CN114470178A - Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof - Google Patents

Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof Download PDF

Info

Publication number
CN114470178A
CN114470178A CN202210103514.4A CN202210103514A CN114470178A CN 114470178 A CN114470178 A CN 114470178A CN 202210103514 A CN202210103514 A CN 202210103514A CN 114470178 A CN114470178 A CN 114470178A
Authority
CN
China
Prior art keywords
protein
protein kinase
cells
cell
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210103514.4A
Other languages
Chinese (zh)
Inventor
王连生
范燚
王昊
郭雪江
陈秉瑞
韦天文
李亚飞
王子牧
程毅伟
沙家豪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN202210103514.4A priority Critical patent/CN114470178A/en
Publication of CN114470178A publication Critical patent/CN114470178A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/45—Transferases (2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A61K9/0024—Solid, semi-solid or solidifying implants, which are implanted or injected in body tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/06—Antiarrhythmics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01037—Protein kinase (2.7.1.37)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore

Abstract

The invention discloses a recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and a preparation method and application thereof, belonging to the technical field of biomedicine. The recombinant human CHK1 protein kinase comprises a CHK1 protein kinase sequence and a cell-penetrating peptide sequence, and can influence the processes of DNA synthesis, cell cycle, mitosis and the like of cardiac muscle cells by activating a key pathway of cardiac muscle regeneration after injection administration, promote the regeneration and repair of cardiac muscle after acute myocardial infarction, reduce the area and fibrosis of the cardiac muscle infarction and improve the recovery of cardiac function. Meanwhile, a three-dimensional network structure formed by the liquid state solidification of the small molecular hydrogel can provide mechanical supporting force for the ventricles and delay the ventricular reconstruction; the porous structure of the small molecular hydrogel is convenient for the growth of regenerative myocardial cells so as to promote myocardial repair.

Description

Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof
Technical Field
The invention relates to the technical field of biomedicine, in particular to a recombinant human CHK1 protein kinase product taking hydrogel as a carrier and application thereof.
Background
With the continuous development of clinical medical technology, the death rate of patients with acute myocardial infarction is reduced, but the patients still have serious diseases threatening human life. After the acute myocardial infarction occurs, the coronary artery related to the infarction is opened as early as possible, fully and continuously, the myocardial dying due to ischemia is saved, and the heart function is protected, so that the main strategy for treating the acute myocardial infarction is provided at present. However, no matter the current reperfusion means after myocardial infarction such as drug thrombolysis, percutaneous coronary intervention or coronary bypass transplantation, the blood supply of the myocardium can be improved, but the number of myocardial cells cannot be increased or the necrotic myocardium can not be regenerated, the damaged area is still repaired by fibrous scars after the myocardial infarction occurs, the myocardial contractility is inevitably reduced, and the cardiac remodeling, the cardiac dysfunction and the end-of-life event of the heart failure are caused in the long-term prognosis of the disease. Realizing effective regeneration of myocardial cells and reducing scar formation has important significance for reversing or delaying the progress of diseases after myocardial infarction, which is also one of the great problems in the current cardiovascular field.
Researchers have long thought that cardiomyocyte depletion resulting from myocardial injury is an irreversible process as cardiomyocytes enter terminal differentiation and exit the cell cycle after birth. In recent years, more and more researches show that the cardiomyocytes in the adult heart still maintain extremely weak self-proliferation renewal capacity, which brings hope for researching treatment for promoting the self-proliferation of residual cardiomyocytes in the infarct border area to reduce the infarct area and improve the cardiac function after myocardial injury after the adult myocardial infarction, and the promotion of the endogenous cardiomyocyte proliferation is proved to be a promising method for promoting myocardial regeneration.
CHK1 belongs to the group of phosphorylated protein kinases, is localized to the cytoplasm and nucleus, is highly conserved in mammals, and was originally found as a checkpoint in cell development; when cells develop DNA damage, the DNA damage response protein PIKKs (ATM or ATR) rapidly phosphorylates and activates the corresponding substrates, including CHK1, CHK2, initiating the DNA damage response. In early mammalian embryo, CHK1 gene deletion can cause severe defect of embryonic stem cell (ES) proliferation and even death, thereby causing embryo death in the implantation stage of mouse embryo.
By searching domestic and foreign documents, no document report that CHK1 protein kinase can promote the proliferation of myocardial cells or improve the recovery of cardiac function is found.
Disclosure of Invention
Aiming at the current treatment situation of myocardial repair after acute myocardial infarction, the invention aims to provide the recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and the preparation method and the application thereof.
The inventor is dedicated to developing a medicament for promoting myocardial regeneration for a long time, and surprisingly, the study of the inventor discovers and verifies that the activity of CHK1 kinase in the new myocardium is increased for the first time, the CHK1 kinase can influence the cell cycle through a mTORC1/P70S6K signal channel, the process of DNA synthesis, mitosis and the like is accelerated, the proliferation of myocardial cells is promoted, the regeneration and repair of the myocardium after acute myocardial infarction is promoted, the area of myocardial infarction is reduced, and the recovery of cardiac function is improved.
Based on the above, after the inventor modifies the CHK1 protein kinase, firstly, a fusion protein of the CHK1 protein kinase and a cell-penetrating peptide is provided, the fusion protein comprises a CHK1 protein kinase sequence and a cell-penetrating peptide sequence, and the CHK1 protein kinase sequence and the cell-penetrating peptide sequence are connected through a connecting peptide.
Further preferably, the cell-penetrating peptide-CHK 1 protein kinase fusion protein is described as above, wherein the amino acid sequence of CHK1 protein kinase is shown as SEQ ID NO: 1 is shown.
Further preferably, the cell-penetrating peptide-CHK 1 protein kinase fusion protein is as described above, wherein the cell-penetrating peptide is selected from any one of the following: TAT, MPG Δ NLS, Stearyl-R8, Transportan, Pep-1.
Further preferably, the cell-penetrating peptide-CHK 1 protein kinase fusion protein has an amino acid sequence shown in SEQ ID NO: 2, and the nucleotide sequence is shown as SEQ ID NO: 3, respectively.
In order to make the locally injected recombinant human CHK1 protein kinase more efficiently, accurately and continuously act in the area around the acute myocardial infarction, the inventor utilizes a biological tissue engineering material to solve the problem, namely provides a recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration.
The injectable hydrogel is prepared by uniformly mixing the fusion protein and a gel-forming precursor molecule in a water phase, wherein the gel-forming precursor molecule is dFEFKdFEFKYRGD and has the molecular weight of 1612. The CHK1 fusion protein and the gel-forming precursor molecule prepolymer solution are mixed through a certain formula and then injected into the edge of acute myocardial infarction, and the gel-forming precursor molecule generates liquid-solid phase transition at body temperature, so that the CHK1 fusion protein is wrapped in the hydrogel and slowly released along with the degradation of the hydrogel.
Further preferably, the injectable hydrogel as described above, wherein the mass ratio of the fusion protein to the gel-forming precursor molecule is 1: (1.9-2.1).
The invention also provides a preparation method of the injectable hydrogel of the CHK1 protein kinase-cell-penetrating peptide fusion protein, which comprises the following steps:
(1) weighing the gel-forming precursor molecule powder, fully dissolving the gel-forming precursor molecule powder by using double distilled water at room temperature, filtering and sterilizing, adjusting the pH to 7.3-7.5 by using sterile sodium bicarbonate, and obtaining a solution A for later use according to the constant volume of the gel-forming precursor molecule with the concentration of 18-22 mg/mL;
(2) taking a solution containing the fusion protein, adding sterile PBS (phosphate buffer solution) to enable the concentration of the protein solution to be 9-11mg/mL, and obtaining a solution B for later use;
(3) and (3) mixing the solution A obtained in the step (1) with the solution B obtained in the step (2) at room temperature, and slowly blowing, beating and uniformly mixing to obtain the injectable hydrogel.
The third aspect of the invention provides an application of the CHK1 protein kinase-cell penetrating peptide fusion protein in preparing a medicament for treating cardiomyopathy. The cardiomyopathy is selected from one or more of acute myocardial infarction, myocardial ischemia injury, old myocardial infarction, coronary atherosclerosis, ventricular remodeling after myocardial infarction, and arrhythmia caused by myocardial ischemia or infarction. The medicament is administered by intracoronary injection or direct myocardial injection.
Compared with the prior art, the hydrogel of the recombinant human CHK1 protein kinase has the following advantages and progresses:
(1) the invention takes the micromolecule hydrogel as a carrier to carry the recombinant human CHK1 protein kinase, the micromolecule hydrogel injected into the local part of the heart in a liquid form can be fully attached to the myocardial infarction wound surface after being injected to the acute myocardial infarction edge by an injector, the gel liquid-solid phase transformation occurs at the body temperature, and CHK1 can be wrapped in the micromolecule hydrogel to form protection and support. In the local part of the cardiac muscle, CHK1 can be slowly released along with the degradation of the small molecular hydrogel to play a role, promote the regeneration and repair of the cardiac muscle, reduce the infarct size, inhibit the cardiac remodeling and improve the cardiac function.
(2) The injected small molecular hydrogel can provide mechanical support force for ventricles, delay ventricular remodeling and prevent ventricular cavity expansion, and meanwhile, the solidified hydrogel is in a porous state, can provide support and space for regenerated cardiac muscle cells, is convenient for the growth of the regenerated cardiac muscle cells to promote cardiac muscle repair, and is an ideal treatment mode for acute myocardial infarction and other cardiac muscle diseases.
(3) Experiments show that after the recombinant human CHK1 protein kinase hydrogel is injected into local myocardium of an acute myocardial infarction mouse, CHK1 can be slowly released along with degradation of small molecular hydrogel to play a role, so that myocardial regeneration is promoted, ventricular remodeling is inhibited, the infarction area is reduced, and the cardiac function is remarkably improved.
(4) The invention only needs injection operation, is convenient and easy to operate, and can avoid high risks of treatment such as extracorporeal circulation, allogenic heart transplantation and the like. In addition, the invention has simple operation and feasible implementation conditions, provides a new myocardial tissue engineering product, and provides a new strategy for the biological treatment of acute myocardial infarction.
Drawings
FIG. 1 shows the constructed pFastBacHTA-CHEK1 insect cell vector and the restriction enzyme site;
FIG. 2 is the electrophoretic validation of the prepared high concentration recombinant human CHK1 protein kinase;
FIG. 3 shows the expression of myocardial CHK1 7 days after local injection of recombinant human CHK1 protein kinase hydrogel into mouse myocardium;
FIG. 4 shows that the recombinant human CHK1 protein kinase hydrogel can significantly promote the recovery of the cardiac function of mice after MI;
fig. 5 shows that the application of the recombinant human CHK1 protein kinase hydrogel can significantly reduce the infarct size (a.ttc) and the degree of fibrosis (b.massson staining) after MI in mice;
FIG. 6 shows that the recombinant human CHK1 protein kinase hydrogel can promote the proliferation of mouse post-MI myocardial cells, including DNA synthesis (A, EDU +), cell cycle activity (B, Ki67+), mitosis (C, PH3+), and cytokinesis (D, Aurora B +).
Detailed Description
The technical solution and the technical effect of the present invention will be further described in detail by the following specific embodiments and the accompanying drawings. It will be understood by those skilled in the art that the following examples are illustrative of the present invention only and should not be taken as limiting the scope of the invention. In addition, the specific technical operation steps or conditions not indicated in the examples are performed according to the general techniques or conditions described in the literature in the field or according to the product specification. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
EXAMPLE 1 preparation of biologically active recombinant human CHK1 protein kinase
TAT-CHEK1 (nucleotide sequence) is shown in SEQ NO. 3.
2. Construction of pFastBacHTA-CHEK1 insect cell vector
Bac-to-bachtvector kit was designed to express and purify recombinant proteins with histidine tags in Sf9, Sf21, or HighFive cells after production of baculovirus vectors in e. The pfastbach vector has the following characteristics: (1) a polyhedrin strong promoter for expression of proteins; (2) three reading frames for simplified cloning; (3) an N-terminal 6xHis tag for easy purification of the recombinant fusion protein; (4) for removal of histidine-tagged TEV protease cleavage sites after protein purification.
Construction Process of recombinant vector
(1) Plasmid design:
pUCori, F1ori terminator SV40poly (A) signal; the restriction enzyme site is 5 'BamHI, 3' HindIII; TAT-CHEK1 primer sequence:
F：CTGTATTTTCAGGGCGCCATGGATCCCATGGACTACAAGGACGACG
R：CCTCTAGTACTTCTCGACAAGCTTTTACTTGTACAGCTCGTCC
(2) TAT-CHEK1 fragment is PCR amplified and identified and purified
The PrimeSTAR HS DNA Polymerase kit was used, and the system conditions were as follows:
the primers were diluted to a concentration of 10nmol/ul each and added to the reaction system. (primer dilution to Standard concentration)
PCR50ul reaction system (performed on ice):
Figure BDA0003493089180000051
and (3) PCR reaction conditions:
Figure BDA0003493089180000052
purifying the PCR product
A purification step:
binding buffer, centrifugation at 12000rpm for 1min
Washing buffer12000rpm, Washing twice in 1min
Eluting with 20-50ul water
(3) Ligating the vector with TAT-CHKE1, and recombining
Figure BDA0003493089180000053
The MultiS One Step Cloning Kit was used for recombination (accession number: C113):
the optimum amount of each fragment was [ 0.02X log of base of fragment ] ng
For example, when inserts of 0.5kb, 1kb and 2kb in length are cloned into a cloning vector of 5kb in length, the vector
The optimal use amount of each fragment is as follows:
the optimal using amount of the linearized cloning vector is as follows: 0.02 × 5000 ═ 100 ng;
optimum amount of 0.5kb insert: 0.02 × 500-10 ng;
the optimum amount of the 1kb insert used: 0.02 × 1000 ═ 20 ng;
optimum amount of 2kb insert used: 0.02 × 2000-40 ng;
A. the amount of linearized cloning vector used should be between 50ng and 200 ng. When the optimum amount of DNA to be used is calculated to be out of this range using the above formula, the lowest/highest amount to be used may be selected as it is.
B. Each insert should be used in an amount greater than 10 ng. When the optimum amount of use is calculated to be less than this value using the above formula, 10ng may be used as it is.
C. When the linearized cloning vector and the amplified product of the insert were used without DNA purification, 1/5, i.e.4. mu.l, were added in a total volume not exceeding the volume of the reaction system.
And (3) recombination reaction:
the following reaction system was set up on ice:
Figure BDA0003493089180000061
in order to ensure the accuracy of sample addition, the linearized vector and the insert can be diluted appropriately before the recombinant reaction system is configured, and the sample addition amount of the components can not be less than 1ul
(4) Identification of recombinant products
PCR identification
Sequencing identification
The constructed vector information and the restriction enzyme sites are shown in FIG. 1.
Transformation of DH10Bac competent cells
(1) And (3) placing the competent cells in an ice bath, and if the competent cells need to be subpackaged, subpackaging the just-melted cell suspension into a centrifugal tube with aseptic precooling, and placing the centrifugal tube in the ice bath. (the recommended amount of the competent cells for one transformation is 50-100. mu.l, which can be divided according to the actual situation. it should be noted that the volume of DNA used should not exceed one tenth of the volume of the competent cell suspension.) the following experiment is exemplified by 100ul of competent cells.
(2) To the competent cell suspension, 1-10ng of pFastBacHTA-CHEK1 recombinant plasmid was added, the tube was gently swirled to mix the contents, and the mixture was left to stand in an ice bath for 30 minutes.
(3) The centrifuge tube was placed in a 42 ℃ water bath for 30 seconds and then the tube was quickly transferred to an ice bath to allow the cells to cool for 2 minutes without shaking the centrifuge tube.
(4) 900ul of sterile SOC (no antibiotics) was added to each tube, mixed well and incubated at 37 ℃ for 4 hours with shaking on a shaker at 200 rpm.
(5) 10-fold gradient dilution, e.g. by dividing, with SOC mediumIn 3 dilution gradients 10-1，10-2，10-3。
(6) 100ul of each gradient of culture was taken for plating. After the liquid in the plate was completely absorbed, the plate was inverted and incubated at 37 ℃ for 24 to 48 hours.
(7) The remaining bacterial liquid was kept in a 4 ℃ refrigerator, depending on the growth of the colonies on the plate.
(8) Selecting 4 large (>1mm) white colonies with good isolation, plating again, scribing, and growing for at least 16 hours;
(9) culturing overnight;
(10) the colonies that successfully recombined (white) were selected for PCR to verify recombination.
(11) The verification primer is as follows: M13-F: CCCAGTCACGACGTTGTAAAACG
M13-R：AGCGGATAACAATTTCACACAGG
The fragment identified by PCR was 2.3kb + the insert length, and if identified, indicated successful transformation and successful virion ligation to the plasmid.
Extraction of Bacmids
The midprep of the positive clone (Qiagen kit, cat # 12243) was used, and eluted with sterile water (recombinant bacmid was too large for a conventional miniprep column). And (4) subpackaging the pure bacmid, and freezing to-80C. The recombinant AcMNPV virus can be rapidly and efficiently produced. Taking the English prefix and the suffix of baculovirus (baculovirus) and plasmid (plasmid) to be named Bacmid, namely baculovirus plasmid. The vector can grow in Escherichia coli like plasmid, and has infection to lepidopteran insect cells.
Transfection of Sf9 cells with bacmids
(1) Bacmids were transfected into Sf9 cells using the CELLFECTIN kit (gibco, cat # 10362100).
(2) The virus titer after transfection should be 2-4X 107pfu/ml. Two more transfections were performed and the virus titer would exceed 109pfu/ml. Protein expression was examined using cells three times after transfection of the virus (2.5-3X 10)6Individual cells, 25ml culture medium, 15cm dish).
6. Extraction of proteins
(1) Adding 125 ml of sf9 cell culture medium into a conical glass bottle, and adding 50-100 mu l of virus titer 109pfu/ml of sf9 cells (after three to four transfections) were cultured in sf9 incubator for three days.
(2) Adding lysis solution to fully lyse.
7. Purification of proteins
(1) The Ni-NTA slurry was placed in the resin and washed.
(2) The lysate-Ni-NTA mixture was loaded stepwise into a 5ml plastic column until all the mixture was loaded. At this time, if the protein is labeled with EGFP, the resin (blue in primary color) turns to light green due to the binding of the EGFP-labeled protein to the resin.
(3) The resin was washed with 2 × 8ml buffer. If the resin binding of the egfp-tagged protein is good, the washed resin remains pale green.
(4) Protein was eluted by adding 0.75ml elution buffer to the resin, labeled (E1). At this time, if the elution is good, the color of the resin changes back to blue.
(5) 4X 0.75ml of elution buffer was added further and E2, E3, E4, E5 were collected. 20. mu.l each of E1-E5 was used for protein detection by the Biorad method. If the protein content is good, the detection result will quickly turn blue.
(6) E1-E5 were pooled together and passed through a gel exclusion spin filter for a total of about 3.75 ml (0.75 ml. times.5) with a spin of 20 minutes until about 200. mu.l of volume had decreased. At this point, the concentrated eluate was green, indicating that the protein gradually became granular. Mixing with a pipette each time to avoid protein precipitation. Then 2ml buffer was added and the next round of operation was started, again dropping to 200ul and repeating two more rounds. Finally, the total dilution of the original buffer was about 18 × 10 × 10 × 10 ═ 1.8 × 104. The supernatant was then carefully transferred to another tube without agitating the denatured protein particles, with the indicated 10 minutes of rotation of the exchanged eluent. The OD600 values of the protein concentration were measured, rapidly frozen in liquid nitrogen and stored at-80 ℃.
8. Validation of proteins
(1) Running glue for examination and silver staining after protein extraction;
(2) WB running flag, recombinant human CHK1 and the like were verified against the counterstaining results to verify the protein purity (see FIG. 2).
Example 2 preparation of hydrogel of recombinant human CHK1 protein kinase
(1) 20mg of gel-forming precursor molecule powder was weighed and dissolved thoroughly in 800. mu.L of double distilled water at room temperature. The dissolved solution was sterilized by filtration through a 0.22 μm filter, the pH was adjusted to 7.4 with sterile sodium bicarbonate powder, and the total volume of the dissolved solution was made up to 1000ul (hereinafter referred to as solution A).
(2) Dissolving the prepared recombinant human CHK1 protein kinase solution with known concentration on ice at-80 deg.C, collecting the solution containing 10mg protein kinase, and supplementing the total volume of the protein solution to 1000ul with sterile PBS (hereinafter referred to as solution B)
(3) Mixing the solution A and the solution B at room temperature, and slowly blowing and mixing by a pipette to obtain a small molecular hydrogel-recombinant human CHK1 protein kinase mixture which needs to be used immediately.
Example 3 application of recombinant human CHK1 protein kinase hydrogel in promotion of myocardial regeneration and repair
1. Preparation and administration of mouse acute myocardial infarction model
50 male mice (P56) aged 8 weeks were anesthetized with 1.2070Avertin intraperitoneal injection (/ kg), and were manually ventilated with a small animal ventilator after tracheal intubation. The skin is cut off along the fourth intercostal space on the left side by adopting an ophthalmological scissors, the ophthalmological forceps are used for separating intercostal muscles in a blunt manner and then enter the thoracic cavity, the left auricle is exposed, the needle is inserted from the lowest edge of the left auricle by adopting 6-0, the cardiac muscle on the front wall of the ventricle becomes pale, the needle is taken out from the junction of the pulmonary artery cone and the left auricle, and the left prompting ligation is observed by ligating an LAD suture line to be correct. An operator lifts two ends of the ligature to fix the heart position, holds the insulin needle by an assistant, and selects the upper part, the left side and the right side of the edge of the paleness-like area of the myocardium on the anterior wall of the left ventricle to carry out intramyocardial injection of 30-50uL of hydrogel premix. Grouping experiments: CHK1 gel group (n-25), recombinant human CHK1 protein kinase hydrogel (prepared in example 2) was injected. In the control group (n-25), hydrogel containing no recombinant human CHK1 protein kinase was injected alone. The injected hydrogel was pre-stained with trypan blue. Then, the intercostal muscles and skin incisions were sutured layer by layer using 6-0 sutures. After the surgery was closed, the mice were placed on a thermostatic table and allowed to wake up. The myocardial infarction injury model is successfully constructed on the 4 th day after myocardial infarction by ultrasonic detection of the heart.
The recombinant human CHK1 protein kinase hydrogel is injected into the myocardial infarction edge, and gel liquid-solid phase transformation occurs at body temperature, so that CHK1 is wrapped in the small molecule hydrogel and slowly released along with degradation of the hydrogel.
2. Application evaluation of recombinant human CHK1 protein kinase hydrogel in acute myocardial infarction regeneration repair
The CHK1 gel group survived 20 and the gel group alone survived 15 days after surgery. By applying cardiac hyperaccumulation to cardiac infarction mice, the EF value and the FS value of the mice in the CHK1 gel group are obviously improved compared with those in the pure gel control group, which shows that the CHK1 hydrogel can obviously promote the recovery of the cardiac function of the mice after MI (see figure 4).
Mice were sacrificed and fresh heart tissue was subjected to TTC staining and massson staining to find that CHK1 gel mice had significantly reduced myocardial infarct size and degree of fibrosis compared to the gel-only mice (see fig. 5).
The paraffin section or the frozen section is prepared from fresh myocardial infarction marginal area tissues, and EDU, Ki67, PH3 and Aurora B staining is respectively carried out, so that DNA synthesis, cell cycle activity, mitosis and cytokinesis of myocardial cells in the infarction marginal area of the CHK1 gel group mice are remarkably increased, and the recombinant human CHK1 protein kinase hydrogel can promote proliferation of the myocardial cells of the mice after MI (see figure 6).
The results show that the recombinant human CHK1 protein kinase hydrogel can promote myocardial regeneration and repair, reduce infarct size, inhibit cardiac remodeling and improve cardiac function. The embodiment shows that the recombinant human CHK1 protein kinase hydrogel can be used as a new strategy for the regeneration, repair and treatment of the myocardium after acute myocardial infarction.
Sequence listing
<110> Wanglian Sheng
<120> recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 476
<212> PRT
<213> human (human)
<400> 1
Met Ala Val Pro Phe Val Glu Asp Trp Asp Leu Val Gln Thr Leu Gly
1 5 10 15
Glu Gly Ala Tyr Gly Glu Val Gln Leu Ala Val Asn Arg Val Thr Glu
20 25 30
Glu Ala Val Ala Val Lys Ile Val Asp Met Lys Arg Ala Val Asp Cys
35 40 45
Pro Glu Asn Ile Lys Lys Glu Ile Cys Ile Asn Lys Met Leu Asn His
50 55 60
Glu Asn Val Val Lys Phe Tyr Gly His Arg Arg Glu Gly Asn Ile Gln
65 70 75 80
Tyr Leu Phe Leu Glu Tyr Cys Ser Gly Gly Glu Leu Phe Asp Arg Ile
85 90 95
Glu Pro Asp Ile Gly Met Pro Glu Pro Asp Ala Gln Arg Phe Phe His
100 105 110
Gln Leu Met Ala Gly Val Val Tyr Leu His Gly Ile Gly Ile Thr His
115 120 125
Arg Asp Ile Lys Pro Glu Asn Leu Leu Leu Asp Glu Arg Asp Asn Leu
130 135 140
Lys Ile Ser Asp Phe Gly Leu Ala Thr Val Phe Arg Tyr Asn Asn Arg
145 150 155 160
Glu Arg Leu Leu Asn Lys Met Cys Gly Thr Leu Pro Tyr Val Ala Pro
165 170 175
Glu Leu Leu Lys Arg Arg Glu Phe His Ala Glu Pro Val Asp Val Trp
180 185 190
Ser Cys Gly Ile Val Leu Thr Ala Met Leu Ala Gly Glu Leu Pro Trp
195 200 205
Asp Gln Pro Ser Asp Ser Cys Gln Glu Tyr Ser Asp Trp Lys Glu Lys
210 215 220
Lys Thr Tyr Leu Asn Pro Trp Lys Lys Ile Asp Ser Ala Pro Leu Ala
225 230 235 240
Leu Leu His Lys Ile Leu Val Glu Asn Pro Ser Ala Arg Ile Thr Ile
245 250 255
Pro Asp Ile Lys Lys Asp Arg Trp Tyr Asn Lys Pro Leu Lys Lys Gly
260 265 270
Ala Lys Arg Pro Arg Val Thr Ser Gly Gly Val Ser Glu Ser Pro Ser
275 280 285
Gly Phe Ser Lys His Ile Gln Ser Asn Leu Asp Phe Ser Pro Val Asn
290 295 300
Ser Ala Ser Ser Glu Glu Asn Val Lys Tyr Ser Ser Ser Gln Pro Glu
305 310 315 320
Pro Arg Thr Gly Leu Ser Leu Trp Asp Thr Ser Pro Ser Tyr Ile Asp
325 330 335
Lys Leu Val Gln Gly Ile Ser Phe Ser Gln Pro Thr Cys Pro Asp His
340 345 350
Met Leu Leu Asn Ser Gln Leu Leu Gly Thr Pro Gly Ser Ser Gln Asn
355 360 365
Pro Trp Gln Arg Leu Val Lys Arg Met Thr Arg Phe Phe Thr Lys Leu
370 375 380
Asp Ala Asp Lys Ser Tyr Gln Cys Leu Lys Glu Thr Cys Glu Lys Leu
385 390 395 400
Gly Tyr Gln Trp Lys Lys Ser Cys Met Asn Gln Val Thr Ile Ser Thr
405 410 415
Thr Asp Arg Arg Asn Asn Lys Leu Ile Phe Lys Val Asn Leu Leu Glu
420 425 430
Met Asp Asp Lys Ile Leu Val Asp Phe Arg Leu Ser Lys Gly Asp Gly
435 440 445
Leu Glu Phe Lys Arg His Phe Leu Lys Ile Lys Gly Lys Leu Ile Asp
450 455 460
Ile Val Ser Ser Gln Lys Ile Trp Leu Pro Ala Thr
465 470 475
<210> 2
<211> 527
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Gly Gly Gly Ser Arg Lys
1 5 10 15
Lys Arg Arg Gln Arg Arg Arg Gly Gly Gly Gly Ser Arg Lys Lys Arg
20 25 30
Arg Gln Arg Arg Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
35 40 45
Gly Gly Gly Ser Ala Val Pro Phe Val Glu Asp Trp Asp Leu Val Gln
50 55 60
Thr Leu Gly Glu Gly Ala Tyr Gly Glu Val Gln Leu Ala Val Asn Arg
65 70 75 80
Val Thr Glu Glu Ala Val Ala Val Lys Ile Val Asp Met Lys Arg Ala
85 90 95
Val Asp Cys Pro Glu Asn Ile Lys Lys Glu Ile Cys Ile Asn Lys Met
100 105 110
Leu Asn His Glu Asn Val Val Lys Phe Tyr Gly His Arg Arg Glu Gly
115 120 125
Asn Ile Gln Tyr Leu Phe Leu Glu Tyr Cys Ser Gly Gly Glu Leu Phe
130 135 140
Asp Arg Ile Glu Pro Asp Ile Gly Met Pro Glu Pro Asp Ala Gln Arg
145 150 155 160
Phe Phe His Gln Leu Met Ala Gly Val Val Tyr Leu His Gly Ile Gly
165 170 175
Ile Thr His Arg Asp Ile Lys Pro Glu Asn Leu Leu Leu Asp Glu Arg
180 185 190
Asp Asn Leu Lys Ile Ser Asp Phe Gly Leu Ala Thr Val Phe Arg Tyr
195 200 205
Asn Asn Arg Glu Arg Leu Leu Asn Lys Met Cys Gly Thr Leu Pro Tyr
210 215 220
Val Ala Pro Glu Leu Leu Lys Arg Arg Glu Phe His Ala Glu Pro Val
225 230 235 240
Asp Val Trp Ser Cys Gly Ile Val Leu Thr Ala Met Leu Ala Gly Glu
245 250 255
Leu Pro Trp Asp Gln Pro Ser Asp Ser Cys Gln Glu Tyr Ser Asp Trp
260 265 270
Lys Glu Lys Lys Thr Tyr Leu Asn Pro Trp Lys Lys Ile Asp Ser Ala
275 280 285
Pro Leu Ala Leu Leu His Lys Ile Leu Val Glu Asn Pro Ser Ala Arg
290 295 300
Ile Thr Ile Pro Asp Ile Lys Lys Asp Arg Trp Tyr Asn Lys Pro Leu
305 310 315 320
Lys Lys Gly Ala Lys Arg Pro Arg Val Thr Ser Gly Gly Val Ser Glu
325 330 335
Ser Pro Ser Gly Phe Ser Lys His Ile Gln Ser Asn Leu Asp Phe Ser
340 345 350
Pro Val Asn Ser Ala Ser Ser Glu Glu Asn Val Lys Tyr Ser Ser Ser
355 360 365
Gln Pro Glu Pro Arg Thr Gly Leu Ser Leu Trp Asp Thr Ser Pro Ser
370 375 380
Tyr Ile Asp Lys Leu Val Gln Gly Ile Ser Phe Ser Gln Pro Thr Cys
385 390 395 400
Pro Asp His Met Leu Leu Asn Ser Gln Leu Leu Gly Thr Pro Gly Ser
405 410 415
Ser Gln Asn Pro Trp Gln Arg Leu Val Lys Arg Met Thr Arg Phe Phe
420 425 430
Thr Lys Leu Asp Ala Asp Lys Ser Tyr Gln Cys Leu Lys Glu Thr Cys
435 440 445
Glu Lys Leu Gly Tyr Gln Trp Lys Lys Ser Cys Met Asn Gln Val Thr
450 455 460
Ile Ser Thr Thr Asp Arg Arg Asn Asn Lys Leu Ile Phe Lys Val Asn
465 470 475 480
Leu Leu Glu Met Asp Asp Lys Ile Leu Val Asp Phe Arg Leu Ser Lys
485 490 495
Gly Asp Gly Leu Glu Phe Lys Arg His Phe Leu Lys Ile Lys Gly Lys
500 505 510
Leu Ile Asp Ile Val Ser Ser Gln Lys Ile Trp Leu Pro Ala Thr
515 520 525
<210> 3
<211> 1581
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgaaaaaagc ggagacagag acggcgggga ggcggcgggt ctcgaaaaaa gcggagacag 60
agacggcggg gcggaggggg cagccgaaaa aagcggagac agagacggcg gggaggcggc 120
gggtctggcg gagggggcag cggaggaggc ggctctgcag tgccctttgt ggaagactgg 180
gacttggtgc aaaccctggg agaaggtgcc tatggagaag ttcaacttgc tgtgaataga 240
gtaactgaag aagcagtcgc agtgaagatt gtagatatga agcgtgccgt agactgtcca 300
gaaaatatta agaaagagat ctgtatcaat aaaatgctaa atcatgaaaa tgtagtaaaa 360
ttctatggtc acaggagaga aggcaatatc caatatttat ttctggagta ctgtagtgga 420
ggagagcttt ttgacagaat agagccagac ataggcatgc ctgaaccaga tgctcagaga 480
ttcttccatc aactcatggc aggggtggtt tatctgcatg gtattggaat aactcacagg 540
gatattaaac cagaaaatct tctgttggat gaaagggata acctcaaaat ctcagacttt 600
ggcttggcaa cagtatttcg gtataataat cgtgagcgtt tgttgaacaa gatgtgtggt 660
actttaccat atgttgctcc agaacttctg aagagaagag aatttcatgc agaaccagtt 720
gatgtttggt cctgtggaat agtacttact gcaatgctcg ctggagaatt gccatgggac 780
caacccagtg acagctgtca ggagtattct gactggaaag aaaaaaaaac atacctcaac 840
ccttggaaaa aaatcgattc tgctcctcta gctctgctgc ataaaatctt agttgagaat 900
ccatcagcaa gaattaccat tccagacatc aaaaaagata gatggtacaa caaacccctc 960
aagaaagggg caaaaaggcc ccgagtcact tcaggtggtg tgtcagagtc tcccagtgga 1020
ttttctaagc acattcaatc caatttggac ttctctccag taaacagtgc ttctagtgaa 1080
gaaaatgtga agtactccag ttctcagcca gaaccccgca caggtctttc cttatgggat 1140
accagcccct catacattga taaattggta caagggatca gcttttccca gcccacatgt 1200
cctgatcata tgcttttgaa tagtcagtta cttggcaccc caggatcctc acagaacccc 1260
tggcagcggt tggtcaaaag aatgacacga ttctttacca aattggatgc agacaaatct 1320
tatcaatgcc tgaaagagac ttgtgagaag ttgggctatc aatggaagaa aagttgtatg 1380
aatcaggtta ctatatcaac aactgatagg agaaacaata aactcatttt caaagtgaat 1440
ttgttagaaa tggatgataa aatattggtt gacttccggc tttctaaggg tgatggattg 1500
gagttcaaga gacacttcct gaagattaaa gggaagctga ttgatattgt gagcagccag 1560
aagatttggc ttcctgccac a 1581

Claims (4)

1. An injectable hydrogel containing CHK1 protein kinase-cell-penetrating peptide fusion protein is characterized in that the injectable hydrogel is formed by uniformly mixing the fusion protein and a gel-forming precursor molecule in a water phase, the fusion protein comprises a CHK1 protein kinase sequence and a TAT cell-penetrating peptide sequence, the CHK1 protein kinase sequence and the TAT cell-penetrating peptide sequence are connected through a connecting peptide, and the amino acid sequence of the fusion protein is shown as SEQ ID NO: 2, the gel-forming precursor molecule is dfeffdeffyrgd.
2. The injectable hydrogel of claim 1, wherein the mass ratio of the CHK1 protein kinase-cell penetrating peptide fusion protein to the gel-forming precursor molecule is 1: (1.9-2.1).
3. A method of preparing the injectable hydrogel of claim 1, comprising the steps of:
(1) weighing the gel-forming precursor molecule powder, fully dissolving the gel-forming precursor molecule powder by using double distilled water at room temperature, filtering and sterilizing, adjusting the pH to 7.3-7.5 by using sterile sodium bicarbonate, and obtaining a solution A for later use according to the constant volume of the gel-forming precursor molecule with the concentration of 18-22 mg/mL;
(2) taking a solution containing the fusion protein, and adding sterile PBS to make the concentration of the protein solution be 9-11mg/mL to obtain a solution B for later use;
(3) and (3) mixing the solution A obtained in the step (1) with the solution B obtained in the step (2) at room temperature, and slowly blowing, beating and uniformly mixing to obtain the injectable hydrogel.
4. A preparation method of CHK1 protein kinase-cell-penetrating peptide fusion protein is characterized by comprising the following steps:
the first step is as follows: synthesizing a nucleotide sequence of a protein kinase-cell penetrating peptide fusion protein TAT-CHEK1 of CHK1, wherein the nucleotide sequence is shown as SEQ NO. 3;
the second step is that: construction of pFastBacHTA-CHEK1 insect cell vector
(1) Plasmid design:
pUCori, F1ori terminator SV40poly (A) signal; the restriction enzyme site is 5 'BamHI, 3' HindIII; TAT-CHEK1 primer sequence:
F：CTGTATTTTCAGGGCGCCATGGATCCCATGGACTACAAGGACGACG
R：CCTCTAGTACTTCTCGACAAGCTTTTACTTGTACAGCTCGTCC
(2) TAT-CHEK1 fragment is PCR amplified and identified and purified
The PrimeSTAR HS DNA Polymerase kit was used, and the system conditions were as follows:
the primers are respectively diluted to the concentration of 10nmol/ul and added into the reaction system;
PCR50ul reaction system:
Figure FDA0003493089170000021
and (3) PCR reaction conditions:
Figure FDA0003493089170000022
and (3) purifying a product obtained by PCR, wherein the purification step comprises the following steps: binding buffer, centrifugation at 12000rpm for 1 min; washing buffer12000rpm, Washing twice in 1 min; eluting with 20-50ul water;
(3) recombination of the ligation vector with TAT-CHKE1
Figure FDA0003493089170000023
The MultiS One Step Cloning Kit was used for recombination:
the optimum amount of each fragment was [ 0.02X log of base of fragment ] ng
For example, when cloning inserts of 0.5kb, 1kb, and 2kb in length into a cloning vector of 5kb in length, the vector and each fragment are used in the optimum amounts:
the optimal usage amount of the linearized cloning vector is as follows: 0.02 × 5000 ═ 100 ng;
optimum amount of 0.5kb insert: 0.02 × 500-10 ng;
the optimum amount of the 1kb insert used: 0.02 × 1000 ═ 20 ng;
optimum amount of 2kb insert used: 0.02 × 2000-40 ng;
A. the amount of the linear cloning vector used is between 50ng and 200 ng; when the optimal usage amount of the DNA calculated by the formula is beyond the range, the lowest/highest usage amount is directly selected;
B. the amount of each insert used should be greater than 10 ng; when the optimal usage amount calculated by the formula is lower than the value, 10ng of the solution can be directly used;
C. when the linearized cloning vector and the amplified product of the insert are directly used without DNA purification, 1/5 (4 mu l) with the total volume not exceeding the volume of the reaction system is added;
and (3) recombination reaction:
the following reaction system was set up on ice:
Figure FDA0003493089170000031
in order to ensure the accuracy of sample addition, the linearized vector and the insert can be properly diluted before a recombination reaction system is configured, and the sample addition amount of components cannot be less than 1 ul;
(4) identification of recombinant products
PCR identification or sequencing identification;
the third step: DH10Bac competent cell transformation
(1) Placing the competent cells in an ice bath, if the competent cells need to be subpackaged, subpackaging the just-melted cell suspension into a centrifugal tube with aseptic precooling, and placing the centrifugal tube in the ice bath, wherein 100ul of the competent cells are taken as an example in the following experiment;
(2) adding 1-10ng of pFastBacHTA-CHEK1 recombinant plasmid into the competent cell suspension, gently rotating the centrifugal tube to mix the contents uniformly, and standing in an ice bath for 30 minutes;
(3) the centrifuge tube was placed in a 42 ℃ water bath for 30 seconds and then the tube was quickly transferred to an ice bath to allow the cells to cool for 2 minutes without shaking the centrifuge tube;
(4) adding 900ul of sterile SOC into each centrifugal tube, uniformly mixing, placing at 37 ℃, performing shaking culture for 4 hours at 200rpm by using a shaking table;
(5) performing 10-fold gradient dilution with SOC culture medium, e.g. dividing into 3 dilution gradients 10-1，10-2，10-3；
(6) 100ul of each gradient of culture was taken for plating; after the liquid in the plate is completely absorbed, inverting the plate, and culturing at 37 ℃ for 24-48 hours;
(7) remaining bacterial liquid is kept in a refrigerator at 4 ℃, and the remaining bacterial liquid is determined according to the growth condition of bacterial colonies on the flat plate;
(8) selecting 4 large (>1mm) white colonies with good isolation, plating again, scribing, and growing for at least 16 hours;
(9) culturing overnight;
(10) selecting a colony which is successfully recombined, and carrying out PCR (polymerase chain reaction) verification recombination;
(11) the verification primer is as follows: M13-F: CCCAGTCACGACGTTGTAAAACG
M13-R：AGCGGATAACAATTTCACACAGG
The fragment identified by PCR was 2.3kb + the insert length, and if identified, it represented successful transformation, and the virion had been successfully ligated to the plasmid;
extraction of Bacmids
Using a positive clone of midprep, eluting with sterile water; subpackaging pure bacmid, and freezing to-80 ℃; the recombinant AcMNPV virus can be rapidly and efficiently generated; taking English prefix and suffix of baculovirus (baculovirus) and plasmid (plasmid) to be named Bacmid, namely baculovirus plasmid; the vector can grow in Escherichia coli like plasmid, and has infection to lepidoptera insect cells;
transfection of Sf9 cells with bacmids
(1) Using CELLFECTIN kit, bacmids were transfected into Sf9 cells;
(2) the virus titer after transfection should be 2-4X 107pfu/ml; two more transfections were performed and the virus titer would exceed 109pfu/ml; protein expression was detected using cells after three passages of transfected virus, 2.5-3X 106Individual cells, 25ml of culture medium, 15cm dish;
6. extraction of proteins
(1) Adding 125 ml of sf9 cell culture medium into a conical glass bottle, and adding 50-100 mu l of virus titer 109pfu/ml sf9 cells, cultured in sf9 incubator for three days;
(2) adding a lysis solution for full lysis;
7. purification of proteins
(1) Putting Ni-NTA slurry into resin and cleaning;
(2) loading the lysate-Ni-NTA mixture into a 5ml plastic column in steps until all the mixture is loaded; at this time, if the protein is labeled with EGFP, the blue resin becomes light green due to the binding of the EGFP-labeled protein to the resin;
(3) washing the resin with 2 × 8ml buffer, if the egfp-labeled protein resin binds well, the washed resin remains pale green;
(4) adding 0.75ml elution buffer to the resin to elute the protein, labeled E1, at which time the resin color would turn blue if the elution was good;
(5) adding 4 × 0.75ml of elution buffer solution, and collecting E2, E3, E4 and E5; E1-E5 each 20. mu.l protein was detected by the Biorad method; if the protein content is good, the detection result will quickly turn into blue;
(6) E1-E5 were pooled together and passed through a gel exclusion spin filter in a total volume of about 3.75 ml, with a spin of 20 minutes, until a volume reduction of about 200. mu.l was achieved; at this time, the concentrated eluate was green, indicating that the protein gradually became granular; mixing with straw every timeProtein precipitation is avoided; then 2ml of buffer solution is added, the next round of operation is started, the temperature is reduced to 200ul again, and the two rounds are repeated; finally, the total dilution of the original buffer was about 18 × 10 × 10 × 10 ═ 1.8 × 104(ii) a Then spin the exchanged eluent for 10 minutes, carefully transfer the supernatant to another tube without agitating the denatured protein particles; the OD600 values of the protein concentration were measured, rapidly frozen in liquid nitrogen and stored at-80 ℃.
CN202210103514.4A 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof Pending CN114470178A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210103514.4A CN114470178A (en) 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202210103514.4A CN114470178A (en) 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof
CN201911235619.XA CN110904070A (en) 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201911235619.XA Division CN110904070A (en) 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN114470178A true CN114470178A (en) 2022-05-13

Family

ID=69823205

Family Applications (2)

Application Number Title Priority Date Filing Date
CN202210103514.4A Pending CN114470178A (en) 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof
CN201911235619.XA Pending CN110904070A (en) 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201911235619.XA Pending CN110904070A (en) 2019-12-05 2019-12-05 Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof

Country Status (1)

Country Link
CN (2) CN114470178A (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114470225B (en) * 2022-01-20 2023-09-12 苏州市立医院 Recombinant human CDC5L fusion protein hydrogel, preparation method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050059116A1 (en) * 1999-09-22 2005-03-17 Canbas Co. Ltd. Compositions and methods for inhibiting G2 cell cycle arrest and sensitizing cells to DNA damaging agents
CN103509088A (en) * 2013-09-13 2014-01-15 南开大学 Novel amphiphilic ionic polypeptide and application thereof in cell culture aspect

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103044556B (en) * 2013-01-14 2014-05-28 余榕捷 Recombined fusion protein VIP-TAT and application thereof
CN106063928B (en) * 2015-04-23 2020-07-14 中国医学科学院药物研究所 Application of polypeptide or derivative thereof in treating hypertensive myocardial hypertrophy
CN108753822A (en) * 2018-06-20 2018-11-06 中国人民解放军第四军医大学 Deliver the expression vector and its preparation method and application of pattern of fusion rna binding protein

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050059116A1 (en) * 1999-09-22 2005-03-17 Canbas Co. Ltd. Compositions and methods for inhibiting G2 cell cycle arrest and sensitizing cells to DNA damaging agents
CN103509088A (en) * 2013-09-13 2014-01-15 南开大学 Novel amphiphilic ionic polypeptide and application thereof in cell culture aspect

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JANGWOOK LEE等: "Injectable microsphere/hydrogel hybrid system containing heat shock protein as therapy in a murine myocardial infarction model", 《J DRUG TARGET》 *
刘国琴等: "《现代蛋白质实验技术》", 31 October 2011 *
区彩文: "小分子水凝胶承载Ad-HGF修饰的MSCs移植治疗心肌梗塞及其机制探讨", 《万方数据知识服务平台学位论文》 *
范燚: "乳小鼠再生心肌磷酸化蛋白组学分析揭示CHK1激酶通过mTORC1促进梗死后心肌再生的重要作用", 《中国博士学位论文全文数据库 医药卫生科技辑》 *

Also Published As

Publication number Publication date
CN110904070A (en) 2020-03-24

Similar Documents

Publication Publication Date Title
US20200149068A1 (en) Chimeric capsids
JP2004344170A (en) Myocardial graft and cellular composition useful therefor
JP2002500040A (en) Extending cell life, methods and reagents
CN112225793B (en) Lysosome targeting peptide, fusion protein thereof, adeno-associated virus vector carrying fusion protein coding sequence and application thereof
CN109678967B (en) Targeting polypeptide for treating osteosarcoma and application thereof
KR20110085765A (en) Human adult stem cells secreting anti-mdm2 and uses thereof
CN102209784B (en) Periostin-induced pancreatic regeneration
JP2023548957A (en) New PiggyBac transposon system and its application
JP2003502065A (en) Cardiomyocytes with enhanced proliferative capacity, and methods for their production and use
TWI263784B (en) Encapsulated cell indicator system
CN114470178A (en) Recombinant human CHK1 protein kinase hydrogel for promoting myocardial regeneration and preparation method and application thereof
CA3103684A1 (en) Solubilized apyrases, methods and use
CN110982802B (en) Recombinant human SGK3 protein kinase hydrogel and preparation method and application thereof in promoting myocardial regeneration
CN111187761A (en) Fusion protein of MNK2 protein kinase and cell-penetrating peptide, hydrogel thereof and application of fusion protein to promotion of myocardial regeneration
JP2024501821A (en) Viral capsid protein with specificity for cardiac tissue cells
CN114470225B (en) Recombinant human CDC5L fusion protein hydrogel, preparation method and application
KR102349061B1 (en) Method for preparing stem cells having improved engraftment
CN109136357B (en) Method for effectively inducing vascular degeneration and application
CA2447703C (en) Methods for proliferating terminal differentiated cells and recombinant vectors therefor
CN116162650B (en) Construction method and application of RyR2 mutant plasmid with fluorescent tag
CN114470162B (en) Application of GDF6 and over-expression reagent thereof in preparation of myocardial cell protective agent
US7795032B2 (en) Methods for proliferating cardiomyocytes and recombinant vectors therefor
CN116083367A (en) Method for preparing induced liver parenchymal cells and application thereof
Yang et al. Experimental Study of the Effects of Marrow Mesenchymal Stem Cells Transfected with Hypoxia-Inducible Factor-1 Gene
CN117467024A (en) Fusion tag recombinant collagen and expression and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20220513