fermentation process), and filtering to obtain sterile fermentation filtrate (the sterile fermentation filtrate does not contain SMEL bacteria after being filtered by a 0.22-mum filter); adding 3 times volume of ethyl acetate into the sterile fermentation filtrate, fully mixing, and standing for 24 h; collecting the upper organic phase by using a separating funnel, and distilling the organic phase by using a rotary evaporator at 40 ℃; dissolving the precipitate with DMSO, and filtering to obtain ethyl acetate extract of the fermentation filtrate. It is to be noted that it is not necessary to perform the extraction of the fermentation filtrate under such severe conditions to obtain the corresponding extract, and any method capable of obtaining the fermentation filtrate extract is within the scope of the present invention.

The invention also aims to provide application of the fir endophytic fungi fermentation filtrate in preparing agricultural medicines for inhibiting germination and development of attached cells of the fir anthrax spores.

The invention also aims to provide application of the ethyl acetate extract of the fir endophytic fungi fermentation filtrate in preparing agricultural medicines for inhibiting the growth of the fir anthracnose bacteria, application in preparing agricultural medicines for inhibiting the spore germination and the anchorage development of the fir anthracnose bacteria and application in preparing agricultural medicines for preventing and treating the fir anthracnose.

Compared with the prior art, the invention has the following advantages:

（1）Epicoccum dendrobiithe bacterial strain SMEL is a plant endophyte, and compared with other environmental microorganisms, the bacteriostatic component generated by the bacterial strain SMEL can exist and be transported in a plant body for a long time, so that the bacterial strain SMEL has a more lasting control effect. The bacteriostatic component contained in the fermentation filtrate of the strain can obviously reduce the germination of the anthrax spores of the fir and reduce the formation rate of the attachment cells of the anthrax of the fir.

(2) In contrast to other biocontrol microorganisms, no reference is currently made toEpicoccum dendrobiiFermentation filtrateThe report of the preparation method and the extraction method of the bacteriostatic substance of the bacterium. The invention provides a simple and convenientEpicoccum dendrobiiA preparation method of fermentation filtrate and a bacteriostatic component obtained by extracting the filtrate with ethyl acetate.

（3）Epicoccum dendrobiiBacteriostatic components obtained by extracting sterile fermentation filtrate with ethyl acetate can obviously inhibit the germination of the anthrax spores of the fir, inhibit the development of the attached cells of the anthrax spores, reduce the pathogenicity of the anthrax spores and achieve good disease control effect.

Drawings

FIG. 1 is a graph showing the effect of SMEL fermentation filtrate on spore germination and outgrowth formation of anthrax spores of Cunninghamia lanceolata; in the figure, A, the influence of the fermentation filtrate of SMEL on the germination of the spores of the anthrax cedar (different letters indicate that the difference between treatments is remarkable), and B, the influence of the fermentation filtrate of SMEL on the formation of the attachment cells of the anthrax cedar (different letters indicate that the difference between treatments is remarkable);

FIG. 2 is a graph showing the effect of ethyl acetate extract of SMEL fermentation filtrate on the growth of mycelium of Antrodia cunninghamii;

FIG. 3 is a graph showing the effect of ethyl acetate extract of SMEL fermentation filtrate on spore germination and outgrowth of anthrax spores of Cunninghamia lanceolata; in the figure, A, the influence of the ethyl acetate extract of the SMEL fermentation filtrate on the germination of the spores of the anthrax cedar (different letters indicate that the difference between treatments is remarkable), and B, the influence of the ethyl acetate extract of the SMEL fermentation filtrate on the formation of the attached cells of the anthrax cedar (different letters indicate that the difference between treatments is remarkable);

FIG. 4 is a graph showing the results of ethyl acetate extracts from SMEL fermentation filtrates on the virulence of anthrax fir;

FIG. 5 is a morphological feature diagram of SMEL; in the figure, colony morphology of a. SMEL (front and back), sporophore of b.smel, stroma of C-d. SMEL, spore stem of E-f. SMEL, spore of G-h. SMEL, wart (indicated by arrow) and basal cell (indicated by asterisk) on surface of i.smel spore;

FIG. 6 is a diagram of the SMEL phylogenetic tree based on the ITS, LSU, RPB2 and TUB tandem sequence;

the invention relates to a fir realBacteriaEpicoccum dendrobii SMEL, which is preserved in China Center for Type Culture Collection (CCTCC) with the preservation address of university of Wuhan, China, and is classified and namedEpicoccum dendrobii SMEL, the preservation number is CCTCC No: M2019895, the preservation date is: 11/4/2019.

Detailed Description

The invention will be better understood from the following examples. However, it is easily understood by those skilled in the art that the embodiments are described only for illustrating the present invention and should not limit the present invention described in detail in the claims.

Example 1: china fir endophytic fungiEpicoccum dendrobiiSMEL isolation and identification

The experiment is that healthy cunninghamia lanceolata branches (collected person: yellow phosphorus;

and (4) contacting the telephone: 025 and 85427301), washing with sterile water, sterilizing the surface with 75% absolute ethyl alcohol, removing the epidermis, transferring the internal tissue to a PDA plate, culturing at 28 ℃, picking the edge part of the colony by using a sterile picking needle after 7 days, inoculating the edge part of the colony to a new PDA plate, and purifying the strain to obtain the fir endophytic fungi strain SMEL.

The fir endophytic fungiEpicoccum dendrobiiThe biological properties of strain SMEL are as follows: the colony edge of the SMEL strain on the PDA culture medium is regular, and the aerial mycelium is felty to flocculent, flat, white to light brown; the colony was reddish on the back and brownish to brown in the center. The hyphae have a diaphragm and are 1.4-4.1 mu m wide; the stroma is black and is superficial or partially embedded in the culture medium. The conidiophores are light brown, have branches and diaphragms, and have the length of 2.3-8.2 mu m. The conidia are spherical or nearly spherical, are light brown when immature and are dark brown when mature, and have the diameter of 8-13 mu m; the spore surface had warts with one basal cell (fig. 5). Morphological characteristics of SMEL strain andEpicoccum dendrobiiwith obvious similarity.

Sequence alignment analysis finds the ITS, LSU, RPB2 and TUB sequences of the SMEL strain and model strains in GenBank databaseEpicoccum dendrobiiThe sequence similarity of (a) was 100%, 98.5% and 99.7%, respectively. The MEGA7.0 software is adopted to construct a phylogenetic tree of SMEL and high-similarity strains, and the result shows that the SMEL strain and other 2 strainsEpicoccum dendrobiiBelonging to one branch (fig. 6). Combined with the morphological characteristics of the strain, SMEL was identified asEpicoccum dendrobii。

Example 2: inhibition effect of SMEL fermentation filtrate on spore germination and attachment cell formation of cunninghamia lanceolata

Preparing a mycelium block: inoculating anthrax and SMEL of Cunninghamia lanceolata to PDA plate, culturing at 25 deg.C for 5 days, and preparing blocks (i.e. mycelium blocks) with diameter of 5mm with sterile puncher.

To prepare spores of cunninghamia lanceolata, a hypha block of cunninghamia lanceolata (provided by forest pathology laboratory of Nanjing university of forestry, named as SMCG1# C, observed in 2017. cunninghamia lanceolata genetic transformation and nucleus behavior of anchorage development process, Nanjing university of forestry university, school newspaper of Nanjing forestry (Nature science edition), 41(6):68-72, published) was inoculated into 100ml of CMC liquid medium, shake-cultured at 25 ℃, 200rpm, and spores were collected after 2d and adjusted to 1 × 10 concentration⁵Spores per ml, spore suspension of cunninghamia lanceolata anthrax was obtained for spore germination, outgrowth of anchorage cells and inoculation experiments.

Inoculating 10 SMEL hypha blocks with the diameter of 5mm into 100ml of sterile PD medium, and performing shake culture at 150rpm for 5d at 28 ℃; filtering with funnel to collect fermentation filtrate; the fermentation filtrate is filtered by a 0.22-mum filter to prepare sterile fermentation filtrate of the SMEL (the filtered fermentation filtrate does not contain SMEL bacteria, and components metabolized into the fermentation broth in the SMEL culture process play a role in inhibiting bacteria). Mixing the sterile fermentation filtrate with the same amount of cunninghamia lanceolata anthrax spore suspension, placing 20 μ l of the mixture on a hydrophobic glass slide, and performing dark culture at 25 deg.C; the spores were observed after 4h and 12h, respectively, for counting the germination rate and the appressorium formation rate of the spores. With non-inoculated PD blank medium and deionized water (ddH)₂O) is a control. The experiment was set up in triplicate, 30 replicates per treatment (i.e. 30 spores per treatment were counted). The results are shown in FIG. 1, from whichIt was seen that the fermentation filtrate of SMEL significantly inhibited germination of the anthrax spores of Cunninghamia lanceolata compared to the control of PD blank medium without SMEL, with an inhibition rate of 42% (FIG. 1A); although the blank PD medium also has a certain inhibiting effect on the formation of the anthrax cedar anchorage, the inhibiting effect of the SMEL fermentation filtrate on the development of the anthrax cedar anchorage is more obvious, and the inhibiting rate is 55% (fig. 1B).

Example 3: inhibitory effect of ethyl acetate extract of SMEL fermentation filtrate on growth of cunninghamia lanceolata

Inoculating 10 SMEL hypha blocks with diameter of 5mm into a 500ml conical flask containing 200ml sterile PD medium, placing in a dark room with shaking table at 25 deg.C and 130rpm for 40d, and filtering with a funnel to collect fermentation filtrate; filtering the fermentation filtrate with 0.22- μm filter to obtain SMEL sterile fermentation filtrate (the filtered fermentation filtrate does not contain SMEL bacteria, and components metabolized into the fermentation broth in the SMEL culture process play a role in inhibiting bacteria); adding 3 times volume of ethyl acetate into the sterile fermentation filtrate, fully mixing (namely the volume of the ethyl acetate is 3 times of the volume of the fermentation filtrate), and standing for 24 hours; collecting the upper organic phase by using a separating funnel, and distilling the organic phase by using a rotary evaporator at 40 ℃; the precipitate was dissolved with 5ml of DMSO and an ethyl acetate extract of the SMEL broth was prepared through a 0.45- μm filter. An equal volume of PD medium not inoculated with SMEL was used as a control.

Spore suspension of cunninghamia lanceolata anthrax is prepared as in example 2, the spore suspension is mixed with PDA medium and poured into a flat plate, after the medium is cooled, inoculation holes with a diameter of 6mm are prepared on the medium by a puncher, 3 inoculation holes are prepared on each flat plate at equal intervals, 20 μ l of the ethyl acetate extract of the SEML fermentation broth, the ethyl acetate extract of the PD medium and the solvent DMSO are added to the inoculation holes, and the zone of inhibition around the inoculation hole is observed after 5 days. Three replicates of each treatment were set up for the experiment, 3 replicates for each treatment. The results are shown in fig. 2, from which it can be seen that a significant zone of inhibition occurs around the inoculum wells of the ethyl acetate extract to which the SMEL fermentation filtrate was added, indicating that the extract significantly inhibited hyphal growth of the fir anthrax (fig. 2).

Example 4: inhibitory effect of ethyl acetate extract of SMEL fermentation filtrate on spore germination and attachment cell formation of cunninghamia lanceolata

A spore suspension of Anthrax cunninghamiae was prepared according to example 2, and an ethyl acetate extract of SMEL fermentation filtrate was prepared according to example 3. Adding 2 μ l of the ethyl acetate extract into 1ml of the cunninghamia lanceolata anthracnose spore suspension, uniformly mixing, placing 20 μ l of the mixed solution on a hydrophobic slide, performing dark culture at 25 ℃, and counting the germination rate of spores after 2h and 4h and the formation rate of anchorage cells after 8h and 12h respectively. Ethyl acetate extract with blank PD, DMSO and ddH₂O is a control. The experiment was set up in triplicate and 30 spores counted per treatment. The results are shown in fig. 3, from which it can be seen that the ethyl acetate extract of the SMEL fermentation filtrate significantly inhibited germination of the anthrax spores of cedarwood, with 68% and 38% inhibition of spore germination at 2h and 4h, respectively, as compared to the control of the ethyl acetate extract of the blank PD (fig. 3A); and the ethyl acetate extract of the SMEL fermentation filtrate obviously inhibits the formation of the taxus chinensis anthracnose cells, and the inhibition rates of the formation of the anthracnose cells are 65% and 59% respectively in 8h and 12h (figure 3B).

Example 5: inhibitory effect of ethyl acetate extract of SMEL fermentation filtrate on virulence of cunninghamia lanceolata

Collecting healthy hybrid Chinese gown leaves in the field, and disinfecting the surfaces of the leaves by using 75% alcohol; the surface-sterilized leaves were wounded using a sterile inoculating needle and used for the inoculation test. A spore suspension of Anthrax cunninghamiae was prepared according to example 2, and an ethyl acetate extract of SMEL fermentation filtrate was prepared according to example 3. Adding 2 μ l ethyl acetate extract into 1ml anthrax cunninghamia spore suspension, mixing, inoculating 10 μ l spore mixture to the wound of leaf of Chinese gown, adding blank PD ethyl acetate extract, DMSO and ddH₂O is a control. Inoculating leaf, placing into culture dish, placing a layer of moist filter paper on the bottom layer for moisturizing, sealing the culture dish, and placing at 25 deg.C^oAnd C, performing alternate treatment of 12h light/12 h dark in an incubator. The leaves were observed for disease after 5 days of inoculation. Three replicates of each treatment were set up for the experiment, 3 replicates for each treatment. The results are shown in FIG. 4, from which it can be seenIn comparison to the control with the ethyl acetate extract of PD blank, the spot size of anthrax was reduced by 36% after treatment with the ethyl acetate extract of SMEL fermentation filtrate, significantly inhibiting the virulence of fir anthrax (fig. 4).

Appendix: gene sequence of SMEL strain

ITS:

TGCAGTTGCAATCAGCGTCTGAAAAAACATAATAGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTTGTCTCGCCTCTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGGCGACGTCCAAAAGTACATTTTTACACTCT（SEQ ID NO.1）

LSU:

GCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTACGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGATCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGA（SEQ ID NO.2）

RPB2:

GGGGTCTTGTGTGCCCCGCCGAGACACCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCCCTGATGTGCTACGTCAGTGTCGGTAGCGATGCCGGACCCATATCCGACTTCATGGGCCAGCGAAACATGCTGATGCTTGAAGAATATGATCAAAACCAGAACCCGGATGCCACCAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACTCTAACGCACAACAGCTTGTCTCTACAGTGCAGGAGCTTCGCCGTAATGGAACCCTCTCTTACGAGATGAGTTTGATTCGAGACATCCGTGACCGAGAGTTCAAAATCTTCACAGATGCTGGACGTGTTATGAGGCCTCTCTTCGTAGTGGAGAACGACGTGCGCAAGCCTAATAGGAATCACCTCGTCTACAACCAAGAGCACTACGGCAAGCTGGCTCGAGAGCAACAGGCAATGTCTCAGGCAGGCGTCGGCGAGGAAGAGAGGCTGGCAGAGCCTTATGGCTGGAAGGGCCTCATTCAAGATGGTGTTATTGAATACCTTGACGCGGAAGAGGAGGAGACTGCCATGATTGTCATGTCGCCCGAAGATCTCGGCGAG（SEQ ID NO.3）

TUB:

TCCGGATTGGCCGAAGACGAAGTTGTCGGGACGGAAGAGCTGGCCGAAGGGACCGGCGCGGACGGCGTCCATTGTACCGGGCTCCAAGTCGACGAGGACGGCACGGGGAACGAACTTGTTGCCAGAGGCCTGTGGGAGGTCAGCACTCGCAGTCCGTCTCAGGAAAGCGTGTCGTTTCTAGTACCTCGTTGAAGTAGACGTTCATGCGCTCGAGCTGGAGGTCCGAGGTGCCGTTGTAGACACCGGAGCCGTCGAGGCCATGCTCGCCGGAGATGGTCTGCCAGAAGGCGGCACCGATTTGGTTACCCTGTCCATTGTGAGCTGCCGTCCATGAGAGAACATGGAGGTGGTAAACTTACGCACTGACCGGTCTGAAGGTGAACA（SEQ ID NO.4）

The basic principle and the application prospect of the invention of the application are described in the above. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are intended as illustrations of the principles of the invention, but rather, as various modifications and improvements may be made without departing from the function, spirit and scope of the invention. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> Nanjing university of forestry

<120> Chinese fir endophytic fungi fermentation filtrate, extract thereof, preparation method and application

<130> 2020073105-zf-xhx

<141> 2020-07-31

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 354

<212> DNA

<213> Epicoccum dendrobii

<400> 1

tgcagttgca atcagcgtct gaaaaaacat aatagttaca actttcaaca acggatctct 60

tggttctggc atcgatgaag aacgcagcga aatgcgataa gtagtgtgaa ttgcagaatt 120

cagtgaatca tcgaatcttt gaacgcacat tgcgcccctt ggtattccat ggggcatgcc 180

tgttcgagcg tcatttgtac cttcaagctc tgcttggtgt tgggtgtttt gtctcgcctc 240

tgcgtgtaga ctcgccttaa aacaattggc agccggcgta ttgatttcgg agcgcagtac 300

atctcgcgct ttgcactcat aacggcgacg tccaaaagta catttttaca ctct 354

<210> 2

<211> 812

<212> DNA

<213> Epicoccum dendrobii

<400> 2

gcgtccgagt tgtaatttgc agagggcgct ttggcattgg cagcggtcca agttccttgg 60

aacaggacgt cacagagggt gagaatcccg tacgtggtcg ctagccttta ccgtgtaaag 120

ccccttcgac gagtcgagtt gtttgggaat gcagctctaa atgggaggta aatttcttct 180

aaagctaaat actggccaga gaccgatagc gcacaagtag agtgatcgaa agatgaaaag 240

cactttggaa agagagttaa aaagcacgtg aaattgttga aagggaagcg cttgcagcca 300

gacttgcctg tagttgctca tccgggtttc tacccggtgc actcttctac gggcaggcca 360

gcatcagttt gggcggttgg ataaaggtct ctgtcatgta cctcctctcg gggagatctt 420

ataggggaga cgacatgcaa ccagcctgga ctgaggtccg cgcatctgct aggatgctgg 480

cgtaatggct gtaagcggcc cgtcttgaaa cacggaccaa ggagtctaac atctatgcga 540

gtgtttgggt gtcaagcccg agcgcgtaat gaaagtgaac ggaggtggga acctttcggg 600

gtgcaccatc gaccgatcct gatgtcttcg gatggatttg agtaagagca tagctgttgg 660

gacccgaaag atggtgaact atgcttgaat agggtgaagc cagaggaaac tctggtggag 720

gctcgcagcg gttctgacgt gcaaatcgat cgtcaaattt gggcataggg gcgaaagact 780

aatcgaacta tctagtagct ggttcctgcc ga 812

<210> 3

<211> 596

<212> DNA

<213> Epicoccum dendrobii

<400> 3

ggggtcttgt gtgccccgcc gagacacctg aaggacaggc ttgtggtctt gtcaagaact 60

tgtccctgat gtgctacgtc agtgtcggta gcgatgccgg acccatatcc gacttcatgg 120

gccagcgaaa catgctgatg cttgaagaat atgatcaaaa ccagaacccg gatgccacca 180

aggtcttcgt caacggtgta tgggtcggtg tgcactctaa cgcacaacag cttgtctcta 240

cagtgcagga gcttcgccgt aatggaaccc tctcttacga gatgagtttg attcgagaca 300

tccgtgaccg agagttcaaa atcttcacag atgctggacg tgttatgagg cctctcttcg 360

tagtggagaa cgacgtgcgc aagcctaata ggaatcacct cgtctacaac caagagcact 420

acggcaagct ggctcgagag caacaggcaa tgtctcaggc aggcgtcggc gaggaagaga 480

ggctggcaga gccttatggc tggaagggcc tcattcaaga tggtgttatt gaataccttg 540

acgcggaaga ggaggagact gccatgattg tcatgtcgcc cgaagatctc ggcgag 596

<210> 4

<211> 384

<212> DNA

<213> Epicoccum dendrobii

<400> 4

tccggattgg ccgaagacga agttgtcggg acggaagagc tggccgaagg gaccggcgcg 60

gacggcgtcc attgtaccgg gctccaagtc gacgaggacg gcacggggaa cgaacttgtt 120

gccagaggcc tgtgggaggt cagcactcgc agtccgtctc aggaaagcgt gtcgtttcta 180

gtacctcgtt gaagtagacg ttcatgcgct cgagctggag gtccgaggtg ccgttgtaga 240

caccggagcc gtcgaggcca tgctcgccgg agatggtctg ccagaaggcg gcaccgattt 300

ggttaccctg tccattgtga gctgccgtcc atgagagaac atggaggtgg taaacttacg 360

cactgaccgg tctgaaggtg aaca 384

Claims

1. A fir endophytic fungi fermentation filtrate is characterized in that the fir endophytic fungi is formed by fermentation and filtration: inoculating the hypha blocks of the fir endophytic fungi into a culture medium, performing shake culture at the temperature of 28 ℃ and the rpm of 150 for 5 days, and filtering by adopting a funnel to collect fermentation filtrate; filtering to obtain sterile fermentation filtrate; the fir endophytic fungi is preserved in China Center for Type Culture Collection (CCTCC) with a preservation address of university of Wuhan, China, and is named by classificationEpicoccum dendrobii SMEL, the preservation number is CCTCC No: M2019895, the preservation date is: 11/4/2019.

2. The method for preparing fir endophytic fungi fermentation filtrate according to claim 1, characterized by comprising the following steps:

inoculating the hypha blocks of the fir endophytic fungi into a culture medium, performing shake culture at the temperature of 28 ℃ and the rpm of 150 for 5 days, and filtering by adopting a funnel to collect fermentation filtrate; sterile fermentation filtrate is obtained by filtration.

3. The ethyl acetate extract of the fir endophytic fungi fermentation filtrate according to claim 1, wherein the sterile fermentation filtrate is obtained by fermenting and filtering the fir endophytic fungi, and the ethyl acetate extract of the fir endophytic fungi fermentation filtrate is obtained by extracting the sterile fermentation filtrate with ethyl acetate: inoculating hypha blocks of the fir endophytic fungi into a culture medium, placing the culture medium in a dark room with a shaking table at 25 ℃, shaking at 130rpm for 40d, collecting fermentation filtrate by adopting a funnel for filtration, and filtering to obtain sterile fermentation filtrate; adding 3 times volume of ethyl acetate into the sterile fermentation filtrate, fully mixing, and standing for 24 h; collecting the upper organic phase by using a separating funnel, distilling the organic phase by using a rotary evaporator at 40 ℃, dissolving the precipitate by using DMSO, and filtering by using a 0.45 mu m filter to obtain an ethyl acetate extract of the fermentation filtrate.

4. The method for preparing the ethyl acetate extract of the fir endophytic fungi fermentation filtrate according to claim 3, wherein the mycelia of the fir endophytic fungi are inoculated into a culture medium, are placed in a dark room at 25 ℃ by shaking and 130rpm for 40d by shaking, are filtered by a funnel to collect the fermentation filtrate, and are filtered to obtain the sterile fermentation filtrate; adding 3 times volume of ethyl acetate into the sterile fermentation filtrate, fully mixing, and standing for 24 h; collecting the upper organic phase by using a separating funnel, distilling the organic phase by using a rotary evaporator at 40 ℃, dissolving the precipitate by using DMSO, and filtering by using a 0.45 mu m filter to obtain an ethyl acetate extract of the fermentation filtrate.

5. The use of the fir endophytic fungi fermentation filtrate of claim 1 in the preparation of agricultural drugs for inhibiting the germination and appressorium development of fir anthrax spores.

6. The use of the ethyl acetate extract of the fir endophytic fungi fermentation filtrate of claim 1 in the preparation of agricultural drugs for inhibiting the growth of fir anthrax.

7. The use of the ethyl acetate extract of the fir endophytic fungi fermentation filtrate according to claim 1 in the preparation of agricultural drugs for inhibiting the germination and anchorage development of the spores of fir anthrax.

8. The use of the ethyl acetate extract of the fir endophytic fungi fermentation filtrate in the preparation of agricultural drugs for preventing and treating fir anthracnose according to claim 1.