CN114480098A - Portable chicken bursal mycoplasma detection device and method thereof - Google Patents
Portable chicken bursal mycoplasma detection device and method thereof Download PDFInfo
- Publication number
- CN114480098A CN114480098A CN202210137800.2A CN202210137800A CN114480098A CN 114480098 A CN114480098 A CN 114480098A CN 202210137800 A CN202210137800 A CN 202210137800A CN 114480098 A CN114480098 A CN 114480098A
- Authority
- CN
- China
- Prior art keywords
- pipe
- primer
- injection
- control valve
- electric control
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 51
- 238000000034 method Methods 0.000 title claims abstract description 26
- 241000287828 Gallus gallus Species 0.000 title claims description 20
- 241000204031 Mycoplasma Species 0.000 title claims description 3
- 241000202942 Mycoplasma synoviae Species 0.000 claims abstract description 20
- 230000007246 mechanism Effects 0.000 claims abstract description 17
- 230000008569 process Effects 0.000 claims abstract description 13
- 238000002347 injection Methods 0.000 claims description 127
- 239000007924 injection Substances 0.000 claims description 127
- 238000006243 chemical reaction Methods 0.000 claims description 70
- 238000002156 mixing Methods 0.000 claims description 48
- 239000000243 solution Substances 0.000 claims description 46
- 238000010438 heat treatment Methods 0.000 claims description 32
- 238000003825 pressing Methods 0.000 claims description 24
- 238000001816 cooling Methods 0.000 claims description 22
- 238000007789 sealing Methods 0.000 claims description 19
- 238000001125 extrusion Methods 0.000 claims description 17
- 239000005457 ice water Substances 0.000 claims description 17
- 210000002966 serum Anatomy 0.000 claims description 14
- 230000003321 amplification Effects 0.000 claims description 13
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 13
- 238000005452 bending Methods 0.000 claims description 12
- 210000001503 joint Anatomy 0.000 claims description 12
- 238000009413 insulation Methods 0.000 claims description 10
- 238000000137 annealing Methods 0.000 claims description 9
- 230000006835 compression Effects 0.000 claims description 9
- 238000007906 compression Methods 0.000 claims description 9
- 229920000936 Agarose Polymers 0.000 claims description 8
- 238000004925 denaturation Methods 0.000 claims description 8
- 230000036425 denaturation Effects 0.000 claims description 8
- 238000001962 electrophoresis Methods 0.000 claims description 8
- 238000004401 flow injection analysis Methods 0.000 claims description 8
- 239000012634 fragment Substances 0.000 claims description 8
- 238000012257 pre-denaturation Methods 0.000 claims description 8
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 8
- 230000009471 action Effects 0.000 claims description 5
- 239000007788 liquid Substances 0.000 claims description 5
- 208000015181 infectious disease Diseases 0.000 claims description 4
- 235000017166 Bambusa arundinacea Nutrition 0.000 claims description 3
- 235000017491 Bambusa tulda Nutrition 0.000 claims description 3
- 241001330002 Bambuseae Species 0.000 claims description 3
- 235000015334 Phyllostachys viridis Nutrition 0.000 claims description 3
- 239000011425 bamboo Substances 0.000 claims description 3
- 239000000203 mixture Substances 0.000 claims description 3
- 238000004321 preservation Methods 0.000 claims description 3
- 238000010079 rubber tapping Methods 0.000 claims description 3
- 230000001954 sterilising effect Effects 0.000 claims description 3
- 238000010992 reflux Methods 0.000 claims description 2
- 238000005507 spraying Methods 0.000 claims 1
- 210000001171 synovial bursa Anatomy 0.000 claims 1
- 239000000463 material Substances 0.000 abstract description 4
- 235000013330 chicken meat Nutrition 0.000 description 15
- 241000894006 Bacteria Species 0.000 description 6
- 238000011049 filling Methods 0.000 description 6
- 125000004122 cyclic group Chemical group 0.000 description 5
- 230000000694 effects Effects 0.000 description 5
- 238000012545 processing Methods 0.000 description 5
- 239000012535 impurity Substances 0.000 description 4
- 101000793686 Homo sapiens Azurocidin Proteins 0.000 description 3
- 230000004087 circulation Effects 0.000 description 3
- 230000006978 adaptation Effects 0.000 description 2
- 230000009545 invasion Effects 0.000 description 2
- 238000003032 molecular docking Methods 0.000 description 2
- 244000144977 poultry Species 0.000 description 2
- 235000013594 poultry meat Nutrition 0.000 description 2
- 230000009467 reduction Effects 0.000 description 2
- 241000271566 Aves Species 0.000 description 1
- 241001430197 Mollicutes Species 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 210000003555 cloaca Anatomy 0.000 description 1
- 238000004891 communication Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000008878 coupling Effects 0.000 description 1
- 238000010168 coupling process Methods 0.000 description 1
- 238000005859 coupling reaction Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 210000001035 gastrointestinal tract Anatomy 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 210000000281 joint capsule Anatomy 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 210000004877 mucosa Anatomy 0.000 description 1
- 210000003101 oviduct Anatomy 0.000 description 1
- 230000003071 parasitic effect Effects 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 238000012549 training Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M41/00—Means for regulation, monitoring, measurement or control, e.g. flow regulation
- C12M41/12—Means for regulation, monitoring, measurement or control, e.g. flow regulation of temperature
- C12M41/18—Heat exchange systems, e.g. heat jackets or outer envelopes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M23/00—Constructional details, e.g. recesses, hinges
- C12M23/38—Caps; Covers; Plugs; Pouring means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M27/00—Means for mixing, agitating or circulating fluids in the vessel
- C12M27/18—Flow directing inserts
- C12M27/24—Draft tube
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M29/00—Means for introduction, extraction or recirculation of materials, e.g. pumps
- C12M29/06—Nozzles; Sprayers; Spargers; Diffusers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M29/00—Means for introduction, extraction or recirculation of materials, e.g. pumps
- C12M29/26—Conditioning fluids entering or exiting the reaction vessel
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M33/00—Means for introduction, transport, positioning, extraction, harvesting, peeling or sampling of biological material in or from the apparatus
- C12M33/04—Means for introduction, transport, positioning, extraction, harvesting, peeling or sampling of biological material in or from the apparatus by injection or suction, e.g. using pipettes, syringes, needles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M37/00—Means for sterilizing, maintaining sterile conditions or avoiding chemical or biological contamination
- C12M37/04—Seals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Sustainable Development (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Thermal Sciences (AREA)
- Clinical Laboratory Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a portable detection device and a method for mycoplasma synoviae, and particularly relates to the technical field of mycoplasma synoviae detection, wherein the detection device comprises a detection cylinder, an embedded pipe is installed at the bottom end of the detection cylinder, four connecting pipes are annularly and equidistantly distributed on the outer wall of the embedded pipe, and a primer mechanism is installed at the top end of each connecting pipe; the primer mechanism comprises a first electric control valve arranged at the top end of the connecting pipe, a second electric control valve is arranged on the outer wall of the connecting pipe, an air inlet pipe is communicated with the upper portion of the second electric control valve, and a primer pipe is arranged above the first electric control valve. The invention adopts the primer mechanism, the switching is convenient in the primer process, and the annular counter flow and the reverse flow are formed during the primer process, so that the primer operation can be quickly completed, the primer efficiency is improved, the detection is more convenient and quick, the material cost is low, the detection time is shorter, and the instrument operation is simple.
Description
Technical Field
The invention relates to the technical field of mycoplasma synoviae detection, in particular to a portable mycoplasma synoviae detection device and a method thereof.
Background
Avian mycoplasmas mainly infect poultry and are widely parasitic in the respiratory tract, cloaca, digestive tract, oviduct mucosa and joint capsule of poultry. The disease occurs all the year round, but is more frequent in winter and spring. Chickens at all ages are susceptible to infection, the susceptibility of chicks is higher than that of adult chickens, the resistance of the chicks is enhanced along with the increase of the age, the chicks are generally seen in 4-16 weeks old chickens, the morbidity is 5% -15%, and the mortality is about 1% -10%.
Most of the conventional methods for detecting mycoplasma synoviae in the market are fluorescence quantitative PCR methods, and although the detection method has many advantages, the detection method is high in material cost, long in detection time and complex in instrument operation, and special training personnel are needed.
Disclosure of Invention
In order to overcome the above defects in the prior art, embodiments of the present invention provide a portable mycoplasma synoviae detection apparatus and a method thereof, in which a primer mechanism is adopted to form the functions of annular counter flow and reverse flow, so that primer operation can be completed quickly, primer efficiency is improved, and detection is more convenient and faster, thereby solving the problems in the background art.
In order to achieve the purpose, the invention provides the following technical scheme: a portable mycoplasma synoviae detection device comprises a detection cylinder, wherein an embedded pipe is installed at the bottom end of the detection cylinder, four connecting pipes are annularly and equidistantly distributed on the outer wall of the embedded pipe, and a primer mechanism is installed at the top end of each connecting pipe;
primer mechanism is including setting up the first electric control valve on connecting pipe top, and installs second electric control valve at the connecting pipe outer wall, second electric control valve top intercommunication has the intake pipe, primer pipe is installed to first electric control valve top, is connected with the shunt tubes at primer pipe top, the shunt tubes outer wall from the top down is that annular equidistance distributes and has the multiunit arc to expand the stand pipe outward, and wherein a set of arc expands stand pipe one side outward and installs a plurality of reverse honeycomb ducts that set gradually from the top down, embedding bobbin bottom position department installs the switch over subassembly.
In a preferred embodiment, the embedded pipe is communicated with the connecting pipe, the upper end and the lower end of the primer pipe are respectively communicated with the flow dividing pipe and the first electric control valve, the reverse flow guiding pipe is communicated with the collecting pipe, the cross section of the reverse flow guiding pipe is arranged to be arc-shaped, and the opening of the reverse flow guiding pipe is arranged opposite to the opening of the arc-shaped outward-expanding guiding pipe.
In a preferred embodiment, the switching assembly comprises a pump installed at the bottom end of the embedded pipe, the input end of the pump is connected with an injection pipe, one side of the outer wall of the injection pipe is connected with a first electric control valve pipe, a first primer mixing box is installed at one end of the first electric control valve pipe, the other side of the outer wall of the injection pipe is connected with a second electric control valve pipe, and a second primer mixing box is installed at one end of the second electric control valve pipe.
In a preferred embodiment, an air inlet valve is installed at one end of the injection pipe, one end of the air inlet valve is communicated with an air supply pipe, a booster fan is installed at one end of the air supply pipe, the input end of the booster fan is communicated with a butt joint pipe, and injection threaded pipes are installed on the opposite sides of the first primer mixing box and the second primer mixing box.
In a preferred embodiment, the primer tube is externally sleeved with a processing mechanism, the processing mechanism comprises a reaction box arranged outside the primer tube, a heat-insulating sleeve is arranged outside the reaction box, four deflection flow tubes are arranged in a gap formed between the reaction box and the heat-insulating sleeve, the bottom ends of the deflection flow tubes are communicated with a collecting ring tube, the top ends of the deflection flow tubes are communicated with an upper ring collecting tube, a resistance heating rod is arranged between every two adjacent deflection flow tubes, the top ends of the upper ring collecting tubes are embedded and communicated with flow tubes, the bottom ends of the flow tubes are connected with annular shunt tubes, the bottom ends of the annular shunt tubes are communicated with injection stretching hoses, the bottom ends of the injection stretching hoses are provided with suction pumps for injecting cold water, the input ends of the suction pumps are communicated with annular bearing cylinders, the upper surfaces of the annular bearing cylinders are externally screwed with threaded covers, the suction pump is characterized in that a control button is arranged above the threaded cover and at one side of the suction pump, the control button is detachably connected with the threaded cover through a plurality of self-tapping bolts, four backflow pipes are annularly distributed outside the annular bearing cylinder, and the bottom ends of the backflow pipes are communicated with the outer wall of the collecting ring pipe.
In a preferred embodiment, the inside injection lid that is annular equidistance and distributes and set up that is provided with four of detection section of thick bamboo, two joint grooves have been seted up to the injection lid top, and have seted up annular spacing groove in joint inslot end, injection lid internally mounted has the arc to push down the body, the arc pushes down the body upper surface and is close to border position department and be connected with sealed the pad, sealed outer wall that fills up is provided with four cover and connects the ring, and is equipped with location branch at the cover ring inner part cover, location branch outside just is located cover and connects ring below position department and install the extrusion spring, the spacing piece that is used for location branch to support is connected to extrusion spring bottom, sealed pad and injection lid inner wall top position department looks joint, the injection lid top just is located joint groove one side position department embedding and installs the pressure relief valve.
A use method of a portable mycoplasma synoviae detection device comprises the following specific use steps:
step one, injecting chicken serum, inserting the injection gun into the injection cover, directly butting the clamping position of the injection gun in the clamping groove, pressing downwards and rotating to enter the annular limiting groove to complete clamping, the injection gun can drive the arc-shaped lower pressing body to move downwards, the arc-shaped lower pressing body drives the sealing gasket to move downwards, so that the sealing gasket drives the sleeve ring to move downwards along the outer part of the positioning support rod, the sleeve ring downwards extrudes the extrusion spring, and the extrusion spring completes compression operation on the limiting support block, the detected chicken serum can be injected downwards and flows into the reaction box along the arc-shaped pressing body, thus the chicken serum can be injected into other three reaction boxes according to the method, after injection is finished, the injection gun can be rotated, and the sleeve ring moves upwards along the positioning support rod under the action of the resilience force of the extrusion spring, so that the sealing gasket is driven to be clamped with the position above the inner wall of the injection cover;
step two, when the first round of primers is carried out, solution proportioning is carried out in the first primer mixing box according to the primer sequences of MS-F1(CAATGGACGATACAAAGAG) and MS-R1(TAGGGATACCTTGTTACGAC), the solution is filled into the first primer mixing box through an injection threaded pipe, the first electric control valve pipe can be opened, the second electric control valve pipe and an air inlet valve are closed, the second electric control valve is closed, then a pump machine is started, so that the proportioned primer solution in the first primer mixing box is injected into the injection pipe and enters the embedding pipe along the injection pipe, the embedding pipe is input into the first electric control valve, the proportioned primer solution enters the primer pipe through the first electric control valve and enters the shunt pipe along the primer pipe, annular primer flow injection is carried out through a plurality of arc-shaped external amplification guide pipes, the first round of primer operation is finished, and the primer solution can be combined with DNA to amplify fragments, in the primer process, a resistance heating rod outside the reaction box can be used for carrying out annular heating operation, the temperature rise is completed in the heat insulation sleeve, and when the temperature rises to 98 ℃ for 30s of pre-denaturation time, the circular reaction is carried out for 98 ℃ for 10s of denaturation;
the screw cap can be rotated to be not in threaded connection with the annular bearing cylinder any more, the annular bearing cylinder can be opened to add ice blocks and fill water, the screw cap is rotated to be in threaded butt joint with the annular bearing cylinder, then a suction pump machine is started, so that ice water in the annular bearing cylinder is sucked into the injection stretching hose, enters the annular shunt pipe along the injection stretching hose and then flows into the flow pipe, the flow pipe enters the upper ring collecting pipe and then flows into the plurality of bent flow pipes, the cooling operation on the outer part of the reaction box is completed, then the cooling ice water enters the collecting ring pipe and enters the reflux pipe, and then the cooling ice water flows back into the annular bearing cylinder to continue to circulate, so that the temperature can be reduced by 55 ℃ for annealing for 30s, then the cooling is stopped, the heating is continued to be carried out for 1.5min at 72 ℃, 40 circulations are carried out, and the circulation is carried out for 2min at 72 ℃;
step three, when a second round of primers is carried out, solution proportioning is carried out in a second primer mixing box according to the primer sequences of MS-F2(GAGAAGCAAAATAGTGATATCA) and MS-R2(CAGTCGTCTCCGAAGTTAACAA), the solution is stored in the second primer mixing box, a second electric control valve pipe can be opened to close a first electric control valve pipe and an air inlet valve, then the second electric control valve is closed, a pump machine is started, so that the proportioned primer solution in the second primer mixing box is injected into an injection pipe and enters an embedding pipe along the injection pipe, the embedding pipe enters the first electric control valve door and enters a shunt pipe along a primer pipe, annular primer flow injection is carried out through a plurality of arc-shaped external amplification guide pipes, the second round of primer operation is finished, fragments can be amplified only after the second primer solution is combined with DNA, and annular heating operation can be carried out by using a resistance heating rod outside the reaction box in the primer process, heating is finished in the heat preservation and insulation sleeve, and when the temperature is raised to 98 ℃ for 30s of pre-denaturation time, the circular reaction is carried out for 10s of denaturation at 98 ℃;
starting a suction pump machine, so that ice water in the annular bearing cylinder is sucked into the injection stretching hose, enters the annular shunt pipe along the injection stretching hose, enters the upper ring collecting pipe through the flow pipe, flows into the plurality of bent flow pipes, finishes cooling the outside of the reaction box to 49 ℃, anneals for 30s, stops cooling, continues to heat at 72 ℃ for 1.5min, performs 40 cycles, and extends for 2min after 72 ℃;
step four, when the circulation flow is mixed, the butt joint pipes can be butted with the air sterilizing box, namely the first electric control valve pipe, the second electric control valve pipe and the first electric control valve can be closed, the second electric control valve can be opened, thereby starting the booster fan to enable the butt joint pipe to suck sterile air into the air supply pipe, enter the injection pipe along the reaction box, then flow into the embedding pipe, enter the connecting pipe along the embedding pipe, are shunted into the second electric control valve and enter the air inlet pipe along the second electric control valve, enters the collecting pipe through the air inlet pipe and then is divided into a plurality of reverse flow guiding pipes, so that the mixed liquid in the reaction box can be subjected to opposite primer mixing, after the full amplification is carried out for one hour, the inserting rod can be pressed against the arc-shaped pressing body, so that the reaction solution in the reaction box can be poured into the agarose electrophoresis equipment, and then the agarose electrophoresis equipment is started to check the strip result, so that whether the infection exists can be judged.
The invention has the technical effects and advantages that:
1. the invention adopts a primer mechanism to mix solution in a first primer mixing box according to the primer sequences of MS-F1(CAATGGACGATACAAAGAG) and MS-R1(TAGGGATACCTTGTTACGAC) during a first round of primers, the solution is filled and stored in the first primer mixing box through an injection threaded pipe, then annular primer flow injection is carried out through a plurality of arc-shaped external amplification guide pipes, so that the first round of primer operation is completed, when a second round of primers is carried out, the solution is mixed in a second primer mixing box according to the primer sequences of MS-F2(GAGAAGCAAAATAGTGATATCA) and MS-R2(CAGTCGTCTCCGAAGTTAACAA), a second electric control valve pipe is opened to close a first electric control valve pipe and an air inlet valve, the annular primer flow injection is carried out through the plurality of arc-shaped external amplification guide pipes to complete the second round of primer operation, and the second electric control valve is opened to shunt the secondary primer sequence solution to the plurality of reverse guide pipes, so that the opposite primers can be mixed in the mixed solution in the reaction box, therefore, double-channel primer operation can be formed during primer operation, switching is convenient during the primer process, and annular opposite flow and reverse flow effects are formed during the primer operation, so that the primer operation can be quickly completed, the primer efficiency is improved, the detection is more convenient and quick, the material cost is low, the detection time is short, and the instrument operation is simple;
2. the invention adopts a resistance heating rod of a processing mechanism outside a reaction box to carry out annular heating operation, starts a suction pump machine, thereby sucking ice water inside an annular bearing cylinder into an injection stretching hose, entering into an annular shunt tube along the injection stretching hose, entering into an upper ring collecting tube and then flowing into a plurality of bent flow tubes, entering cooling ice water into a collecting ring tube into a backflow tube, and then flowing back into the annular bearing cylinder to continue to circulate;
3. the injection gun is inserted into the injection cover, the clamping position of the injection gun is directly butted inside the clamping groove and is pressed downwards to enter the annular limiting groove to complete clamping, the arc-shaped lower pressing body drives the sealing gasket to move downwards, the sleeving ring moves downwards along the outer part of the positioning support rod, the detected chicken serum is injected downwards and flows into the reaction box along the arc-shaped lower pressing body, after the injection is finished, the injection gun can be rotated, and under the action of the resilience force of the extrusion spring, the sealing gasket is clamped with the upper position of the inner wall of the injection cover, the clamping injection is conveniently finished when the chicken serum is injected each time, the automatic reset closing is carried out after the injection is finished, the influence of external impurities on the chicken serum is avoided, the breeding of bacteria can also be avoided, the invasion of external bacteria can be effectively reduced, the influence of bacteria on detection data and the influence of other impurities on the detection data are avoided, and the effect of high-precision detection is achieved;
in conclusion, through the mutual influence of the above functions, the switching is convenient in the primer process, and simultaneously, the circular opposite flow and the reverse flow are formed in the primer process, so that the primer operation can be quickly completed, the primer efficiency is improved, the detection is more convenient and quick, the material consumption cost is low, the detection time is short, the circular temperature rise operation is realized, the circular attaching type temperature reduction is realized in the annealing temperature reduction, the temperature rise and annealing switching operation can be quickly completed, the external temperature factor in the reaction can be more conveniently mastered, the better reaction adaptation condition is ensured, the invasion of external bacteria can be effectively reduced, the bacteria influence on the detection data and other impurities influence on the detection data, the high-precision detection effect is realized, the detection efficiency can be effectively improved, the detection convenience is realized, and the whole device is small and easy to carry, meanwhile, the adaptation requirement of the external temperature can be quickly realized, external impurities and bacteria are prevented from entering during reaction, and the marginalized injection effect is realized.
Drawings
Fig. 1 is a schematic view of the overall structure of the present invention.
Fig. 2 is a schematic overall bottom perspective view of the present invention.
FIG. 3 is a schematic view of the joint between the butt joint pipe and the blower pipe according to the present invention.
Fig. 4 is an enlarged schematic view of a portion a in fig. 3 according to the present invention.
FIG. 5 is a schematic view of the external structure of the thermal insulating sleeve of the present invention.
FIG. 6 is a schematic view of the internal structure of the thermal insulating sleeve of the present invention.
Fig. 7 is a schematic structural view of the junction of the shunt tube and the arc-shaped outward-expanding guide tube.
Fig. 8 is a schematic view of the sectional structure of the injection cap of the present invention.
The reference signs are: 1. a detection cylinder; 2. a control button; 3. an insert tube; 4. a connecting pipe; 5. a first electrically controlled valve; 6. a second electrically controlled valve; 7. an air inlet pipe; 8. a primer tube; 9. a shunt tube; 10. An arc-shaped external expanding guide pipe; 11. a reverse flow guide pipe; 12. a header; 13. a pump machine; 14. an injection pipe; 15. a first electrically controlled valve tube; 16. a first primer mixing tank; 17. a second electrically controlled valve tube; 18. a second primer mixing box; 19. an air inlet valve; 20. an air supply pipe; 21. a booster fan; 22. butt-joint pipes; 23. Injecting the threaded pipe; 24. a reaction box; 25. a heat-insulating sleeve; 26. collecting a ring pipe; 27. bending the flow pipe; 28. a resistance heating rod; 29. an upper ring header; 30. a flow tube; 31. an annular shunt tube; 32. Injecting a stretching hose; 33. a suction pump; 34. an annular bearing cylinder; 35. a return pipe; 36. a threaded cap; 37. an injection cap; 38. a clamping groove; 39. an annular limiting groove; 40. an arc-shaped pressing body; 41. a gasket; 42. a sleeving connection ring; 43. positioning the supporting rod; 44. a compression spring; 45. limiting the supporting block; 46. a pressure relief valve.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The portable mycoplasma synoviae detection device shown in the attached figures 1-8 comprises a detection cylinder 1, wherein an embedded pipe 3 is installed at the bottom end of the detection cylinder 1, four connecting pipes 4 are annularly and equidistantly distributed on the outer wall of the embedded pipe 3, and a primer mechanism is installed at the top ends of the connecting pipes 4;
primer mechanism is including setting up first electric control valve 5 on 4 tops of connecting pipe, and install second electric control valve 6 at 4 outer walls of connecting pipe, 6 top intercommunications of second electric control valve have intake pipe 7, 5 tops of first electric control valve install and draw thing pipe 8, be connected with shunt tubes 9 on drawing thing pipe 8 tops, shunt tubes 9 outer wall from the top down is that the annular equidistance distributes and has multiunit arc to expand stand pipe 10 outward, wherein a plurality of from the top down reverse honeycomb ducts 11 that set gradually are installed to 10 one side of stand pipe of a set of arc outer expansion, embedded pipe 3 bottom end position department installs the switching component.
In some embodiments, as shown in fig. 4-7, the inserting tube 3 is connected to the connecting tube 4, the upper and lower ends of the primer tube 8 are respectively connected to the dividing tube 9 and the first electrically controlled valve 5, so that the solution is inputted into the first electrically controlled valve 5 along the inserting tube 3, enters the primer tube 8 through the first electrically controlled valve 5, and is connected to the collecting tube 12 through the reverse flow guide tube 11, the cross section of the reverse flow guide tube 11 is set to be arc-shaped, the opening of the reverse flow guide tube 11 is set opposite to the opening of the arc-shaped outward-expanding guide tube 10, so that the solution enters the collecting tube 12 through the air inlet tube 7 and is divided into the reverse flow guide tubes 11, so that the mixture inside the reaction box 24 can be subjected to opposite primer mixing.
In some embodiments, as shown in fig. 4, the switching assembly includes a pump 13 installed at the bottom end of the insert pipe 3, an input end of the pump 13 is connected to an injection pipe 14, one side of an outer wall of the injection pipe 14 is connected to a first electric control valve pipe 15, a first primer mixing box 16 is installed at one end of the first electric control valve pipe 15, the other side of the outer wall of the injection pipe 14 is connected to a second electric control valve pipe 17, and a second primer mixing box 18 is installed at one end of the second electric control valve pipe 17, so that the second electric control valve pipe 17 is opened to close the first electric control valve pipe 15, the proportioning primer solution inside the second primer mixing box 18 is injected into the injection pipe 14, and the second electric control valve pipe 17 is closed to open the first electric control valve pipe 15, so that the proportioning primer solution can be injected into the injection pipe 14.
In some embodiments, as shown in fig. 3-4, an air inlet valve 19 is installed at one end of the injection pipe 14, one end of the air inlet valve 19 is connected to the air supply pipe 20, a booster fan 21 is installed at one end of the air supply pipe 20, an input end of the booster fan 21 is connected to the docking pipe 22, injection threaded pipes 23 are installed at opposite sides of the first primer mixing box 16 and the second primer mixing box 18, so that the injection threaded pipes 23 are filled and stored inside the first primer mixing box 16, and the booster fan 21 is started to enable the docking pipe 22 to suck sterile air into the air supply pipe 20 and enter the injection pipe 14 along the reaction box 24.
In some embodiments, as shown in fig. 1-6, a processing mechanism is sleeved outside the primer tube 8, the processing mechanism includes a reaction box 24 disposed outside the primer tube 8, a heat-insulating sleeve 25 is mounted outside the reaction box 24, four bending flow tubes 27 are mounted in a gap formed between the reaction box 24 and the heat-insulating sleeve 25, a collecting ring 26 is connected to the bottom end of each bending flow tube 27, an upper collecting ring 29 is connected to the top end of each bending flow tube 27, a resistance heating rod 28 is mounted between two adjacent bending flow tubes 27, a flow tube 30 is embedded and connected to the top end of each upper collecting ring 29, an annular shunt tube 31 is connected to the bottom end of each flow tube 30, an injection stretching hose 32 is connected to the bottom end of each annular shunt tube 31, a suction pump 33 for injecting cold water is mounted to the bottom end of each injection stretching hose 32, and an annular bearing cylinder 34 is connected to the input end of each suction pump 33, the upper surface of the annular bearing cylinder 34 and the external thread of the input end of the suction pump 33 are connected with a threaded cover 36, a control button 2 is arranged above the threaded cover 36 and at one side of the suction pump 33, the control button 2 and the threaded cover 36 are detachably connected through a plurality of self-tapping bolts, four return pipes 35 are annularly distributed outside the annular bearing cylinder 34, and the bottom ends of the return pipes 35 are communicated with the outer wall of the collecting ring pipe 26;
so that the annular heating operation can be carried out by utilizing the resistance heating rod 28 outside the reaction box 24, the temperature rise is completed inside the heat insulation sleeve 25, and when the temperature rises to 98 ℃ for the pre-denaturation time of 30s, the cyclic reaction is carried out for the denaturation time of 98 ℃ of 10 s;
the screw cap 36 can be rotated to be not in threaded connection with the annular bearing cylinder 34 any more, the annular bearing cylinder 34 can be opened to add ice blocks and fill water, the screw cap 36 is rotated to be in threaded connection with the annular bearing cylinder 34, then the suction pump 33 is started, so that ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular shunt pipe 31 along the injection stretching hose 32 and then is shunted into the flow pipe 30, the flow pipe 30 enters the upper ring header 29 and then flows into the plurality of bent flow deflection pipes 27, the cooling operation on the outside of the reaction box 24 is completed, then the cooling ice water enters the collecting ring pipe 26 and enters the return pipe 35, and then flows back into the annular bearing cylinder 34 to continue to circulate.
In some embodiments, as shown in fig. 1-8, four injection caps 37 are disposed inside the detection barrel 1, the injection caps 37 are disposed in an annular and equidistant manner, two clamping grooves 38 are disposed at the top end of each injection cap 37, an annular limiting groove 39 is disposed at the bottom end of each clamping groove 38, an arc-shaped pressing body 40 is mounted inside each injection cap 37, a sealing pad 41 is connected to a position, close to the edge, of the upper surface of each arc-shaped pressing body 40, four sleeving rings 42 are disposed on the outer wall of each sealing pad 41, a positioning support rod 43 is sleeved inside each sleeving ring 42, an extrusion spring 44 is mounted outside each positioning support rod 43 and below each sleeving ring 42, and the bottom end of each extrusion spring 44 is connected to a limiting support block 45 supported by the positioning support rod 43;
the sealing pad 41 is clamped with the upper position of the inner wall of the injection cover 37, a pressure relief valve 46 is embedded and installed at the position above the injection cover 37 and at one side of the clamping groove 38, so that the pressure relief valve 46 can perform the air exhaust operation on the air pressurized inside the reaction chamber 24, and the injection gun is inserted into the injection cover 37, the clamping position of the injection gun is directly butted against the inside of the clamping groove 38, the injection gun can drive the arc-shaped pressing body 40 to move downwards, so that the sealing gasket 41 drives the sleeve ring 42 to move downwards along the outer part of the positioning support rod 43, the extrusion spring 44 completes the compression operation on the limiting support block 45, the detected chicken serum can be injected downwards and flows into the reaction box 24 along the arc-shaped lower pressure body 40, when the injection is complete, the gun can be rotated and the collar 42 moved up the alignment struts 43 to move the sealing engagement under the resilience of the compression spring 44.
A use method of a portable mycoplasma synoviae detection device comprises the following specific use steps:
step one, injecting chicken serum, inserting an injection gun into the injection cover 37, directly butting the clamping position of the injection gun into the clamping groove 38, pressing and rotating downwards to enter the annular limiting groove 39 to complete clamping, so that the injection gun drives the arc-shaped pressing body 40 downwards to move downwards, the arc-shaped pressing body 40 drives the sealing gasket 41 to move downwards, the sealing gasket 41 drives the sleeving ring 42 to move downwards along the outer part of the positioning support rod 43, the sleeving ring 42 downwards extrudes the extrusion spring 44, the extrusion spring 44 completes compression operation on the limiting support block 45, the detected chicken serum can be injected downwards and flows into the reaction boxes 24 along the arc-shaped pressing body 40, and then the chicken serum can be injected into other three reaction boxes 24 according to the method, the injection gun can be rotated after injection is completed, and under the action of resilience force of the extrusion spring 44, the sleeve ring 42 moves upwards along the positioning support rod 43, so as to drive the sealing gasket 41 to be clamped with the position above the inner wall of the injection cover 37;
step two, when the first round of primers is carried out, the solution is proportioned in the first primer mixing box 16 according to the primer sequences of MS-F1 CAATGGACGATACAAGAG and MS-R1 TAGGGATACTTGTTACGAC, the solution is filled into the first primer mixing box 16 through the filling threaded pipe 23, namely, the first electric control valve pipe 15 is opened, the second electric control valve pipe 17 and the air inlet valve 19 are closed, the second electric control valve 6 is closed, then the pump machine 13 is started, so that the proportioned primer solution in the first primer mixing box 16 is filled into the filling pipe 14 and enters the embedding pipe 3 along the filling pipe 14, the filling pipe 3 is filled into the first electric control valve 5, the primer pipe 8 is filled into the primer pipe 8 through the first electric control valve 5, the primer pipe 8 is filled into the shunt pipe 9 along the primer pipe 8, and annular primer flow injection is carried out through the plurality of arc-shaped external amplification guide pipes 10, thus the first round of primer operation is completed, therefore, the fragments can be amplified only after the primer solution is combined with DNA, in the primer process, the annular heating operation can be carried out by using a resistance heating rod 28 outside the reaction box 24, the temperature rise is completed inside the heat insulation sleeve 25, and when the temperature rises to 98 ℃, the pre-denaturation time is 30s, and the cyclic reaction is carried out for denaturation at 98 ℃ for 10 s;
the screw cap 36 can be rotated to be not connected with the annular bearing cylinder 34 by screw thread, the annular bearing cylinder 34 can be opened to add ice blocks and fill water, the screw cap 36 can be rotated to be in butt joint with the annular bearing cylinder 34 by screw thread, then the suction pump 33 is started, so that the ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular shunt pipe 31 along the injection stretching hose 32, is shunted to the inside of the flow pipe 30, enters the upper collection pipe 29 through the flow pipe 30 and then flows into the plurality of deflection flow pipes 27, the cooling operation of the outside of the reaction box 24 is completed, then cooling ice water enters the collecting ring pipe 26, enters the return pipe 35, returns to the annular bearing cylinder 34 and continues to circulate, so that the temperature can be reduced by 55 ℃ and the annealing is carried out for 30s, then stopping cooling, continuing heating to 72 ℃, extending for 1.5min, performing 40 cycles, and extending for 2min at 72 ℃ after the cycle is finished;
step three, when the second round of primers is carried out, solution proportioning is carried out in the second primer mixing box 18 according to the primer sequences of MS-F2 GAAGCAAAATAGTGATATCA and MS-R2 CAGTCGTCCGAAGTTAACAA, the solution is stored in the second primer mixing box 18, namely, the second electric control valve pipe 17 can be opened to close the first electric control valve pipe 15 and the air inlet valve 19, then the second electric control valve 6 is closed, then the pump machine 13 is started, so that the proportioned primer solution in the second primer mixing box 18 is injected into the injection pipe 14, enters the embedding pipe 3 along the injection pipe 14, is input into the first electric control valve 5 from the embedding pipe 3, enters the shunt pipe 9 along the primer pipe 8, and then annular primer flowing injection is carried out through the plurality of arc-shaped external amplification guide pipes 10, so that the second round of primer operation is completed, and the fragment amplification can be carried out after the second primer solution is combined with DNA, in the primer process, annular heating operation can be carried out by using a resistance heating rod 28 outside the reaction box 24, temperature rise is completed inside the heat-insulating sleeve 25, and when the temperature rises to 98 ℃ for pre-denaturation time of 30s, the cyclic reaction is carried out for 98 ℃ denaturation 10 s;
starting a suction pump machine 33, so that ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular shunt pipe 31 along the injection stretching hose 32, enters the flow pipe 30 into the upper ring header 29 and then flows into the bending flow pipes 27, the outside of the reaction box 24 is cooled to 49 ℃ for annealing for 30s, then the cooling is stopped, the heating is continued at 72 ℃ for extending for 1.5min, 40 cycles are carried out, and the extending is carried out for 2min after the temperature is 72 ℃;
step four, when the mixture is circulated, the butt joint pipe 22 is butted with the air sterilizing box, namely the first electric control valve pipe 15, the second electric control valve pipe 17 and the first electric control valve 5 are closed, the second electric control valve 6 is opened, so that the booster fan 21 is started to enable the butt joint pipe 22 to suck the sterile air into the air supply pipe 20, the sterile air enters the injection pipe 14 along the reaction box 24, then flows into the embedding pipe 3, enters the connecting pipe 4 along the embedding pipe 3, is shunted into the second electric control valve 6, enters the air inlet pipe 7 along the second electric control valve 6, enters the collecting pipe 12 through the air inlet pipe 7, and is shunted into the plurality of reverse flow guide pipes 11, so that the mixed liquid in the reaction box 24 can be subjected to opposite primer mixing, when the mixed liquid is fully expanded for one hour, the inserting rod can be pressed against the arc-shaped lower pressing body 40, so that the reaction solution in the reaction box 24 can be poured into the agarose electrophoresis equipment, and then, starting an agarose electrophoresis device to check the band result to judge whether the infection exists.
The working principle of the invention is as follows:
the injection gun can be inserted into the injection cap 37, the injection gun drives the arc-shaped pressing body 40 downwards to move downwards, the arc-shaped pressing body 40 drives the sealing gasket 41 to move downwards, so that the sealing gasket 41 drives the coupling ring 42 to move downwards along the outside of the positioning strut 43, the compression spring 44 completes the compression operation on the limiting strut 45, the detected chicken serum can be injected downwards and flows into the reaction box 24 along the arc-shaped lower pressing body 40, when the injection is completed, the gun can be rotated, and under the action of the resilient force of the compression spring 44, the collar 42 moves up along the positioning strut 43, thereby driving the sealing gasket 41 to be clamped with the upper position of the inner wall of the injection cover 37, when the first round of primers, proportioning solution according to the primer sequences of MS-F1 CAATGGACGATACAAGAG and MS-R1 TAGGGATACTTGTTACGAC in the first primer mixing box 16, and filling and storing the solution in the first primer mixing box 16 through a filling threaded pipe 23;
namely, the first electric control valve tube 15 is opened to close the second electric control valve tube 17 and the air inlet valve 19, then the pump 13 is started, so that the proportioned primer solution in the first primer mixing box 16 is injected into the injection tube 14, enters the embedding tube 3 along the injection tube 14, is input into the first electric control valve 5 from the embedding tube 3, enters the primer tube 8 through the first electric control valve 5, enters the shunt tube 9 along the primer tube 8, and is subjected to annular primer flow injection through the plurality of arc-shaped outer amplification guide tubes 10, so that the first round of primer operation is completed, so that the fragments can be amplified after the primer solution is combined with DNA, in the primer process, the annular heating operation can be performed by using the resistance heating rod 28 outside the reaction box 24, the temperature rise can be completed in the heat insulation sleeve 25, when the temperature rises to 98 ℃ for the pre-denaturation time of 30s, performing cyclic reaction at 98 ℃ for 10 s;
the screw cap 36 can be rotated to be not connected with the annular bearing cylinder 34 by screw thread, the annular bearing cylinder 34 can be opened to add ice blocks and fill water, the screw cap 36 can be rotated to be in butt joint with the annular bearing cylinder 34 by screw thread, then the suction pump 33 is started, so that the ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular shunt pipe 31 along the injection stretching hose 32, is shunted to the inside of the flow pipe 30, enters the upper collection pipe 29 through the flow pipe 30 and then flows into the plurality of deflection flow pipes 27, the cooling operation of the outside of the reaction box 24 is completed, then cooling ice water enters the collecting ring pipe 26, enters the return pipe 35, returns to the annular bearing cylinder 34 and continues to circulate, so that the temperature can be reduced by 55 ℃ and the annealing is carried out for 30s, then stopping cooling, continuing heating to 72 ℃, extending for 1.5min, performing 40 cycles, and extending for 2min at 72 ℃ after the cycle is finished; during the second round of primers, the solution is proportioned in the second primer mixing box 18 according to the primer sequences of MS-F2 GAAGCAAATAGATATCA and MS-R2 CAGTCGTCCGAAGTTAACAA, and the solution is stored in the second primer mixing box 18, namely, the second electric control valve pipe 17 is opened to close the first electric control valve pipe 15 and the air inlet valve 19, then the second electric control valve 6 is closed, and then the pump machine 13 is started, so that the proportioned primer solution in the second primer mixing box 18 is injected into the injection pipe 14, enters the embedding pipe 3 along the injection pipe 14 and is input into the first electric control valve 5 through the embedding pipe 3;
entering a shunt tube 9 along a primer tube 8, and performing annular primer flow injection through a plurality of arc-shaped external amplification guide tubes 10 to complete a second round of primer operation, so that a second primer solution can be combined with DNA to amplify a fragment, in the primer process, performing annular heating operation by using a resistance heating rod 28 outside a reaction box 24, completing temperature rise inside a heat insulation sleeve 25, and entering a cyclic reaction for denaturation at 98 ℃ for 10s when the temperature rises to 98 ℃ for 30 s;
starting a suction pump machine 33, so that ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular shunt pipe 31 along the injection stretching hose 32, enters the flow pipe 30 into the upper ring header 29 and then flows into the bending flow pipes 27, the outside of the reaction box 24 is cooled to 49 ℃ for annealing for 30s, then the cooling is stopped, the heating is continued at 72 ℃ for extending for 1.5min, 40 cycles are carried out, and the extending is carried out for 2min at 72 ℃;
the first electric control valve pipe 15, the second electric control valve pipe 17 and the first electric control valve 5 are closed, the second electric control valve 6 is opened, the booster fan 21 enables the butt joint pipe 22 to suck sterile air into the air feeding pipe 20, the sterile air enters the injection pipe 14 along the reaction box 24, then flows into the embedded pipe 3, enters the connecting pipe 4 along the embedded pipe 3, is shunted into the second electric control valve 6 and enters the air inlet pipe 7 along the second electric control valve 6, enters the collecting pipe 12 through the air inlet pipe 7, so that the opposite direction primer mixing can be carried out on the mixed liquid in the reaction box 24, after one hour of full amplification, the inserting rod can be pressed against the arc-shaped pressing body 40, so that the reaction solution in the reaction box 24 can be poured into the agarose electrophoresis equipment, and then the agarose electrophoresis equipment is started to check the strip result, so that whether the strip is infected can be judged;
the points to be finally explained are: first, in the description of the present application, it should be noted that, unless otherwise specified and limited, the terms "mounted," "connected," and "connected" should be understood broadly, and may be a mechanical connection or an electrical connection, or a communication between two elements, and may be a direct connection, and "upper," "lower," "left," and "right" are only used to indicate a relative positional relationship, and when the absolute position of the object to be described is changed, the relative positional relationship may be changed;
secondly, the method comprises the following steps: in the drawings of the disclosed embodiments of the invention, only the structures related to the disclosed embodiments are referred to, other structures can refer to common designs, and the same embodiment and different embodiments of the invention can be combined with each other without conflict;
and finally: the present invention is not limited to the above preferred embodiments, but rather, any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (10)
1. The utility model provides a portable chicken synovial bursa mycoplasma detection device, is including detecting a section of thick bamboo (1), its characterized in that: the bottom end of the detection cylinder (1) is provided with an embedded pipe (3), the outer wall of the embedded pipe (3) is annularly and equidistantly distributed with four connecting pipes (4), and the top ends of the connecting pipes (4) are provided with primer mechanisms;
primer mechanism is including setting up first electrically controlled valve (5) on connecting pipe (4) top, and installs second electrically controlled valve (6) at connecting pipe (4) outer wall, second electrically controlled valve (6) top intercommunication has intake pipe (7), guide pipe (8) are installed to first electrically controlled valve (5) top, are connected with shunt tubes (9) on guide pipe (8) top, shunt tubes (9) outer wall from the top down is that the annular equidistance distributes and has outer stand pipe (10) that expands of multiunit arc, and wherein a plurality of from the top down reverse honeycomb ducts (11) that set gradually are installed to outer stand pipe (10) one side of expanding of a set of arc, embedding pipe (3) bottom position department installs the switch over subassembly.
2. The portable mycoplasma synoviae detection device of claim 1, wherein: the embedded pipe (3) is communicated with the connecting pipe (4), and the upper end and the lower end of the drainage pipe (8) are respectively communicated with the shunt pipe (9) and the first electric control valve (5) in pairs.
3. The portable mycoplasma synoviae detection device of claim 1, wherein: the reverse flow guide pipe (11) is communicated with the collecting pipe (12), the cross section of the reverse flow guide pipe (11) is arc-shaped, and the opening direction of the reverse flow guide pipe (11) is opposite to that of the arc-shaped outward-expanding guide pipe (10).
4. The portable mycoplasma synoviae detection device of claim 1, wherein: the switching component comprises a pump (13) installed at the bottom end of an embedded pipe (3), the input end of the pump (13) is connected with an injection pipe (14), one side of the outer wall of the injection pipe (14) is connected with a first electric control valve pipe (15), a first primer mixing box (16) is installed at one end of the first electric control valve pipe (15), the other side of the outer wall of the injection pipe (14) is connected with a second electric control valve pipe (17), and a second primer mixing box (18) is installed at one end of the second electric control valve pipe (17).
5. The portable Mycoplasma synoviae detection apparatus of claim 4, wherein: air inlet valve (19) are installed to injection pipe (14) one end, air inlet valve (19) one end intercommunication has blast pipe (20), and installs booster fan (21) in blast pipe (20) one end, booster fan (21) input intercommunication has butt joint pipe (22), injection screwed pipe (23) are all installed to first primer mixing box (16) and second primer mixing box (18) opposite one side.
6. The portable mycoplasma synoviae detection device of claim 1, wherein: the device is characterized in that a treatment mechanism is sleeved outside the primer pipe (8) and comprises a reaction box (24) arranged outside the primer pipe (8), a heat-preservation heat-insulation sleeve (25) is arranged outside the reaction box (24), four bending flow pipes (27) are arranged in a gap formed between the reaction box (24) and the heat-preservation heat-insulation sleeve (25), the bottom ends of the bending flow pipes (27) are communicated with a collecting ring pipe (26), the top ends of the bending flow pipes are communicated with an upper ring collecting pipe (29), two adjacent bending flow pipes (27) are all provided with a resistance heating rod (28), the top ends of the upper ring collecting pipes (29) are embedded and communicated with a flow pipe (30), the bottom ends of the flow pipes (30) are connected with annular shunt pipes (31), the bottom ends of the annular shunt pipes (31) are communicated with injection stretching hoses (32), and a suction pump (33) used for injecting cold water is arranged at the bottom ends of the injection stretching hoses (32), the input end of the suction pump (33) is communicated with an annular bearing cylinder (34), and the upper surface of the annular bearing cylinder (34) is in threaded connection with a threaded cover (36) outside the input end of the suction pump (33).
7. The portable Mycoplasma synoviae detection apparatus of claim 6, wherein: the suction pump is characterized in that a control button (2) is arranged above the threaded cover (36) and on one side of the suction pump (33), the control button (2) is detachably connected with the threaded cover (36) through a plurality of self-tapping bolts, four backflow pipes (35) are annularly distributed outside the annular bearing cylinder (34), and the bottom ends of the backflow pipes (35) are communicated with the outer wall of the collecting ring pipe (26).
8. The portable mycoplasma synoviae detection device of claim 1, wherein: detect a section of thick bamboo (1) inside and be four injection lid (37) that annular equidistance distributes and set up, two joint grooves (38) have been seted up on injection lid (37) top, and have seted up annular spacing groove (39) in joint groove (38) bottom, injection lid (37) internally mounted has the arc to push down body (40), the arc pushes down body (40) upper surface and is close to border position department and is connected with sealed pad (41), sealed pad (41) outer wall is provided with four cover and connects ring (42), and is equipped with location branch (43) in the inside cover of cup jointing ring (42), location branch (43) outside just is located cover and connects ring (42) below position department and installs extrusion spring (44).
9. The portable Mycoplasma synoviae detection apparatus of claim 8, wherein: extrusion spring (44) bottom is connected and is used for spacing piece (45) that support of location branch (43), sealed pad (41) and injection lid (37) inner wall top position department looks joint, injection lid (37) top just is located joint groove (38) one side position department embedding and installs pressure relief valve (46).
10. The portable Mycoplasma synoviae detection apparatus according to any one of claims 1-9, further comprising a method for using the portable Mycoplasma synoviae detection apparatus, comprising the following specific steps:
step one, injecting and injecting chicken serum, wherein an injection gun can be inserted into an injection cover (37), the clamping position of the injection gun is directly butted inside a clamping groove (38), and the injection gun is pressed downwards and rotated to enter the inside of an annular limiting groove (39) to complete clamping, so that the injection gun can drive an arc-shaped pressing body (40) to move downwards, the arc-shaped pressing body (40) drives a sealing gasket (41) to move downwards, the sealing gasket (41) drives a sleeving ring (42) to move downwards along the outside of a positioning support rod (43), the sleeving ring (42) downwards extrudes an extrusion spring (44), the extrusion spring (44) completes compression operation on a limiting support block (45), the detected chicken serum can be injected downwards and flows into a reaction box (24) along the arc-shaped pressing body (40), and then the chicken serum can be injected into other three reaction boxes (24) according to the method, after injection is finished, the injection gun can be rotated, and the sleeving connection ring (42) moves upwards along the positioning support rod (43) under the action of the resilience force of the extrusion spring (44), so that the sealing gasket (41) is driven to be clamped with the position above the inner wall of the injection cover (37);
step two, when the primers are used in the first round, the solution is proportioned in the first primer mixing box (16) according to the primer sequences of MS-F1(CAATGGACGATACAAAGAG) and MS-R1(TAGGGATACCTTGTTACGAC), the solution is filled into the first primer mixing box (16) through an injection threaded pipe (23), namely, a first electric control valve pipe (15) can be opened to close a second electric control valve pipe (17) and an air inlet valve (19), then the second electric control valve (6) is closed, then a pump machine (13) is started, so that the proportioned primer solution in the first primer mixing box (16) is injected into an injection pipe (14) and enters an embedding pipe (3) along the injection pipe (14), is input into the first electric control valve (5) through the embedding pipe (3), enters into a primer pipe (8) through the first electric control valve (5), and enters into a diversion pipe (9) along the primer pipe (8), then, circular primer flow spraying is carried out through a plurality of arc-shaped external amplification guide tubes (10), so that a first round of primer operation is completed, a primer solution can be combined with DNA to amplify fragments, in the primer process, a resistance heating rod (28) outside a reaction box (24) can be used for circular heating operation, temperature rise is completed inside a heat insulation sleeve (25), and when the temperature rises to 98 ℃ for 30s of pre-denaturation time, circular reaction is carried out for 10s of denaturation at 98 ℃;
the screw cap (36) can be rotated and is not connected with the annular bearing cylinder (34) in a threaded manner any more, the annular bearing cylinder (34) can be opened to add ice blocks and fill water, the screw cap (36) is rotated to be in threaded butt joint with the annular bearing cylinder (34), then the suction pump (33) is started, so that ice water in the annular bearing cylinder (34) is sucked into the injection stretching hose (32), enters the annular shunt pipe (31) along the injection stretching hose (32) and then is shunted into the flow pipe (30), the flow pipe (30) enters the upper collection pipe (29) and then flows into the plurality of bent baffling flow pipes (27), the cooling operation on the outside of the reaction box (24) is completed, then the cooling ice water enters the collection pipe (26) and enters the reflux pipe (35), then flows back into the annular bearing cylinder (34) to continue to circulate, and thus the cooling temperature can be reduced by 55 ℃ for annealing for 30s, then stopping cooling, continuing heating to 72 ℃, extending for 1.5min, performing 40 cycles, and extending for 2min at 72 ℃ after the cycle is finished;
step three, when the second round of primers is carried out, solution proportioning is carried out in the second primer mixing box (18) according to the primer sequences of MS-F2(GAGAAGCAAAATAGTGATATCA) and MS-R2(CAGTCGTCTCCGAAGTTAACAA), the solution is stored in the second primer mixing box (18), namely, a second electric control valve pipe (17) can be opened to close a first electric control valve pipe (15) and an air inlet valve (19), then a second electric control valve (6) is closed, then a pump machine (13) is started, so that the proportioned primer solution in the second primer mixing box (18) is injected into an injection pipe (14), enters an embedded pipe (3) along the injection pipe (14), is input into a first electric control valve (5) through the embedded pipe (3), enters a shunt pipe (9) along a primer pipe (8), and is subjected to annular primer flow injection through a plurality of arc-shaped external-expanding guide pipes (10), and thus the second round of primer operation is completed, therefore, the fragments can be amplified only after the second primer solution is combined with DNA, in the primer process, a resistance heating rod (28) outside a reaction box (24) can be used for carrying out annular heating operation, the temperature rise is finished inside a heat insulation sleeve (25), and when the temperature rises to 98 ℃ for pre-denaturation time of 30s, the circular reaction is carried out for 98 ℃ denaturation 10 s;
starting a suction pump (33), so that ice water in an annular bearing cylinder (34) is sucked into an injection stretching hose (32), enters an annular flow dividing pipe (31) along the injection stretching hose (32), enters a flow pipe (30) into an upper ring collecting pipe (29) and then flows into a plurality of bending flow dividing pipes (27), the external of a reaction box (24) is cooled to 49 ℃ for annealing for 30s, then the cooling is stopped, the heating is continued at 72 ℃ for extending for 1.5min, 40 cycles are carried out, and the extending time is 2min after the temperature is 72 ℃;
step four, when the mixture flows circularly and mixes, the air sterilizing box butted with the butting pipe (22) can be closed, namely the first electric control valve pipe (15), the second electric control valve pipe (17) and the first electric control valve (5) are closed, the second electric control valve (6) is opened, so that the booster fan (21) is started to ensure that the butting pipe (22) sucks the sterile air into the air conveying pipe (20), the sterile air enters the injection pipe (14) along the reaction box (24), then flows into the embedding pipe (3), enters the connecting pipe (4) along the embedding pipe (3), is shunted into the second electric control valve (6), enters the air inlet pipe (7) along the second electric control valve (6), enters the header pipe (12) through the air inlet pipe (7), and then is shunted into the plurality of reverse flow guide pipes (11), thus the mixed liquid in the reaction box (24) can be subjected to opposite-direction primer mixing, after the full amplification is carried out for one hour, the inserting rod can be pressed against the arc-shaped pressing body (40), so that the reaction solution in the reaction box (24) can be poured into the agarose electrophoresis equipment, and then the agarose electrophoresis equipment is started to check the strip result to judge whether the infection exists.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210137800.2A CN114480098B (en) | 2022-02-15 | 2022-02-15 | Portable chicken bursa mycoplasma detection device and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210137800.2A CN114480098B (en) | 2022-02-15 | 2022-02-15 | Portable chicken bursa mycoplasma detection device and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114480098A true CN114480098A (en) | 2022-05-13 |
| CN114480098B CN114480098B (en) | 2023-10-03 |
Family
ID=81481383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210137800.2A Active CN114480098B (en) | 2022-02-15 | 2022-02-15 | Portable chicken bursa mycoplasma detection device and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114480098B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970476A (en) * | 2023-07-25 | 2023-10-31 | 山东省动物疫病预防与控制中心(山东省人畜共患病流调监测中心) | Detection device and detection method for mycoplasma synoviae of chickens |
Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0630776A (en) * | 1992-07-13 | 1994-02-08 | Rikagaku Kenkyusho | Method for amplifying dna and device for amplifying dna |
| US20040248087A1 (en) * | 1997-05-02 | 2004-12-09 | Burg J. Lawrence | Nucleic acid assays |
| CN104998570A (en) * | 2015-06-30 | 2015-10-28 | 刘宇 | Medicine mixing device |
| US20160304939A1 (en) * | 2010-02-12 | 2016-10-20 | Biotrack Holding B.V. | Methods for Detecting Micro-Organisms and/or Biological Substances in a Fluid |
| CN108467105A (en) * | 2018-04-12 | 2018-08-31 | 南宁绿智环保科技有限公司 | A kind of denitrification aerobic granular sludge continuous flow reactor and its working method |
| CN108866162A (en) * | 2018-07-03 | 2018-11-23 | 芜湖启邦电力技术服务有限公司 | A kind of nucleic acid amplifier of agility temperature control |
| CN208562387U (en) * | 2018-04-24 | 2019-03-01 | 洛阳现代生物技术研究院有限公司 | A device for detecting poultry pathogens |
| CN110331090A (en) * | 2019-07-12 | 2019-10-15 | 湖南圣湘生物科技有限公司 | Nucleic acid extraction, amplification and detection device |
| CN110862907A (en) * | 2019-12-06 | 2020-03-06 | 中国科学院长春光学精密机械与物理研究所 | Nucleic acid extraction preliminary treatment amplification system |
| CN111690758A (en) * | 2020-07-31 | 2020-09-22 | 江苏立华牧业股份有限公司 | Nested PCR (polymerase chain reaction) primer, detection method and kit for detecting mycoplasma synoviae |
| CN111826273A (en) * | 2020-07-22 | 2020-10-27 | 赵毅 | Automatic totally-enclosed micro-fluidic chip for nucleic acid detection |
| CN215250802U (en) * | 2021-05-10 | 2021-12-21 | 上海蓝析生物技术有限公司 | Quick check out test set of mycoplasma |
| CN113817592A (en) * | 2020-06-19 | 2021-12-21 | 安徽为臻生物工程技术有限公司 | Anti-pollution detection device and method for rapid detection of nucleic acid amplification product and application |
-
2022
- 2022-02-15 CN CN202210137800.2A patent/CN114480098B/en active Active
Patent Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0630776A (en) * | 1992-07-13 | 1994-02-08 | Rikagaku Kenkyusho | Method for amplifying dna and device for amplifying dna |
| US20040248087A1 (en) * | 1997-05-02 | 2004-12-09 | Burg J. Lawrence | Nucleic acid assays |
| US20160304939A1 (en) * | 2010-02-12 | 2016-10-20 | Biotrack Holding B.V. | Methods for Detecting Micro-Organisms and/or Biological Substances in a Fluid |
| CN104998570A (en) * | 2015-06-30 | 2015-10-28 | 刘宇 | Medicine mixing device |
| CN108467105A (en) * | 2018-04-12 | 2018-08-31 | 南宁绿智环保科技有限公司 | A kind of denitrification aerobic granular sludge continuous flow reactor and its working method |
| CN208562387U (en) * | 2018-04-24 | 2019-03-01 | 洛阳现代生物技术研究院有限公司 | A device for detecting poultry pathogens |
| CN108866162A (en) * | 2018-07-03 | 2018-11-23 | 芜湖启邦电力技术服务有限公司 | A kind of nucleic acid amplifier of agility temperature control |
| CN110331090A (en) * | 2019-07-12 | 2019-10-15 | 湖南圣湘生物科技有限公司 | Nucleic acid extraction, amplification and detection device |
| CN110862907A (en) * | 2019-12-06 | 2020-03-06 | 中国科学院长春光学精密机械与物理研究所 | Nucleic acid extraction preliminary treatment amplification system |
| CN113817592A (en) * | 2020-06-19 | 2021-12-21 | 安徽为臻生物工程技术有限公司 | Anti-pollution detection device and method for rapid detection of nucleic acid amplification product and application |
| CN111826273A (en) * | 2020-07-22 | 2020-10-27 | 赵毅 | Automatic totally-enclosed micro-fluidic chip for nucleic acid detection |
| CN111690758A (en) * | 2020-07-31 | 2020-09-22 | 江苏立华牧业股份有限公司 | Nested PCR (polymerase chain reaction) primer, detection method and kit for detecting mycoplasma synoviae |
| CN215250802U (en) * | 2021-05-10 | 2021-12-21 | 上海蓝析生物技术有限公司 | Quick check out test set of mycoplasma |
Non-Patent Citations (3)
| Title |
|---|
| HUNG-CHIH KUO等: "Rapid and sensitive detection of Mycoplasma synoviae by an insulated isothermal polymerase chain reaction-based assay on a field-deployable device", POULTRY SCIENCE, vol. 96, no. 1, pages 35 * |
| ZHENQING LI等: "All-in-one microfluidic device for on-site diagnosis of pathogens based on integrated continuous flow PCR and electrophoresis biochip", LAB ON A CHIP, vol. 19, no. 16, pages 2663 - 2668 * |
| 英聪: "应用PCR法检测生物制品中支原体污染", 中国优秀硕士学位论文全文数据库农业科技辑, no. 02, pages 050 - 211 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970476A (en) * | 2023-07-25 | 2023-10-31 | 山东省动物疫病预防与控制中心(山东省人畜共患病流调监测中心) | Detection device and detection method for mycoplasma synoviae of chickens |
| CN116970476B (en) * | 2023-07-25 | 2024-03-12 | 山东省动物疫病预防与控制中心(山东省人畜共患病流调监测中心) | Detection device and detection method for mycoplasma synoviae of chickens |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114480098B (en) | 2023-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114480098A (en) | Portable chicken bursal mycoplasma detection device and method thereof | |
| CN105436136A (en) | Bearing cleaning machine capable of saving water resource | |
| CN116790375A (en) | Cell culture device | |
| CN107421242A (en) | A kind of Transformer Winding drying device | |
| CN116587580B (en) | A hot pressing blister forming device | |
| CN106871221A (en) | A kind of energy-conserving and environment-protective electric heater | |
| CN218863499U (en) | Novel environment-friendly PE feed pipe | |
| CN213570401U (en) | White spirit processingequipment convenient to quick cooling | |
| CN205626177U (en) | Novel beastly medical injector | |
| CN204787321U (en) | Vacuum tube solar water heater | |
| CN109619148B (en) | Closed boiling hot pond | |
| CN113465289A (en) | PVC is circulating water cooling plant for pipe production | |
| CN208646096U (en) | Device of tyre is dried in a kind of fetus cleaning of special tyre | |
| CN219735590U (en) | Fresh air purifier ventilation piece capable of preventing condensate water from flowing backwards | |
| CN223840796U (en) | A rapid drying equipment for tofu skin | |
| CN220201882U (en) | Cell factory operation pipeline equipment | |
| CN211323620U (en) | Heated air circulation lotus platform of beating | |
| CN210463850U (en) | Rubber plug dryer | |
| CN213321526U (en) | Prevent electrical apparatus injection mold of product deformation | |
| CN204907452U (en) | Sheep hurdle heating system | |
| CN219803168U (en) | Exhaust gas waste heat recovery ventilation equipment | |
| CN217583592U (en) | Heating wire water heating blanket two-way quick connector | |
| CN209801705U (en) | Heat supply and ventilation device for building construction | |
| CN210786326U (en) | A positive pressure compensation device for a solid phase extraction device | |
| CN222852547U (en) | A coil structure with anti-leakage and high-efficiency heat dissipation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |