CN114438227B - Molecular marker related to chicken sagging and application thereof - Google Patents

Abstract

The invention discloses a molecular marker related to chicken drop thickness and application thereof, belongs to the technical field of biological genes, and provides the molecular marker related to chicken drop thickness, wherein the molecular marker takes a C22056470T locus on an intron 1 of a chicken INHA gene as a detection locus, and analyzes the correlation between polymorphism of the locus and chicken drop thickness property. The method provides theoretical basis and reference data for chicken breeding and molecular marker assisted selection through chicken drop thickness characters. Compared with the traditional selection and breeding through phenotype data, the detection method constructed by the molecular marker has the advantages of low cost, simple and convenient operation, accurate result, simplicity, practicability, strong repeatability and capability of being carried out in a common laboratory.

Description

Molecular marker related to chicken sagging and application thereof

Technical Field

The invention relates to the technical field of biological genes, in particular to a molecular marker related to chicken sagging and application thereof.

Background

The sexual maturity of the poultry is highly regulated by hypothalamus-pituitary gland-gonadal axis, and the follicle stimulating hormone secreted by the pituitary gland can promote the growth and development of the seminal tubules and the spermatogenesis; luteinizing hormone stimulates the mesenchymal cells of the testis to secrete androgens and indirectly contributes to the formation of sperm. Secondary sex characteristics appear as androgens are secreted by testes and thereby stimulate the male birds. The secondary character of the poultry is an indirect characterization of reproductive traits, so that the breeding progress of the breeder's reproductive performance can be accelerated by indirect selection of the secondary character. The high-quality cock generally starts to develop at the age of 20-30 days, the color of the cock becomes red, the area of the cock crown becomes larger, the cock crown becomes thicker, the color, the size, the length and the thickness of the meat drop also correspondingly change (Zhang Dexiang and the like, 2013), and the characters can indirectly reflect the male development degree of the cock. Zhang Dexiang et al (2013) found that the correlation degree of testis weight and meat drop development is higher than that of cockscomb, the estimated value of the genetic force of meat drop development is medium and high (0.184-0.626), and the variation coefficient is also large (11.80% -59.87%), so that the method can be used as an indirect seed selection index for selecting testis weight. Liang Yuandong et al (2008) found that roosters with a long meat drop were also relatively large with the young roosters of the parent generation for fine-pattern chicken as experimental materials, and considered that the meat drop size could be a basis and a selection target for measuring the gonad development of the roosters. Zhou Min et al (2019) analyzed the coefficient of variation of the meat drop thickness of different weeks of the experimental population, found that the coefficient of variation was also large (15.40% -22.00%), and was very significantly positively correlated with the weight of 16w testes (P < 0.01), meat drop thickness was one of the main factors affecting the weight of 16 week old testes before 12 weeks of age, and was the rapid period of meat drop thickness development before 12 weeks of age. In recent years, the breeding of chicken sexual precocity characters is mostly to continuously select precocity individuals from backup chicken groups by a generation breeding method, and then to build a core group for propagation and breeding. At present, the research on precocious puberty is mainly focused on hens, and the research on precocious puberty of cocks is not reported yet. Along with the application of molecular genetic marker assisted selection in breeding, the candidate gene method is an effective and easy-to-operate method for breeding the sexual precocity molecules of the chickens.

Inhibin (INH), a dimeric glycoprotein hormone secreted by ovarian granulosa cells and testis support cells, belongs to the transforming growth factor beta superfamily members, and the most fundamental biological role is to inhibit follicle stimulating hormone synthesis and secretion, and can regulate humoral follicle stimulating hormone levels through complex feedback mechanisms, and can also regulate ovarian follicle development through local action. Inhibin is composed of two different subunits, α and β, joined together by disulfide bonds, with glycosylation sites on the α units and A, B on the β units, inhibin A (αβA) and inhibin B (αβB), with neither of the isolated α and β subunits being biologically active (Ma Yongjiang et al, 2000; li Xiaoli et al, 2003). The current research of INHA genes in chickens has focused mainly on the gene polymorphism and its reproductive performance with hens, such as 300-day-old egg yield, hatchling weight, open-body quality, open-day-old, open-birth crown height, open-birth shank length, 70-day-old body weight, 98-day-old body weight/crown height, crown length, etc. (Jin Heng, 2016; gui Taotao, 2018; cui et al, 2019; fan Di, etc. 2020), and ovarian development (Lovell et al, 2003; cui et al, 2019; cui et al, 2020; wast et al, 2020; cui et al, 2021; francoeur et al, 2021). Jin Heng (2016) found that this site was significantly related to 21-day-old body weight, 70-day-old body weight, 98-day-old body weight and 330-day-old egg number of hens (P < 0.05), but the correlation of INHA gene and the meat drop character of local chicken species was not yet reported.

Disclosure of Invention

The invention aims to provide a molecular marker related to chicken drop thickness and application thereof, so as to solve the problems in the prior art, and the invention uses a C22056470T site on an INHA gene intron 1 as a candidate marker to detect polymorphism of the site in local chicken breeder yellow cock and analyze the relationship between the polymorphism and different week-old chicken drop thickness, so as to provide a basis for local chicken breeder breeding and marker assisted selection.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a molecular marker related to chicken sagging, which is shown in figure 1.

Further, there is a C/T base mutation at the C22056470T site of the sequence shown in FIG. 1, and genotyping of CC, CT or TT occurs.

The invention also provides a primer pair for detecting the molecular marker related to chicken sagging, and the nucleotide sequence of the primer pair is shown as SEQ ID No.3-4 or SEQ ID No. 5-6.

The invention also provides a kit comprising the primer pair.

The invention also provides a method for detecting the molecular marker related to chicken sagging, which comprises the following steps:

(1) Extracting genomic DNA of the chicken to be detected;

(2) Performing PCR amplification using the primer set of claim 3 to obtain an amplification product;

(3) When the primer shown as SEQ ID No.3-4 is used in the step (2), sequencing the obtained amplified product to obtain the genotype of the molecular marker;

when the primer shown as SEQ ID No.5-6 is used in the step (2), gel electrophoresis is carried out on the obtained amplified product, and the genotype is judged according to the banding pattern;

(4) Judging the meat drop character of the chicken to be detected according to the genotyping result.

The invention also provides application of the molecular marker, the primer pair or the kit in detecting chicken drop thickness related characters.

The invention also provides an application of the molecular marker, the primer pair or the kit in chicken breeding.

The invention discloses the following technical effects:

the invention provides a molecular marker related to chicken drop thickness, which takes a C22056470T site positioned on an intron 1 of a chicken INHA gene as a detection site, analyzes the correlation between polymorphism of the site and chicken drop thickness property, and discovers through experiments that allele T of the site is beneficial to the development of chicken drop thickness. The method provides theoretical basis and reference data for chicken breeding and molecular marker assisted selection through chicken drop thickness characters. Compared with the traditional selection and breeding through phenotype data, the detection method constructed by the molecular marker has the advantages of low cost, simple and convenient operation, accurate result, simplicity, practicability, strong repeatability and capability of being carried out in a common laboratory.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the sequencing result of PCR products amplified by INHA gene primer INHA-I1F-1/INHA-I1R-1;

FIG. 2 shows the result of NCBI alignment of the PCR sequences amplified by INHA gene primer INHA-I1F-1/INHA-I1R-1;

FIG. 3 shows the results of alignment of PCR sequences amplified by INHA gene primer INHA-I1F-1/INHA-I1R-1 in UCSC chicken genome;

FIG. 4 is a position of the C22056470T locus on chromosome 7 of chicken, wherein the bolded letters indicate the C22056470T locus, the black capital letters indicate the aligned sequences, and the lowercase letters indicate the sequences upstream and downstream of the aligned sequences;

FIG. 5 is a sequencing diagram of the different genotypes of the INHA gene C22056470T locus, wherein the shaded portion is the C22056470T locus;

FIG. 6 shows the detection result of PCR products of INHA gene primer INHA-I1F-2/INHA-I1R-2, wherein M is DL2000 marker, and 1-6 are PCR products;

FIG. 7 shows the electrophoresis patterns of different genotypes at the position C22056470T of the INHA gene.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

Example 1

1. Materials and methods

1.1 Test material, index measurement and sample collection

The test chicken flock is provided by Jiangxi southern Engineer science and technology Co-Ltd, the raising time is 4 months in 2018-8 months, the number of chicken fries is 700 feathers, the raising mode is a breeding cock cage raising mode, unified immunization is carried out according to the conventional immunization program of the broiler breeder, and the other breeder breeds management is carried out according to the conventional method. The first day of birth was fitted with a fin number and the 5 th week was fitted with a foot number. The experiments were performed at 6, 8, 10, 12, 14, 16 weeks of age with full crowd meat drop thickness index determination, with death, escape, and apparent errors and duplicate data removed, and the final test cocks 499. Index determination is carried out according to the method specified in NY/T823-2004, the term for poultry production Performance and metric statistical method. Blood is collected by vein under the wing for 1-2 mL, anticoagulated by EDTA with concentration of 2 percent, and preserved at the temperature of minus 20 ℃ for standby. The collected samples were extracted with a conventional phenol/chloroform extraction method for genomic DNA and diluted to 100 ng/. Mu.L for use.

1.2 Primer design and Synthesis

To screen for SNP sites on intron 1, chicken INHA genomic sequence (GenBank accession number: NM-001031257.2) was downloaded from NCBI, and the Genetol software was used to design the upstream and downstream primers, and the primers were named and sequence respectively:

INHA-I1F-1(SEQ ID No.3):5'-GCAGGGAGGTGACGTGGGAGAGT-3'，

INHA-I1R-1(SEQ ID No.4):5'-GGCCGAGTGGTTGGGAGCAG-3'。

templates were the random extraction of genomic DNA from 20 individuals from 499 populations. Primers were synthesized by Hunan Optimus, inc.

Designing a primer to amplify a 492bp fragment on the upstream and downstream of the C22056470T locus on the INHA gene intron 1, wherein the names and the sequences of the primer are as follows:

INHA-I1F-2(SEQ ID No.5):5'-CAGGGATGGGGCCGCAGAAG-3'，

INHA-I1R-2(SEQ ID No.6):5'-CCGAGGGCTGGAAGAGGTAAGT-3'。

the template was the genomic DNA of 499 Ningdu yellow roosters. Primers were synthesized by Hunan Optimus, inc.

PCR amplification was performed with the primer INHA-I1F-1/INHA-I1R-1, and the PCR reaction system was (50. Mu.L): 2 XPCR mix 25. Mu.L, upstream and downstream primers each 0.4. Mu.L, DNA template 1.0. Mu.L, ddH ₂ O23.2. Mu.L. The PCR reaction procedure was: pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 64℃for 30s, elongation at 72℃for 45s,35 cycles; and then extending at 72 ℃ for 10min. The PCR products were checked for fragment size by 1% agarose gel electrophoresis. After detectionThe PCR products of (C) were sent to Hunan qing Ke biological Co., ltd for direct sequencing using the upstream primer, and the genotype was determined based on each individual sequencing result.

PCR amplification was performed with the primers INHA-I1F-2/INHA-I1R-2, the PCR reaction system was (10. Mu.L): 2 XPCR mix 5. Mu.L, upstream and downstream primers 0.2. Mu.L each, DNA template 0.6. Mu.L, ddH ₂ O4. Mu.L. The PCR reaction procedure was: pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 62℃for 30s, elongation at 72℃for 30s,35 cycles; and then extending at 72 ℃ for 7min. The PCR products were checked for fragment size by 1% agarose gel electrophoresis. The PCR products after detection were typed using RFLP. The enzyme digestion reaction system is as follows: 6.5. Mu.L of PCR product, 0.3. Mu.L of endonuclease PstI, 1.0. Mu.L of 10 Xbuffer buffer and ddH ₂ O2.2. Mu.L, incubator at 37℃overnight. The cleavage products were detected by 2% agarose gel electrophoresis. The gel imaging system photographs, and the genotype is judged according to the banding pattern.

1.3 statistical analysis

Because the observed groups have the same genetic background and are all 16w cock, and are bred under the condition of the same breeding standard, the association analysis between the marker and the meat drop thickness trait adopts the SAS 9.0GLM program for statistical analysis, and a model is constructed as follows: y is Y _ij ＝μ+G _i +e _ij . Wherein Y is _ij Is the character phenotype value, mu is the overall average value of the character, G _i Is the genotype effect value, e _ij Is a random residual effect.

2. Results and analysis

2.1 PCR product detection results of primer INHA-I1F-1/INHA-I1R-1

The PCR product amplified by the primer INHA-I1F-1/INHA-I1R-1 is detected by 1.0% agarose gel electrophoresis, and a clear single band at 750bp is found, which is consistent with the expected fragment size. The PCR product after detection is directly sequenced, the sequenced sequence is shown in figure 1 (SEQ ID No. 1), and a part with poor sequencing results of the 5 'end and the 3' end is removed, so that a 675bp sequence is obtained. The obtained sequence is subjected to https:// blast.ncbi.nfm.nih.gov/blast.cgi comparison, whether the obtained sequence is the sequence of the INHA gene or not is further verified, the comparison result is shown in figure 2, and the sequence obtained by sequencing is a partial sequence of the INHA gene. The sequences obtained by sequencing were further aligned in http:// genome. Ucsc. Edu/cgi-bin/hgBlat, the results are shown in FIG. 3, and the positions of the sequences on chromosome 7 of the chicken genome are shown in FIG. 4. The sequencing of the PCR products of 20 individuals was analyzed by the MegAlign program in the Lasergene 7.1 software package, and the presence of the polymorphic site of T.fwdarw.C of the PstI endonuclease at position 22056470 of chromosome 7 was found (FIG. 5).

SEQ ID No.1：

CCAGGGAGATGGGGAGGGCTGAGGAGCGGGCAGAGCAGGACACTGGAGTGGGATGGTAGAGAATGGGGCAGGGTGCTGGGAATGGGATGCTAAGTGATGGGTTACGATGCTGAAGGATGGAGTGGGATACCCAGGGATGGGGCCGCAGAAGGATGCTCAGGGTTGCAACAGGATACTCGGGGTTGCAGCATAGTGCAGGAGGACAGAGCAGGACACAGTGGAATGGGTACACCAGACCATCCCGGGGCATGGAGGGGCTTGGTGACCTCACTAGGCAGCTCAGCCAAGCCCGGCCATATGAAGAAGGTGGCTGAATCCCACAGCCCCAAGACCGTGGGGTGCCAGGTGCCGCAGCTGTGCCTGGCTGGCAGCACAAGCCAGGCAGAGCCTTGCGCAGGGCTGGATCTGCTGCAGGGTTTGGCTGCAGGACACAGCAGCAGGTGCTGCGTGGCACTGGATGTCGTCAGCTCCTGTGTCTCCCCCCATACCCTATCCCCACAGTGGGGCACAACACCCTGAGCCACTCTTTCCCCACAGACGTGCCGGGCGAGCCCACGCAGCCAGACAAGCTGCTGGAGGAAGAAGGCATCTTCACTTACCTCTTCCAGCCCTCGGCGCACGCCCTGAGCCGCACGCTGACATCCGCCCAGCTCTGGTTCTACAGCGGCCCCTCGG

SEQ ID No.2：

2.2 PCR product detection results of primer INHA-I1F-2/INHA-I1R-2

The PCR product amplified by INHA gene primer INHA-I1F-2/INHA-I1R-2 is detected by 1.0% agarose gel electrophoresis, and is shown in FIG. 6, a clear single band is formed at 492bp, and the size of the single band is consistent with that of the expected fragment.

2.3 Genotype detection of INHA Gene C22056470T locus

The PCR product of the 499 Ningpo Huang Gongji INHA gene C22056470T was digested with PstI, and 3 genotypes were found by detecting the digested products by electrophoresis, namely CC (492 bp), CT (284 bp+204 bp+492bp) and TT (284 bp+204 bp) (FIG. 7).

2.4 Correlation of INHA gene C22056470T locus and meat drop thickness of Ningdu yellow cock at different ages

The correlation between different genotypes at the C22056470T locus in INHA gene intron 1 and the thickness of meat drop at different ages is shown in Table 1. As can be seen from table 1, among the 6 meat drop thickness traits determined, there was a significant difference (P < 0.05) or very significant difference (P < 0.01) between the 6w-12w different genotypes, and the meat drop of TT type individuals was significant (P < 0.05) or very significant (P < 0.01) thicker than those of CT type and CC type individuals; this site was not significantly different from the meat drop thickness of 14w and 16w (P > 0.05).

TABLE 1 correlation of rs16492031 genotypes and cage-rearing Ningdu Huang Gongji meat drop thickness traits at sites

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Sequence listing

<110> Nanchang Master and stock academy of livestock and veterinary research at the academy of agricultural sciences in Jiangxi province

<120> a molecular marker related to chicken sagging and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 675

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ccagggagat ggggagggct gaggagcggg cagagcagga cactggagtg ggatggtaga 60

gaatggggca gggtgctggg aatgggatgc taagtgatgg gttacgatgc tgaaggatgg 120

agtgggatac ccagggatgg ggccgcagaa ggatgctcag ggttgcaaca ggatactcgg 180

ggttgcagca tagtgcagga ggacagagca ggacacagtg gaatgggtac accagaccat 240

cccggggcat ggaggggctt ggtgacctca ctaggcagct cagccaagcc cggccatatg 300

aagaaggtgg ctgaatccca cagccccaag accgtggggt gccaggtgcc gcagctgtgc 360

ctggctggca gcacaagcca ggcagagcct tgcgcagggc tggatctgct gcagggtttg 420

gctgcaggac acagcagcag gtgctgcgtg gcactggatg tcgtcagctc ctgtgtctcc 480

ccccataccc tatccccaca gtggggcaca acaccctgag ccactctttc cccacagacg 540

tgccgggcga gcccacgcag ccagacaagc tgctggagga agaaggcatc ttcacttacc 600

tcttccagcc ctcggcgcac gccctgagcc gcacgctgac atccgcccag ctctggttct 660

acagcggccc ctcgg 675

<210> 2

<211> 850

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gtgctgctct ggggcaatgg ggatgtggca gggccagtgg gagaggggca ggtggcaggg 60

aggtgacgtg ggagagtgcc cagaggtgga acagggggac ccagggagat ggggagggct 120

gaggagcggg cagagcagga cactggagtg ggatggtaga gaatggggca gggtgctggg 180

aatgggatgc taagtgatgg gttacgatgc tgaaggatgg agtgggatac ccagggatgg 240

ggccgcagaa ggatgctcag ggttgcaaca ggatactcgg ggttgcagca tagtgcagga 300

ggacagagca ggacacagtg gaatgggtac accattacca gaccatcccg gggcatggag 360

gggcttggtg acctcactag gcagctcagc caagcccggc catatgaaga aggtggctga 420

atcccacagc cccaagaccg tggggtgcca ggtgccgcag ctgtgcctgg ctggcagcac 480

aagccaggca gagccttgcg cagggctgga tctgctgcag ggtttggccg caggacacag 540

agcagcaggt gctgcgtggc actggatgtc gtcagctcct gtgtctcccc ccatacccca 600

tccccacagt ggggcacgac accctgagcc actctttccc cacagacgtg ccgtgcgagc 660

ccacgcagcc agacaagctg ctggaggaag aaggcatctt cacttacctc ttccagccct 720

cggcgcacgc cctgagccgc acgctgacat ccgcccagct ctggttctac agcggcccct 780

cggctgctcc caaccactcg gcccccgctg tgctgaccct ctcaccgcag ggcagggtgc 840

cggtggtggc 850

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gcagggaggt gacgtgggag agt 23

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ggccgagtgg ttgggagcag 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

cagggatggg gccgcagaag 20

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ccgagggctg gaagaggtaa gt 22

Claims (3)

1. A method for detecting a molecular marker associated with chicken sagging, comprising the steps of:

(1) Extracting genomic DNA of the chicken to be detected;

(2) Performing PCR amplification by using the primer pair to obtain an amplification product;

(3) When the primer shown as SEQ ID No.3-4 is used in the step (2), sequencing the obtained amplified product to obtain the genotype of the molecular marker;

when the primer shown as SEQ ID No.5-6 is used in the step (2), gel electrophoresis is carried out on the obtained amplified product, and the genotype is judged according to the banding pattern;

judging the meat drop character of the chicken to be tested according to the genotyping result;

the molecular marker is shown as SEQ ID No.1, and the 436 th site of the sequence shown as SEQ ID No.1 has C/T base mutation, and the genotyping of CC, CT or TT occurs.

2. The application of the molecular marker in detecting chicken drop thickness related characters is characterized in that the molecular marker is shown as SEQ ID No.1, the 436 th site of the sequence shown as SEQ ID No.1 has C/T base mutation, and the genotyping of CC, CT or TT occurs.

3. The application of the molecular marker in chicken breeding is characterized in that the molecular marker is shown as SEQ ID No.1, the 436 th site of the sequence shown as SEQ ID No.1 has C/T base mutation, and the genotyping of CC, CT or TT occurs.