CN114480098B - Portable chicken bursa mycoplasma detection device and method thereof - Google Patents
Portable chicken bursa mycoplasma detection device and method thereof Download PDFInfo
- Publication number
- CN114480098B CN114480098B CN202210137800.2A CN202210137800A CN114480098B CN 114480098 B CN114480098 B CN 114480098B CN 202210137800 A CN202210137800 A CN 202210137800A CN 114480098 B CN114480098 B CN 114480098B
- Authority
- CN
- China
- Prior art keywords
- pipe
- primer
- injection
- control valve
- electric control
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 48
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 37
- 241000204031 Mycoplasma Species 0.000 title claims abstract description 22
- 241001260012 Bursa Species 0.000 title claims abstract description 20
- 238000000034 method Methods 0.000 title abstract description 18
- 230000007246 mechanism Effects 0.000 claims abstract description 18
- 238000002347 injection Methods 0.000 claims description 114
- 239000007924 injection Substances 0.000 claims description 114
- 238000002156 mixing Methods 0.000 claims description 41
- 238000010438 heat treatment Methods 0.000 claims description 29
- 210000001503 joint Anatomy 0.000 claims description 23
- 238000003825 pressing Methods 0.000 claims description 21
- 238000007789 sealing Methods 0.000 claims description 19
- 238000009413 insulation Methods 0.000 claims description 16
- 238000001125 extrusion Methods 0.000 claims description 13
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 7
- 235000017166 Bambusa arundinacea Nutrition 0.000 claims description 2
- 235000017491 Bambusa tulda Nutrition 0.000 claims description 2
- 241001330002 Bambuseae Species 0.000 claims description 2
- 235000015334 Phyllostachys viridis Nutrition 0.000 claims description 2
- 239000011425 bamboo Substances 0.000 claims description 2
- 238000010079 rubber tapping Methods 0.000 claims description 2
- 230000008569 process Effects 0.000 abstract description 9
- 239000000243 solution Substances 0.000 description 33
- 235000013330 chicken meat Nutrition 0.000 description 26
- 238000001816 cooling Methods 0.000 description 19
- 239000005457 ice water Substances 0.000 description 13
- 238000005452 bending Methods 0.000 description 9
- 210000002966 serum Anatomy 0.000 description 9
- 238000000137 annealing Methods 0.000 description 8
- 230000006835 compression Effects 0.000 description 8
- 238000007906 compression Methods 0.000 description 8
- 238000004925 denaturation Methods 0.000 description 8
- 230000036425 denaturation Effects 0.000 description 8
- 230000000694 effects Effects 0.000 description 7
- 229920000936 Agarose Polymers 0.000 description 6
- 238000001962 electrophoresis Methods 0.000 description 6
- 239000012634 fragment Substances 0.000 description 6
- 239000011259 mixed solution Substances 0.000 description 6
- 241000894006 Bacteria Species 0.000 description 5
- 238000004401 flow injection analysis Methods 0.000 description 5
- 241000204003 Mycoplasmatales Species 0.000 description 4
- 125000004122 cyclic group Chemical group 0.000 description 4
- 208000015181 infectious disease Diseases 0.000 description 4
- 238000012257 pre-denaturation Methods 0.000 description 4
- 230000006978 adaptation Effects 0.000 description 3
- 244000144977 poultry Species 0.000 description 3
- 235000013594 poultry meat Nutrition 0.000 description 3
- 230000035484 reaction time Effects 0.000 description 3
- 239000012535 impurity Substances 0.000 description 2
- 230000009545 invasion Effects 0.000 description 2
- 238000010030 laminating Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 239000007921 spray Substances 0.000 description 2
- 230000001954 sterilising effect Effects 0.000 description 2
- 230000009471 action Effects 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 210000003555 cloaca Anatomy 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 210000001035 gastrointestinal tract Anatomy 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 210000004400 mucous membrane Anatomy 0.000 description 1
- 210000003101 oviduct Anatomy 0.000 description 1
- 230000003071 parasitic effect Effects 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 230000000630 rising effect Effects 0.000 description 1
- 238000012549 training Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M41/00—Means for regulation, monitoring, measurement or control, e.g. flow regulation
- C12M41/12—Means for regulation, monitoring, measurement or control, e.g. flow regulation of temperature
- C12M41/18—Heat exchange systems, e.g. heat jackets or outer envelopes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M23/00—Constructional details, e.g. recesses, hinges
- C12M23/38—Caps; Covers; Plugs; Pouring means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M27/00—Means for mixing, agitating or circulating fluids in the vessel
- C12M27/18—Flow directing inserts
- C12M27/24—Draft tube
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M29/00—Means for introduction, extraction or recirculation of materials, e.g. pumps
- C12M29/06—Nozzles; Sprayers; Spargers; Diffusers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M29/00—Means for introduction, extraction or recirculation of materials, e.g. pumps
- C12M29/26—Conditioning fluids entering or exiting the reaction vessel
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M33/00—Means for introduction, transport, positioning, extraction, harvesting, peeling or sampling of biological material in or from the apparatus
- C12M33/04—Means for introduction, transport, positioning, extraction, harvesting, peeling or sampling of biological material in or from the apparatus by injection or suction, e.g. using pipettes, syringes, needles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M37/00—Means for sterilizing, maintaining sterile conditions or avoiding chemical or biological contamination
- C12M37/04—Seals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Sustainable Development (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Thermal Sciences (AREA)
- Clinical Laboratory Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses a portable chicken bursa mycoplasma detection device and a method thereof, and in particular relates to the technical field of chicken bursa mycoplasma detection, comprising a detection cylinder, wherein an embedded pipe is arranged at the bottom end of the detection cylinder, four connecting pipes are annularly and equidistantly distributed on the outer wall of the embedded pipe, and a primer mechanism is arranged at the top end of each connecting pipe; the primer mechanism comprises a first electric control valve arranged at the top end of the connecting pipe, a second electric control valve is arranged on the outer wall of the connecting pipe, an air inlet pipe is communicated with the upper side of the second electric control valve, and a primer pipe is arranged above the first electric control valve. The application adopts the primer mechanism, is convenient to switch in the primer process, forms the functions of annular opposite flow and reverse flow when the primer is used, can rapidly finish the primer operation, improves the primer efficiency, is more convenient and rapid to detect, has low consumable cost, short detection time and simple instrument operation.
Description
Technical Field
The application relates to the technical field of chicken bursa mycoplasma detection, in particular to a portable chicken bursa mycoplasma detection device and a portable chicken bursa mycoplasma detection method.
Background
Poultry mycoplasma mainly infects poultry and is widely parasitic in respiratory tracts, cloaca, digestive tracts, oviduct mucous membranes and joint sacs of the poultry. The disease occurs all the year round, but is more frequent in winter and spring. The chickens are easy to infect, the susceptibility of the chickens is higher than that of adult chickens, the resistance of the chickens can be enhanced along with the increase of the age, the chickens are generally seen in chickens of 4-16 weeks old, the morbidity is 5% -15%, and the mortality is about 1% -10%. The culture farms in the provinces of 11 of the east China, north China, south China, middle China, northeast China and northwest China are subjected to stack adjustment, the mycoplasma synoviae infection positive rate is 30.23% -54.67%, the average positive rate is 41.42%, the morbidity of the mycoplasma synoviae presents a trend of rising year by year, and the mycoplasma synoviae becomes an important pathogen for preventing sustainable development of chicken industry in China, so that the establishment of a rapid, stable and accurate detection method of the mycoplasma synoviae is very necessary.
Most of the existing chicken bursa mycoplasma detection methods in the market are fluorescent quantitative PCR methods, and although the detection methods have a plurality of advantages, the consumable cost is high, the detection time is long, the instrument operation is complex, and special training personnel are needed.
Disclosure of Invention
In order to overcome the defects in the prior art, the embodiment of the application provides a portable chicken bursa mycoplasma detection device and a method thereof, and the application adopts a primer mechanism to form the functions of annular opposite flow and reverse flow, so that the primer operation can be rapidly completed, the primer efficiency is improved, and the detection is more convenient and rapid, so as to solve the problems in the background technology.
In order to achieve the above purpose, the present application provides the following technical solutions: the portable chicken bursa mycoplasma detection device comprises a detection cylinder, wherein an embedded pipe is arranged at the bottom end of the detection cylinder, four connecting pipes are distributed on the outer wall of the embedded pipe at equal intervals in a ring shape, and a primer mechanism is arranged at the top end of each connecting pipe;
the primer mechanism comprises a first electric control valve arranged at the top end of a connecting pipe, a second electric control valve is arranged on the outer wall of the connecting pipe, an air inlet pipe is communicated with the upper portion of the second electric control valve, a primer pipe is arranged above the first electric control valve, a shunt pipe is connected to the top end of the primer pipe, a plurality of groups of arc-shaped expansion guide pipes are distributed on the outer wall of the shunt pipe from top to bottom in an annular equidistant manner, a plurality of reverse guide pipes are arranged on one side of each of the arc-shaped expansion guide pipes from top to bottom in sequence, and a switching assembly is arranged at the bottom end position of the embedded pipe.
In a preferred embodiment, the embedded pipe is communicated with the connecting pipe, the upper end and the lower end of the primer pipe are respectively communicated with the shunt pipe and the first electric control valve in pairs, the reverse flow guide pipe is communicated with the collecting pipe, the cross section of the reverse flow guide pipe is arranged in an arc shape, the opening of the reverse flow guide pipe is arranged in the opposite direction to the opening of the arc-shaped outward-expanding guide pipe, and the reverse flow guide pipe is communicated with the air inlet pipe through the collecting pipe.
In a preferred embodiment, the switching assembly comprises a pump installed at the bottom end of the embedded pipe, the input end of the pump is connected with an injection pipe, one side of the outer wall of the injection pipe is connected with a first electric control valve pipe, a first primer mixing box is installed at one end of the first electric control valve pipe, the other side of the outer wall of the injection pipe is connected with a second electric control valve pipe, and a second primer mixing box is installed at one end of the second electric control valve pipe.
In a preferred embodiment, an air inlet valve is installed at one end of the injection pipe, an air supply pipe is communicated with one end of the air inlet valve, a booster fan is installed at one end of the air supply pipe, a butt joint pipe is communicated with the input end of the booster fan, and injection threaded pipes are installed on the opposite sides of the first primer mixing box and the second primer mixing box.
In a preferred embodiment, the primer pipe is externally sleeved with a treatment mechanism, the treatment mechanism comprises a reaction box arranged outside the primer pipe, a heat insulation sleeve is arranged at the outer part of the reaction box, four bending baffle pipes are arranged in a gap formed between the reaction box and the heat insulation sleeve, a collecting ring pipe is communicated with the bottom end of each bending flow pipe, an upper ring collecting pipe is communicated with the top end of each bending flow pipe, resistance heating rods are arranged between every two adjacent bending flow pipes, the top ends of the upper ring collecting pipes are embedded and communicated with the flow pipes, annular shunt pipes are connected with the bottom ends of the flow pipes, injection extension hoses are communicated with the bottom ends of the annular shunt pipes, suction pumps for injecting cold water are arranged at the bottom ends of the injection extension hoses, annular bearing cylinders are communicated with the input ends of the suction pumps, threaded covers are arranged on the upper surfaces of the annular bearing cylinders and are in threaded connection with the outer sides of the input ends of the suction pumps, control buttons are arranged at the positions of one sides of the suction pumps, and the control buttons are detachably connected with the threaded covers through a plurality of self-detachable connecting rings, and the four annular bearing cylinders are distributed with the outer walls of the annular bearing cylinders.
In a preferred embodiment, the inside injection lid that is annular equidistance and distributes and set up that is provided with of detection section of thick bamboo, two joint grooves have been seted up to injection lid top, and have seted up annular spacing groove in joint groove bottom, injection lid internally mounted has the arc to push down the body, the arc pushes down body upper surface and is close to edge position department and is connected with sealed the pad, sealed pad outer wall is provided with four cup joints the ring, and cup joints the inside cover of ring and be equipped with location branch, location branch outside just is located cup joints ring below position department and installs extrusion spring, extrusion spring bottom connection is used for the spacing piece that location branch supported, sealed pad and injection lid inner wall top position looks joint, injection lid top just is located joint groove one side position department embedding and installs the relief valve.
The application method of the portable chicken bursa mycoplasma detection device comprises the following specific application steps:
injecting chicken serum into the injection cover, wherein the injection gun can be inserted into the injection cover, the clamping position of the injection gun is directly butted in the clamping groove, so that the injection gun is pressed downwards to rotate to enter the annular limiting groove to finish the clamping, the arc-shaped pressing body is driven downwards to move downwards by the injection gun, the sealing gasket is driven to move downwards by the arc-shaped pressing body, the sealing gasket drives the sleeving ring to move downwards along the outer part of the positioning supporting rod, the sleeving ring downwards extrudes the extrusion spring, the extrusion spring finishes the compression operation on the limiting supporting rod, the chicken serum which is detected can be injected downwards, flows into the reaction box along the arc-shaped pressing body, can be injected into the other three reaction boxes according to the method, can rotate the injection gun after the injection is finished, and moves upwards along the positioning supporting rod under the rebound force of the extrusion spring, so that the sealing gasket is driven to finish the clamping with the upper position of the inner wall of the injection cover;
step two, when a first round of primer is carried out, the interior of a first primer mixing box is filled with a proportioning solution according to an MS-F1CAATGGACGATACAAAGAG primer sequence and an MS-R1TAGGGATACCTTGTTACGAC primer sequence through an injection threaded pipe, the interior of the first primer mixing box can be opened, a second electric control valve pipe and an air inlet valve can be closed by opening the first electric control valve pipe, the second electric control valve is closed again, then a pump is started, so that the proportioning primer solution in the interior of the first primer mixing box is injected into the injection pipe, enters an embedding pipe along the injection pipe, is input into the first electric control valve through the embedding pipe, enters the primer pipe through the first electric control valve, enters a shunt pipe along the primer pipe, and then enters a plurality of arc-shaped external expansion guide pipes for circular primer flow injection, so that a first round of primer operation is completed, a fragment can be amplified after the primer solution is combined with DNA, in the process of the primer, the circular heating operation can be carried out by utilizing a resistance heating rod outside the reaction box, and the interior of a heat insulation sleeve is completed, when the temperature is raised to 98 ℃, the temperature is raised to be kept at a preset temperature for 30 ℃ and enters a denaturation reaction time of 98 s, and the denaturation cycle is carried out for 10s;
the screw cap can be rotated to be no longer in threaded connection with the annular bearing cylinder, ice cubes can be added into the annular bearing cylinder, water is poured into the annular bearing cylinder, the screw cap is rotated to be in threaded butt joint with the annular bearing cylinder, then a suction pump is started, ice water in the annular bearing cylinder is sucked into the injection stretching hose, enters the annular shunt tube along the injection stretching hose and then is shunted into the flow tube, the flow tube enters the upper ring collecting tube and then flows into the plurality of curved baffle tubes, the cooling operation on the outside of the reaction box is completed, then cooling ice water enters the collecting ring tube and enters the return tube, and then flows back into the annular bearing cylinder to continue to circulate, the temperature can be reduced by 55 ℃, annealing is carried out for 30s, then cooling is stopped, heating is continued to 72 ℃, the temperature is extended for 1.5min, 40 cycles are carried out, and the temperature is reduced for 2min after the circulation is completed;
step three, during the second round of primer, the second primer mixing box is internally provided with a proportioning solution according to MS-F2GAGAAGCAAAATAGTGATATCA and MS-R2CAGTCGTCTCCGAAGTTAACAA primer sequences, the proportioning solution is stored in the second primer mixing box, a second electric control valve pipe can be opened to close a first electric control valve pipe and an air inlet valve, then the second electric control valve is closed, a pump is started, so that the proportioning primer solution in the second primer mixing box is injected into an injection pipe, enters an embedding pipe along the injection pipe, is input into the first electric control valve through the embedding pipe, enters a shunt pipe along the primer pipe, and then flows and sprays through a plurality of arc-shaped external expansion guide pipes in an annular primer mode, thus the second round of primer operation is completed, the second primer solution can be combined with DNA, the fragments can be amplified, in the primer process, the annular heating operation can be performed by using a resistance heating rod outside the reaction box, the temperature is increased to be completed in the heat-preserving heat insulating sleeve, when the temperature is increased to 98 ℃, the temperature is increased to be preset for 30s, and the cyclic reaction is carried out for 10s;
starting a suction pump machine, thereby sucking ice water in the annular bearing cylinder into the injection stretching hose, entering the annular shunt pipe along the injection stretching hose, entering the upper annular shunt pipe through the flow pipe, and then flowing into the plurality of curved baffle pipes to finish cooling the outside of the reaction tank to 49 ℃, annealing for 30s, stopping cooling, continuing heating to 72 ℃, extending for 1.5min, performing 40 cycles, and extending for 2min at 72 ℃ after the cycle is completed;
and fourthly, when the circulation flows and mixes, the butt joint pipe can be butt jointed with the air sterilizing box, namely, the first electric control valve pipe, the second electric control valve pipe and the first electric control valve can be closed, and the second electric control valve is opened, so that the booster fan is started to enable the butt joint pipe to suck sterile air into the air supply pipe, the sterile air enters the injection pipe along the reaction box and then flows into the embedded pipe, enters the connecting pipe along the embedded pipe, is split into the second electric control valve, enters the air inlet pipe along the second electric control valve, enters the collecting pipe through the air inlet pipe and then is split into a plurality of reverse guide pipes, and then, the mixed solution inside the reaction box can be mixed with the opposite primers, after the mixed solution is fully amplified for one hour, the inserting rod is pressed against the arc-shaped pressing body, so that the reaction solution inside the reaction box is poured into the agarose electrophoresis equipment, and then the agarose electrophoresis equipment is started to check the strip result, and whether the infection is judged.
The application has the technical effects and advantages that:
according to the application, a primer mechanism is adopted to mix solutions in a first primer mixing box according to an MS-F1CAATGGACGATACAAAGAG primer sequence and an MS-R1TAGGGATACCTTGTTACGAC primer sequence in a first primer mixing box, the solutions are filled into the first primer mixing box through a filling threaded pipe and are stored in a plurality of arc-shaped expansion guide pipes to carry out annular primer flow injection, so that the first primer operation is finished, during a second primer, the second primer mixing box is mixed with solutions according to an MS-F2GAGAAGCAAAATAGTGATATCA primer sequence and an MS-R2CAGTCGTCTCCGAAGTTAACAA primer sequence in the second primer mixing box, a second electric control valve pipe is opened to close the first electric control valve pipe and an air inlet valve, the plurality of arc-shaped expansion guide pipes carry out annular primer flow injection, the second primer operation is finished, the second primer sequence solution is split into a plurality of reverse guide pipes, and the mixed solution in the reaction box can be subjected to opposite primer mixing, so that double-path primer operation can be formed in the primer process, simultaneously, the reverse primer flow operation can be formed in the primer process, the reverse primer operation can be carried out, the reverse primer flow operation can be carried out, the rapid operation can be finished, the reverse primer flow can be carried out, the rapid operation can be carried out, the reverse flow, the cost can be improved, the instrument can be used for detecting the primer has a short, and the cost can be more convenient, and the detection instrument can be used for detecting and has a short cost;
according to the application, the processing mechanism is adopted to perform annular heating operation on the resistance heating rod outside the reaction box, and the suction pump is started, so that ice water in the annular bearing cylinder is sucked into the injection stretching hose, enters into the annular split-flow pipe along the injection stretching hose, enters into the upper annular collecting pipe and flows into the plurality of curved baffle pipes, and the cooling ice water enters into the collecting ring pipe and enters into the return pipe and flows back into the annular bearing cylinder to continue to circulate, thus, annular heating operation is realized during heating, annular laminating cooling is realized during annealing cooling, and switching operation of heating and annealing can be completed rapidly, so that external temperature factors during reaction can be mastered more conveniently, better reaction adaptation conditions are ensured, and better reaction effect is achieved;
according to the application, the injection gun is inserted into the injection cover, the clamping position of the injection gun is directly butted in the clamping groove and is pressed downwards to rotate to enter the annular limiting groove to finish clamping, the arc-shaped pressing body drives the sealing gasket to move downwards, the sleeving ring moves downwards along the outer part of the positioning support rod, the detected chicken serum is injected downwards, flows into the reaction box along the arc-shaped pressing body, after injection is finished, the injection gun can be rotated, the clamping is finished at the position above the inner wall of the sealing gasket and the injection cover under the action of the resilience force of the extrusion spring, the clamping injection is conveniently finished when the chicken serum is injected each time, the automatic reset and closing are realized after the injection is finished, the influence of external impurities on the chicken serum is avoided, the bacterial breeding is avoided, the invasion of external bacteria is effectively reduced, the influence of bacteria on detection data and other sundries on detection data are avoided, and the effect of high-precision detection is achieved;
in summary, through the mutual influence of above-mentioned a plurality of effects, conveniently switch in primer in-process, form annular subtend flow simultaneously when the primer, and reverse flow's effect, can accomplish the primer operation fast like this, improve primer efficiency, it is more convenient quick to detect, the consumptive material is with low costs, detection time is shorter, realize annular heating operation, and when annealing cooling, reach annular laminating formula cooling, and can accomplish the switching operation of heating up and annealing fast, external temperature factor when the reaction is mastered more conveniently, guarantee better reaction adaptation condition, can effectively reduce the invasion of outside bacterium, avoid bacterium to influence detection data, and other debris influence detection data, reach the effect of high accuracy detection, in all can effectively improve detection efficiency, and the convenience of detection, whole device is less easily carried simultaneously, can guarantee the quick adaptation requirement of external temperature simultaneously, and avoid the entering of external impurity and bacterium when reacting, realize the effect of marginalized injection.
Drawings
Fig. 1 is a schematic diagram of the overall structure of the present application.
Fig. 2 is a schematic view of the whole bottom perspective structure of the present application.
Fig. 3 is a schematic view of the joint of the butt joint pipe and the blast pipe of the present application.
Fig. 4 is an enlarged schematic view of the structure of fig. 3 a according to the present application.
FIG. 5 is a schematic view of the external structure of the heat insulation sleeve of the present application.
FIG. 6 is a schematic view of the internal structure of the heat insulation sleeve of the present application.
Fig. 7 is a schematic view of the junction between a shunt tube and an arcuate flared guide tube of the present application.
FIG. 8 is a schematic view of a cut-out section of an injection cap according to the present application.
The reference numerals are: 1. a detection cylinder; 2. a control button; 3. embedding a tube; 4. a connecting pipe; 5. a first electrically controlled valve; 6. a second electrically controlled valve; 7. an air inlet pipe; 8. a primer tube; 9. a shunt; 10. arc-shaped outward expansion guide pipe; 11. a reverse flow guide pipe; 12. a header; 13. a pump machine; 14. an injection tube; 15. a first electrically controlled valve tube; 16. a first primer mixing tank; 17. a second electrically controlled valve tube; 18. a second primer mixing tank; 19. an air inlet valve; 20. an air supply pipe; 21. a booster fan; 22. a butt joint pipe; 23. injecting a threaded pipe; 24. a reaction box; 25. a thermal insulation sleeve; 26. collecting the ring pipe; 27. bending the baffle tube; 28. a resistance heating rod; 29. an upper ring manifold; 30. a flow tube; 31. an annular shunt; 32. injecting a stretching hose; 33. sucking a pump; 34. an annular bearing cylinder; 35. a return pipe; 36. a screw cap; 37. an injection cap; 38. a clamping groove; 39. an annular limit groove; 40. an arc-shaped pressing body; 41. a sealing gasket; 42. a sleeve joint ring; 43. positioning the supporting rod; 44. extruding a spring; 45. limiting support blocks; 46. and the pressure relief valve.
Detailed Description
The following description of the embodiments of the present application will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present application, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.
The portable chicken bursa mycoplasma detection device shown in the accompanying drawings 1-8 comprises a detection cylinder 1, wherein an embedded pipe 3 is arranged at the bottom end of the detection cylinder 1, four connecting pipes 4 are distributed on the outer wall of the embedded pipe 3 at equal intervals in a ring shape, and a primer mechanism is arranged at the top end of each connecting pipe 4;
the primer mechanism comprises a first electric control valve 5 arranged at the top end of a connecting pipe 4, a second electric control valve 6 is arranged on the outer wall of the connecting pipe 4, an air inlet pipe 7 is communicated with the upper portion of the second electric control valve 6, a primer pipe 8 is arranged above the first electric control valve 5, a shunt pipe 9 is connected to the top end of the primer pipe 8, a plurality of groups of arc expansion guide pipes 10 are distributed on the outer wall of the shunt pipe 9 from top to bottom in an annular equidistant manner, a plurality of reverse guide pipes 11 are arranged on one side of each arc expansion guide pipe 10 from top to bottom in sequence, and a switching assembly is arranged at the bottom end position of an embedded pipe 3.
In some embodiments, as shown in fig. 4-7, the embedded pipe 3 is connected to the connecting pipe 4, and the upper and lower ends of the primer pipe 8 are respectively connected to the shunt pipe 9 and the first electric control valve 5, so that the solution is input into the first electric control valve 5 along the embedded pipe 3, enters the primer pipe 8 through the first electric control valve 5, is connected between the reverse flow guide pipe 11 and the collecting pipe 12, the cross section of the reverse flow guide pipe 11 is arc-shaped, the opening of the reverse flow guide pipe 11 is opposite to the opening of the arc-shaped expansion guide pipe 10, the reverse flow guide pipe 11 is connected to the air inlet pipe 7 through the collecting pipe 12, enters the collecting pipe 12 through the air inlet pipe 7, and is then split into the plurality of reverse flow guide pipes 11, so that the mixed solution in the reaction tank 24 can be mixed with the reverse primer.
In some embodiments, as shown in fig. 4, the switching assembly includes a pump 13 installed at the bottom end of the embedding tube 3, an injection tube 14 is connected to the input end of the pump 13, a first electric control valve tube 15 is connected to one side of the outer wall of the injection tube 14, a first primer mixing box 16 is installed at one end of the first electric control valve tube 15, a second electric control valve tube 17 is connected to the other side of the outer wall of the injection tube 14, and a second primer mixing box 18 is installed at one end of the second electric control valve tube 17, so that the second electric control valve tube 17 is opened to close the first electric control valve tube 15, the proportioned primer solution inside the second primer mixing box 18 is injected into the injection tube 14, and the second electric control valve tube 17 is closed to open the first electric control valve tube 15, so that the proportioned primer solution can be injected into the injection tube 14.
In some embodiments, as shown in fig. 3-4, an air inlet valve 19 is installed at one end of the injection pipe 14, one end of the air inlet valve 19 is communicated with an air supply pipe 20, a booster fan 21 is installed at one end of the air supply pipe 20, the input end of the booster fan 21 is communicated with a butt joint pipe 22, and injection threaded pipes 23 are installed at opposite sides of the first primer mixing box 16 and the second primer mixing box 18, so that the injection threaded pipes 23 are filled into the first primer mixing box 16, and the booster fan 21 is started to enable the butt joint pipe 22 to suck sterile air into the air supply pipe 20, and the sterile air enters the injection pipe 14 along the reaction box 24.
In some embodiments, as shown in fig. 1-6, a treatment mechanism is sleeved outside the primer tube 8, the treatment mechanism comprises a reaction tank 24 arranged outside the primer tube 8, a heat insulation sleeve 25 is installed outside the reaction tank 24, four bending flow tubes 27 are installed in a gap formed between the reaction tank 24 and the heat insulation sleeve 25, the bottom ends of the bending flow tubes 27 are communicated with a collecting ring pipe 26, the top ends of the bending flow tubes are communicated with an upper ring collecting pipe 29, a resistance heating rod 28 is installed between every two adjacent bending flow tubes 27, the top ends of the upper ring collecting pipe 29 are embedded and communicated with a flow tube 30, the bottom ends of the flow tubes 30 are connected with annular shunt pipes 31, the bottom ends of the annular shunt pipes 31 are communicated with an injection stretching hose 32, a suction pump 33 for injecting cold water is installed at the bottom ends of the injection stretching hose 32, the input ends of the suction pump 33 are communicated with an annular bearing cylinder 34, the upper surface of the annular bearing cylinder 34 is externally connected with a threaded cover 36 at the input ends of the suction pump 33, a control button 2 is installed at a position above one side of the suction pump 33, and the control button 2 is detachably connected with the threaded cover 36 through a plurality of tapping rings 35, and the annular bearing 35 are distributed and are communicated with the outer walls of the annular bearing 35;
so that the resistance heating rod 28 outside the reaction box 24 can be utilized to perform annular heating operation, the temperature is raised in the heat insulation sleeve 25, when the temperature is raised to 98 ℃, the pre-denaturation time is 30s, the cyclic reaction is carried out at 98 ℃, and the denaturation is carried out for 10s;
the screw cap 36 can be rotated to be no longer in threaded connection with the annular bearing cylinder 34, the annular bearing cylinder 34 can be opened to add ice cubes and fill water, the screw cap 36 is rotated to be in threaded butt joint with the annular bearing cylinder 34, then the suction pump 33 is started, thereby sucking the ice water in the annular bearing cylinder 34 into the injection stretching hose 32, entering the annular shunt tube 31 along the injection stretching hose 32, and then being shunted into the flow tube 30, the flow tube 30 enters the upper ring collecting tube 29 and then flows into the plurality of curved baffle tubes 27, the cooling operation on the outside of the reaction tank 24 is completed, then the cooled ice water enters the collecting ring tube 26 and enters the return tube 35, and then flows back into the annular bearing cylinder 34 for continuous circulation.
In some embodiments, as shown in fig. 1-8, four injection covers 37 which are distributed at equal intervals in an annular shape are arranged in the detection cylinder 1, two clamping grooves 38 are formed in the top end of each injection cover 37, annular limiting grooves 39 are formed in the bottom ends of the clamping grooves 38, arc-shaped pressing bodies 40 are arranged in the injection covers 37, sealing gaskets 41 are connected to the upper surfaces of the arc-shaped pressing bodies 40 close to the edge positions, four sleeve rings 42 are arranged on the outer walls of the sealing gaskets 41, positioning support rods 43 are sleeved in the sleeve rings 42, extrusion springs 44 are arranged outside the positioning support rods 43 and below the sleeve rings 42, and limiting support blocks 45 used for supporting the positioning support rods 43 are connected to the bottom ends of the extrusion springs 44;
the sealing gasket 41 is clamped with the upper position of the inner wall of the injection cover 37, the pressure release valve 46 is embedded and installed above the injection cover 37 and at the position of one side of the clamping groove 38, so that the pressure release valve 46 can exhaust pressurized air in the reaction tank 24, an injection gun is inserted into the injection cover 37, the clamping position of the injection gun is directly abutted to the inside of the clamping groove 38, the injection gun can downwards drive the arc-shaped pressing body 40 to downwards move, the sealing gasket 41 drives the sleeve ring 42 to downwards move along the outer part of the positioning support rod 43, the compression spring 44 completes the compression operation on the limiting support block 45, the chicken serum which can be downwards injected and detected flows into the reaction tank 24 along the arc-shaped pressing body 40, the injection gun can be rotated after the injection is finished, and the sleeve ring 42 upwards moves along the positioning support rod 43 to seal and attach under the resilience of the compression spring 44.
The application method of the portable chicken bursa mycoplasma detection device comprises the following specific application steps:
step one, injecting chicken serum, can insert into the injection cover 37 by using the injection gun, the joint position of the injection gun is directly butted in the joint groove 38, thus press down and rotate and enter into the annular limiting groove 39 and finish the joint, can make the injection gun drive the arc-shaped pressing body 40 to move downward, the arc-shaped pressing body 40 drives the sealing pad 41 to move downward, thus the sealing pad 41 drives the sleeve ring 42 to move downward along the outside of the positioning strut 43, the sleeve ring 42 presses the extrusion spring 44 downward, thus the extrusion spring 44 finishes the compression operation on the limiting support 45, the chicken serum detected can be injected downward, flows into the reaction box 24 along the arc-shaped pressing body 40, can rotate the injection gun after injection is finished, and under the rebound force of the extrusion spring 44, the sleeve ring 42 moves upward along the positioning strut 43, thus driving the sealing pad 41 to finish the joint with the upper position of the inner wall of the injection cover 37;
in the second step, when the primer is first round, the first primer mixing box 16 is internally mixed with solution according to the primer sequences of MS-F1CAATGGACGATACAAAGAG and MS-R1TAGGGATACCTTGTTACGAC, the solution is filled into the first primer mixing box 16 through the injection threaded pipe 23, the first electric control valve pipe 15 can be opened to close the second electric control valve pipe 17 and the air inlet valve 19, then the second electric control valve 6 is closed, and then the pump 13 is started, so that the mixed primer solution in the first primer mixing box 16 is injected into the injection pipe 14 and enters the embedded pipe 3 along the injection pipe 14, the embedded pipe 3 is input into the first electric control valve 5, enters the primer pipe 8 through the first electric control valve 5, enters the shunt pipe 9 along the primer pipe 8, and then flows and sprays through the plurality of arc-shaped outward-expansion guide pipes 10 in an annular primer flow way, so that the first round of primer operation is completed, the primer solution and DNA are combined to amplify fragments, in the primer process, the annular heating operation can be performed by utilizing the resistance heating rod 28 outside the reaction box 24, the temperature rise is completed in the heat insulation sleeve 25, when the temperature rises to 98 ℃, the pre-denaturation time is 30s, the cyclic reaction is carried out at 98 ℃, and the denaturation is carried out for 10s;
the screw cap 36 can be rotated to be no longer in threaded connection with the annular bearing cylinder 34, the annular bearing cylinder 34 can be opened to add ice cubes and fill water, the screw cap 36 is rotated to be in threaded butt joint with the annular bearing cylinder 34, then the suction pump 33 is started, the ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular shunt tube 31 along the injection stretching hose 32 and then is shunted into the flow tube 30, the flow tube 30 enters the upper ring collecting tube 29 and then flows into the plurality of curved baffle tubes 27, the cooling operation on the outside of the reaction tank 24 is completed, the cooled ice water enters the collecting ring tube 26 and then enters the return tube 35, and then flows back into the annular bearing cylinder 34 for continuous circulation, so that the temperature can be reduced by 55 ℃, the annealing is stopped for 30s, the cooling is stopped, the heating is continued to 72 ℃, the temperature is extended for 1.5min, 40 circulation is carried out, and the temperature is 72 ℃ and the temperature is extended for 2min after the circulation;
step three, during the second round of primer, the second primer mixing box 18 is internally mixed with solution according to MS-F2GAGAAGCAAAATAGTGATATCA and MS-R2CAGTCGTCTCCGAAGTTAACAA primer sequences, the solution is stored in the second primer mixing box 18, the second electric control valve pipe 17 can be opened to close the first electric control valve pipe 15 and the air inlet valve 19, the second electric control valve 6 is closed, then the pump 13 is started, so that the mixed primer solution in the second primer mixing box 18 is injected into the injection pipe 14, enters the embedding pipe 3 along the injection pipe 14, is input into the first electric control valve 5 through the embedding pipe 3, enters the shunt pipe 9 along the primer pipe 8, and is subjected to annular primer flow injection through the plurality of arc-shaped external expansion guide pipes 10, so that the second round of primer operation is completed, fragments can be amplified only after the second primer solution is combined with DNA, in the primer process, the annular heating operation can be performed by using the resistance heating rod 28 outside the reaction box 24, and the thermal insulation sleeve 25 is completed, when the thermal insulation sleeve 25 is preheated to 98 ℃, the thermal sleeve is preheated to be preheated to 98 ℃, and the thermal sleeve is subjected to denaturation reaction time of 98 s and the thermal denaturation reaction time is carried out for 10s;
starting a suction pump 33, so that ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular split-flow pipe 31 along the injection stretching hose 32, enters the upper ring collecting pipe 29, flows into the plurality of curved baffle pipes 27 again, completes cooling to 49 ℃ outside the reaction tank 24, anneals for 30s, stops cooling, continues to heat to 72 ℃, extends for 1.5min, performs 40 cycles, and extends for 2min at 72 ℃ after the cycle is completed;
and step four, when the circulation flow is mixed, the butt joint pipe 22 can be butt jointed with the air sterilizing box, namely the first electric control valve pipe 15, the second electric control valve pipe 17 and the first electric control valve 5 are closed, and the second electric control valve 6 is opened, so that the booster fan 21 is started to enable the butt joint pipe 22 to suck sterile air into the air supply pipe 20, enter the injection pipe 14 along the reaction box 24 and then flow into the embedded pipe 3, enter the connecting pipe 4 along the embedded pipe 3, flow into the second electric control valve 6, enter the air inlet pipe 7 along the second electric control valve 6, enter the collecting pipe 12 through the air inlet pipe 7 and flow into the plurality of reverse flow guide pipes 11, and then the mixed liquid in the reaction box 24 can be mixed by opposite primers, after the mixed liquid is fully amplified for one hour, the inserting rod arc-shaped pressing body 40 is pressed, the reaction solution in the reaction box 24 is poured into the agarose electrophoresis equipment, and then the agarose electrophoresis equipment is started to check the strip result, so as to judge whether the infection is caused.
The working principle of the application is as follows:
the injection gun can be inserted into the injection cover 37, the injection gun downwards drives the arc-shaped pressing body 40 to downwards move, the arc-shaped pressing body 40 drives the sealing gasket 41 to downwards move, the sealing gasket 41 drives the sleeve ring 42 to downwards move along the outer part of the positioning support rod 43, the compression spring 44 completes the compression operation on the limiting support block 45, so that the detected chicken serum can be downwards injected, flows into the reaction box 24 along the arc-shaped pressing body 40, the injection gun can be rotated after the injection is finished, under the resilience force of the compression spring 44, the sleeve ring 42 upwards moves along the positioning support rod 43, so that the sealing gasket 41 is driven to be clamped with the upper part of the inner wall of the injection cover 37, and when a first primer is used, the solution is proportioned in the first primer mixing box 16 according to the primer sequence of MS-F1CAATGGACGATACAAAGAG and MS-R1TAGGGATACCTTGTTACGAC, and the solution is filled into the first primer mixing box 16 through the injection threaded pipe 23;
the first electric control valve tube 15 is opened, the second electric control valve tube 17 and the air inlet valve 19 are closed, then the pump 13 is started, so that the proportioned primer solution in the first primer mixing box 16 is injected into the injection tube 14, enters the embedded tube 3 along the injection tube 14, is input into the first electric control valve 5 through the embedded tube 3, enters the primer tube 8 through the first electric control valve 5, enters the shunt tube 9 along the primer tube 8, and then carries out annular primer flow injection through the plurality of arc-shaped outward expansion guide tubes 10, thus completing the first round of primer operation, the primer solution and DNA are combined to amplify fragments, in the primer process, the annular heating operation can be carried out by utilizing the resistance heating rod 28 outside the reaction box 24, and the temperature rise is completed in the heat insulation sleeve 25, when the temperature rises to 98 ℃, the pre-denaturation time is 30s, the circulating reaction is carried out at 98 ℃, and the denaturation is carried out for 10s;
the screw cap 36 can be rotated to be no longer in threaded connection with the annular bearing cylinder 34, the annular bearing cylinder 34 can be opened to add ice cubes and fill water, the screw cap 36 is rotated to be in threaded butt joint with the annular bearing cylinder 34, then the suction pump 33 is started, the ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular shunt tube 31 along the injection stretching hose 32 and then is shunted into the flow tube 30, the flow tube 30 enters the upper ring collecting tube 29 and then flows into the plurality of curved baffle tubes 27, the cooling operation on the outside of the reaction tank 24 is completed, the cooled ice water enters the collecting ring tube 26 and then enters the return tube 35, and then flows back into the annular bearing cylinder 34 for continuous circulation, so that the temperature can be reduced by 55 ℃, the annealing is stopped for 30s, the cooling is stopped, the heating is continued to 72 ℃, the temperature is extended for 1.5min, 40 circulation is carried out, and the temperature is 72 ℃ and the temperature is extended for 2min after the circulation; in the second round of primer, the second primer mixing box 18 is internally mixed with solution according to the primer sequences of MS-F2GAGAAGCAAAATAGTGATATCA and MS-R2CAGTCGTCTCCGAAGTTAACAA, and the mixed solution is stored in the second primer mixing box 18, namely, the second electric control valve pipe 17 is opened to close the first electric control valve pipe 15 and the air inlet valve 19, then the second electric control valve 6 is closed, and then the pump 13 is started, so that the mixed primer solution in the second primer mixing box 18 is injected into the injection pipe 14, enters the embedded pipe 3 along the injection pipe 14, and is input into the first electric control valve 5 through the embedded pipe 3;
the primer enters into the shunt tube 9 along the primer tube 8, then the circular primer is sprayed through a plurality of arc-shaped outward-expansion guide tubes 10, so that the second round of primer operation is completed, the second primer solution can be combined with DNA to amplify fragments, in the primer process, the circular heating operation can be performed by using a resistance heating rod 28 outside a reaction box 24, the temperature is raised in a heat insulation sleeve 25, when the temperature is raised to 98 ℃, the pre-denaturation time is 30s, the cyclic reaction is carried out at 98 ℃, and the denaturation is carried out for 10s;
starting a suction pump 33, so that ice water in the annular bearing cylinder 34 is sucked into the injection stretching hose 32, enters the annular split-flow pipe 31 along the injection stretching hose 32, enters the upper ring collecting pipe 29, flows into the plurality of curved baffle pipes 27 again, completes cooling to 49 ℃ outside the reaction tank 24, anneals for 30s, stops cooling, continues to heat to 72 ℃, extends for 1.5min, performs 40 cycles, and extends for 2min at 72 ℃ after the cycle is completed;
closing the first electric control valve pipe 15, the second electric control valve pipe 17 and the first electric control valve 5, opening the second electric control valve 6, enabling the booster fan 21 to enable the butt joint pipe 22 to suck sterile air into the air supply pipe 20, enabling the butt joint pipe to enter the injection pipe 14 along the reaction box 24 and then flow into the embedded pipe 3, enabling the butt joint pipe to enter the connecting pipe 4 along the embedded pipe 3, enabling the butt joint pipe to be shunted into the second electric control valve 6, enabling the butt joint pipe to enter the air inlet pipe 7 along the second electric control valve 6 and enter the collecting pipe 12 through the air inlet pipe 7, enabling a mixed solution in the reaction box 24 to be subjected to primer opposite mixing, enabling the insertion rod to press the arc-shaped pressing body 40 after the butt joint pipe is fully amplified for one hour, enabling the reaction solution in the reaction box 24 to be poured into agarose electrophoresis equipment, and enabling the agarose electrophoresis equipment to check a banding result to judge whether infection exists;
the last points to be described are: first, in the description of the present application, it should be noted that, unless otherwise specified and defined, the terms "mounted," "connected," and "connected" are to be construed broadly, and may be mechanical or electrical, or may be a direct connection between two elements, and "upper," "lower," "left," "right," etc. are merely used to indicate relative positional relationships, which may be changed when the absolute position of the object being described is changed;
secondly: in the drawings of the disclosed embodiments, only the structures related to the embodiments of the present disclosure are referred to, and other structures can refer to the common design, so that the same embodiment and different embodiments of the present disclosure can be combined with each other under the condition of no conflict;
finally: the foregoing is only illustrative of the preferred embodiments of the present application and is not to be construed as limiting the application, but rather as various modifications, equivalent arrangements, improvements, etc., within the spirit and principles of the present application.
Claims (8)
1. The utility model provides a portable chicken synovial sac mycoplasma detection device, includes detection section of thick bamboo (1), its characterized in that: an embedded pipe (3) is arranged at the bottom end of the detection cylinder (1), four connecting pipes (4) are distributed on the outer wall of the embedded pipe (3) at equal intervals in a ring shape, and a primer mechanism is arranged at the top end of each connecting pipe (4);
the primer mechanism comprises a first electric control valve (5) arranged at the top end of a connecting pipe (4), a second electric control valve (6) is arranged on the outer wall of the connecting pipe (4), an air inlet pipe (7) is communicated with the upper portion of the second electric control valve (6), a primer pipe (8) is arranged above the first electric control valve (5), a shunt pipe (9) is connected to the top end of the primer pipe (8), a plurality of groups of arc-shaped outward-expansion guide pipes (10) are distributed on the outer wall of the shunt pipe (9) from top to bottom in an annular equidistant mode, a plurality of reverse flow guide pipes (11) which are sequentially arranged from top to bottom are arranged on one side of the arc-shaped outward-expansion guide pipes (10), a switching assembly is arranged at the bottom end position of the embedded pipe (3), the reverse flow guide pipes (11) are communicated with a collecting pipe (12), the cross section of each reverse flow guide pipe (11) is arranged in an arc shape, and the opening direction of each reverse flow guide pipe (11) is opposite to the opening direction of the arc-shaped outward-expansion guide pipe (10), and the reverse collecting pipe (7) are communicated with each other through the collecting pipe (12).
2. The portable chicken bursa mycoplasma detection device according to claim 1, wherein: the embedded pipe (3) is communicated with the connecting pipe (4), and the upper end and the lower end of the primer pipe (8) are respectively communicated with the shunt pipe (9) and the first electric control valve (5) in pairs.
3. The portable chicken bursa mycoplasma detection device according to claim 1, wherein: the switching assembly comprises a pump (13) arranged at the bottom end of the embedded pipe (3), an injection pipe (14) is connected to the input end of the pump (13), a first electric control valve pipe (15) is connected to one side of the outer wall of the injection pipe (14), a first primer mixing box (16) is arranged at one end of the first electric control valve pipe (15), a second electric control valve pipe (17) is connected to the other side of the outer wall of the injection pipe (14), and a second primer mixing box (18) is arranged at one end of the second electric control valve pipe (17).
4. A portable chicken bursa mycoplasma detection device according to claim 3, wherein: the injection pipe (14) one end is installed air inlet valve (19), air inlet valve (19) one end intercommunication has blast pipe (20), and installs booster fan (21) in blast pipe (20) one end, booster fan (21) input intercommunication has butt joint pipe (22), injection screwed pipe (23) are all installed to first primer mixing box (16) and second primer mixing box (18) opposite one side.
5. The portable chicken bursa mycoplasma detection device according to claim 1, wherein: the primer tube (8) is externally sleeved with a treatment mechanism, the treatment mechanism comprises a reaction box (24) arranged outside the primer tube (8), a heat insulation sleeve (25) is arranged outside the reaction box (24), four bent baffle pipes (27) are arranged in a gap formed between the reaction box (24) and the heat insulation sleeve (25), a collecting ring pipe (26) is communicated with the bottom end of the bent flow pipe (27), an upper ring collecting pipe (29) is communicated with the top end of the bent flow pipe, resistance heating rods (28) are arranged between every two adjacent bent flow pipes (27), a flow pipe (30) is embedded and communicated with the top end of the upper ring collecting pipe (29), an annular shunt pipe (31) is connected to the bottom end of the flow pipe (30), an injection stretching hose (32) is communicated with the bottom end of the annular shunt pipe (31), an intake pump (33) for injecting cold water is arranged at the bottom end of the injection stretching hose (32), an annular bearing cylinder (34) is communicated with the input end of the intake pump (33), and the upper surface of the annular bearing cylinder (34) is connected with an input screw cap (36) located at the outer side of the intake pump (33).
6. The portable chicken bursa mycoplasma detection device according to claim 5, wherein: the screw cap (36) top and be located suction pump machine (33) one side position department and install control button (2), and be connected through a plurality of self-tapping bolts between control button (2) and screw cap (36), annular carrier (34) outside is the annular and distributes has four back flow (35) and back flow (35) bottom and collects ring canal (26) outer wall and be linked together.
7. The portable chicken bursa mycoplasma detection device according to claim 1, wherein: the detection cylinder (1) is internally provided with four injection covers (37) which are distributed at annular equal intervals, two clamping grooves (38) are formed in the top ends of the injection covers (37), annular limiting grooves (39) are formed in the bottom ends of the clamping grooves (38), arc-shaped pressing bodies (40) are arranged in the injection covers (37), sealing gaskets (41) are connected to the upper surfaces of the arc-shaped pressing bodies (40) close to the edge positions, four sleeving rings (42) are arranged on the outer walls of the sealing gaskets (41), positioning struts (43) are sleeved inside the sleeving rings (42), and extrusion springs (44) are arranged outside the positioning struts (43) and located below the sleeving rings (42).
8. The portable chicken bursa mycoplasma detection device of claim 7, wherein: the bottom end of the extrusion spring (44) is connected with a limiting support block (45) which is used for positioning the support rod (43) to support, the sealing gasket (41) is clamped with the upper position of the inner wall of the injection cover (37), and a pressure release valve (46) is embedded and installed above the injection cover (37) and at the position of one side of the clamping groove (38).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210137800.2A CN114480098B (en) | 2022-02-15 | 2022-02-15 | Portable chicken bursa mycoplasma detection device and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210137800.2A CN114480098B (en) | 2022-02-15 | 2022-02-15 | Portable chicken bursa mycoplasma detection device and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114480098A CN114480098A (en) | 2022-05-13 |
| CN114480098B true CN114480098B (en) | 2023-10-03 |
Family
ID=81481383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210137800.2A Active CN114480098B (en) | 2022-02-15 | 2022-02-15 | Portable chicken bursa mycoplasma detection device and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114480098B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970476B (en) * | 2023-07-25 | 2024-03-12 | 山东省动物疫病预防与控制中心(山东省人畜共患病流调监测中心) | Detection device and detection method for mycoplasma synoviae of chickens |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0630776A (en) * | 1992-07-13 | 1994-02-08 | Rikagaku Kenkyusho | Method for amplifying dna and device for amplifying dna |
| CN104998570A (en) * | 2015-06-30 | 2015-10-28 | 刘宇 | Medicine mixing device |
| CN108467105A (en) * | 2018-04-12 | 2018-08-31 | 南宁绿智环保科技有限公司 | A kind of denitrification aerobic granular sludge continuous flow reactor and its working method |
| CN108866162A (en) * | 2018-07-03 | 2018-11-23 | 芜湖启邦电力技术服务有限公司 | A kind of nucleic acid amplifier of agility temperature control |
| CN208562387U (en) * | 2018-04-24 | 2019-03-01 | 洛阳现代生物技术研究院有限公司 | A device for detecting poultry pathogens |
| CN110331090A (en) * | 2019-07-12 | 2019-10-15 | 湖南圣湘生物科技有限公司 | Nucleic acid extraction, amplification and detection device |
| CN110862907A (en) * | 2019-12-06 | 2020-03-06 | 中国科学院长春光学精密机械与物理研究所 | Nucleic acid extraction preliminary treatment amplification system |
| CN111690758A (en) * | 2020-07-31 | 2020-09-22 | 江苏立华牧业股份有限公司 | Nested PCR (polymerase chain reaction) primer, detection method and kit for detecting mycoplasma synoviae |
| CN111826273A (en) * | 2020-07-22 | 2020-10-27 | 赵毅 | Automatic totally-enclosed micro-fluidic chip for nucleic acid detection |
| CN215250802U (en) * | 2021-05-10 | 2021-12-21 | 上海蓝析生物技术有限公司 | Quick check out test set of mycoplasma |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6558901B1 (en) * | 1997-05-02 | 2003-05-06 | Biomerieux Vitek | Nucleic acid assays |
| US20130045496A1 (en) * | 2010-02-12 | 2013-02-21 | Gijsbert Johan Jansen | Automatic Fluid Sample Preparation Module, Automatic Analysis System and Method for Use Thereof |
| CN113817592B (en) * | 2020-06-19 | 2025-12-09 | 安徽为臻生物工程技术有限公司 | Anti-pollution detection device, method and application for rapid detection of nucleic acid amplification product |
-
2022
- 2022-02-15 CN CN202210137800.2A patent/CN114480098B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0630776A (en) * | 1992-07-13 | 1994-02-08 | Rikagaku Kenkyusho | Method for amplifying dna and device for amplifying dna |
| CN104998570A (en) * | 2015-06-30 | 2015-10-28 | 刘宇 | Medicine mixing device |
| CN108467105A (en) * | 2018-04-12 | 2018-08-31 | 南宁绿智环保科技有限公司 | A kind of denitrification aerobic granular sludge continuous flow reactor and its working method |
| CN208562387U (en) * | 2018-04-24 | 2019-03-01 | 洛阳现代生物技术研究院有限公司 | A device for detecting poultry pathogens |
| CN108866162A (en) * | 2018-07-03 | 2018-11-23 | 芜湖启邦电力技术服务有限公司 | A kind of nucleic acid amplifier of agility temperature control |
| CN110331090A (en) * | 2019-07-12 | 2019-10-15 | 湖南圣湘生物科技有限公司 | Nucleic acid extraction, amplification and detection device |
| CN110862907A (en) * | 2019-12-06 | 2020-03-06 | 中国科学院长春光学精密机械与物理研究所 | Nucleic acid extraction preliminary treatment amplification system |
| CN111826273A (en) * | 2020-07-22 | 2020-10-27 | 赵毅 | Automatic totally-enclosed micro-fluidic chip for nucleic acid detection |
| CN111690758A (en) * | 2020-07-31 | 2020-09-22 | 江苏立华牧业股份有限公司 | Nested PCR (polymerase chain reaction) primer, detection method and kit for detecting mycoplasma synoviae |
| CN215250802U (en) * | 2021-05-10 | 2021-12-21 | 上海蓝析生物技术有限公司 | Quick check out test set of mycoplasma |
Non-Patent Citations (3)
| Title |
|---|
| All-in-one microfluidic device for on-site diagnosis of pathogens based on integrated continuous flow PCR and electrophoresis biochip;Zhenqing Li等;LAB ON A CHIP;第19卷(第16期);2663-2668 * |
| Rapid and sensitive detection of Mycoplasma synoviae by an insulated isothermal polymerase chain reaction-based assay on a field-deployable device;Hung-Chih Kuo等;Poultry Science;第96卷(第1期);35–41 * |
| 应用PCR法检测生物制品中支原体污染;英聪;中国优秀硕士学位论文全文数据库农业科技辑(第02期);D050-211 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114480098A (en) | 2022-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109732660B (en) | Ground source heat pump tube cutting method | |
| CN114480098A (en) | Portable chicken bursal mycoplasma detection device and method thereof | |
| CN205601148U (en) | Flaring of PVC tubular product and throat all -in -one | |
| CN207954627U (en) | A kind of balloon tube reducing stretching device | |
| CN204395107U (en) | A kind of intelligent gastric lavage device | |
| CN212320086U (en) | Constant-temperature heating system of water tester | |
| CN215320737U (en) | Siphon heat seal composite mechanism applied to cryoprecipitated blood coagulation factor preparation instrument | |
| CN210004362U (en) | high-temperature furnace convenient for sterilizing inoculation tools | |
| CN210168733U (en) | Large-scale laying duck cage culture device | |
| CN217651227U (en) | Fluorescent quantitative PCR instrument | |
| CN102345776B (en) | Easy connector of air-conditioning ventilation duct | |
| CN220499685U (en) | Polymer material vulcanization constant temperature control device | |
| CN223840796U (en) | A rapid drying equipment for tofu skin | |
| CN204739775U (en) | Spiral sulfur trioxide electric heater | |
| CN220201882U (en) | Cell factory operation pipeline equipment | |
| CN224069631U (en) | A steam device that stretches out for fu brick tea processing | |
| CN216977193U (en) | Ultraviolet disinfection heat pump | |
| CN220566846U (en) | PE pipe connection structure | |
| CN219713462U (en) | Heating device with high automation degree | |
| CN206241023U (en) | balloon forming machine | |
| CN215499630U (en) | Novel gas cylinder heating device | |
| CN209801705U (en) | Heat supply and ventilation device for building construction | |
| CN215765807U (en) | Utilize hot air device of solar energy | |
| CN209534144U (en) | A kind of flanging machine for plastic tube | |
| CN221366487U (en) | Automobile heating and warm air device for pure electric automobile |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |