CN114438227A

CN114438227A - Molecular marker related to vertical thickness of chicken and application thereof

Info

Publication number: CN114438227A
Application number: CN202210167267.4A
Authority: CN
Inventors: 武艳平; 周敏; 朱学农; 魏岳; 谭玉文; 贡继尚; 许继国; 马荆鄂; 熊信威
Original assignee: Institute Of Animal Husbandry Veterinary Jiangxi Academy Of Agricultural Sciences; Nanchang Normal University
Current assignee: Institute Of Animal Husbandry Veterinary Jiangxi Academy Of Agricultural Sciences; Nanchang Normal University
Priority date: 2022-02-23
Filing date: 2022-02-23
Publication date: 2022-05-06
Anticipated expiration: 2042-02-23
Also published as: CN114438227B

Abstract

The invention discloses a molecular marker related to chicken vertical thickness and application thereof, belongs to the technical field of biological genes, and provides a molecular marker related to chicken vertical thickness, wherein the molecular marker takes a C22056470T site positioned on intron 1 of chicken INHA gene as a detection site, the correlation between the polymorphism of the site and chicken vertical thickness characters is analyzed, and experiments show that allele T of the site is beneficial to the development of chicken vertical thickness. The method provides theoretical basis and reference data for breeding chicken species and molecular marker-assisted selection through the vertical thickness character of chicken meat. Compared with the traditional phenotypic data breeding, the detection method constructed by the molecular marker has the advantages of low cost, simple and convenient operation, accurate result, simplicity and practicability, strong repeatability and capability of being carried out in a common laboratory.

Description

Molecular marker related to vertical thickness of chicken and application thereof

Technical Field

The invention relates to the technical field of biological genes, in particular to a molecular marker related to the vertical thickness of chicken and application thereof.

Background

The sexual maturity of the poultry is highly regulated and controlled by the hypothalamus-pituitary-gonad axis, and the follicle-stimulating hormone secreted by the pituitary can promote the growth and development of a sperm tube and spermatogenesis; luteinizing hormone stimulates the interstitial cells of the testes to secrete androgen and indirectly contributes to the formation of sperm. The second sexual characteristics of the cock are stimulated by the secretion of androgen from the testis. The second sex characteristics of the poultry are indirect characteristics of the reproductive traits, so that the breeding progress of the breed reproductive performance can be accelerated by indirect selection of the second sex characteristics. High-quality cocks generally begin to develop in 20-30 days old cocks, the color turns red, the area of the cocks becomes large, the cocks become thick, the color, size, length and thickness of the meat drop also change correspondingly (Zhang De Xiang et al, 2013), and the characters can indirectly reflect the masculinizing development degree of the cocks. Studies of Zhang Dexiang et al (2013) find that the correlation degree of the testicle weight and the development of the meat lobe is higher than that of the cockscomb, the estimated value of the heritability of the development of the meat lobe is a medium upper degree (0.184-0.626), the coefficient of variation is large (11.80% -59.87%), and the method can be used as an indirect seed selection index for selecting the testicle weight. Liangyuandong et al (2008) find that the rooster with long verticality has relatively large testis by taking the Liangfeng meat type parental breeding rooster as an experimental material, and think that the size of the verticality can be used as a basis and a selection target for measuring the gonad development of the rooster. Weekly, the like (2019) analyzes the variation coefficient of the thickness of the sagging of the experimental population at different ages of the week, and finds that the variation coefficient is also large (15.40% -22.00%), is in extremely obvious positive correlation with the weight of 16w testis pills (P is less than 0.01), the thickness of the sagging of the flesh is one of the main factors influencing the weight of 16 weeks of the testis pills before the age of 12 weeks, and the thickness of the sagging of the flesh is a rapid period for the development of the sagging of the flesh before the age of 12 weeks. In recent years, the breeding of the related chicken sexual precocity characters is mostly to continuously select precocity individuals from backup chicken groups by a generation breeding method, and expand propagation and breeding are carried out after a core group is established, and the method is slow and has poor stability. At present, the research on sexual precocity is mainly focused on hens, and the research on sexual precocity of cocks is not reported yet. With the application of molecular genetic marker-assisted selection in breeding, the candidate gene method is an effective and easy-to-operate method for the progressive early-maturing molecular breeding of the chickens.

Inhibin (inhin, INH) is a dimeric glycoprotein hormone secreted by ovarian granulosa cells and testicular supporting cells, belongs to a member of the transforming growth factor beta superfamily, and the most basic biological effect is to inhibit synthesis and secretion of follicle-stimulating hormone, regulate the level of humoral follicle-stimulating hormone through a complex feedback mechanism, and also regulate the development of follicles in ovaries through local action. Inhibin is composed of two different subunits, alpha and beta, linked together by disulfide bonds, the alpha unit having glycosylation sites, the beta unit being of the A, B two types, inhibin a (α β a) and inhibin B (α β B), and the isolated alpha and beta subunits being biologically inactive (marwarjiang et al, 2000; ludwig et al, 2003). The research of the INHA gene on chickens at present mainly focuses on the gene polymorphism and the reproductive performance of the gene and hens, such as 300-day-old egg production, chick weight, birth volume quality, birth day age, high birth crown, long birth shin, 70-day-old body weight, 98-day-old body weight/crown height, crown length and the like (Jinheng, 2016; great waves and the like, 2018; Cui and the like, 2019; Vandi and the like, 2020) and ovary development (Lovell and the like, 2003; Cui and the like, 2019; Cui and the like, 2020; Wati and the like, Cui and the like, 2021; Francoeur and the like, 2021). Jinheng (2016) finds that the locus is significantly related to 21-day-old body weight, 70-day-old body weight, 98-day-old body weight and 330-day-old egg laying number of the hens (P <0.05), but the relevance of an INHA gene and the property of the local breeder cock plump is not reported.

Disclosure of Invention

The invention aims to provide a molecular marker related to the vertical thickness of chicken and application thereof, and aims to solve the problems in the prior art, the invention uses the C22056470T site on intron 1 of an INHA gene as a candidate marker to detect the polymorphism of the site in local chicken Ningdu yellow cocks and analyze the relation between the polymorphism and the vertical thickness of the chicken in different weeks, so as to provide a basis for local chicken variety breeding and marker-assisted selection.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a molecular marker related to the vertical thickness of chicken, which is shown in figure 1.

Further, the base mutation of C/T was present at the C22056470T site of the sequence shown in FIG. 1, and genotyping of CC, CT or TT occurred.

The invention also provides a primer pair for detecting the molecular marker related to the vertical thickness of the chicken, and the nucleotide sequence of the primer pair is shown as SEQ ID No.3-4 or SEQ ID No. 5-6.

The invention also provides a kit comprising the primer pair.

The invention also provides a method for detecting the molecular marker related to the vertical thickness of the chicken, which comprises the following steps:

(1) extracting the genome DNA of the chicken to be detected;

(2) performing PCR amplification by using the primer pair of claim 3 to obtain an amplification product;

(3) when the primers shown in SEQ ID No.3-4 are used in the step (2), sequencing the obtained amplification product to obtain the genotype of the molecular marker;

when the primers shown in SEQ ID No.5-6 are used in the step (2), performing gel electrophoresis on the obtained amplification product, and judging the genotype according to the band type;

(4) and judging the meat drop character of the chicken to be detected according to the genotyping result.

The invention also provides an application of the molecular marker, the primer pair or the kit in detecting the chicken drooping thickness related traits.

The invention also provides application of the molecular marker, the primer pair or the kit in chicken breeding.

The invention discloses the following technical effects:

the invention provides a molecular marker related to the vertical thickness of chicken, which takes a C22056470T locus positioned on an intron 1 of an INHA gene of the chicken as a detection locus, analyzes the correlation between the polymorphism of the locus and the vertical thickness character of the chicken, and finds that an allele T of the locus is beneficial to the development of the vertical thickness of the chicken through experiments. The method provides theoretical basis and reference data for breeding chicken species and molecular marker-assisted selection through the vertical and thick chicken meat. Compared with the traditional phenotypic data breeding, the detection method constructed by the molecular marker has the advantages of low cost, simple and convenient operation, accurate result, simplicity and practicability, strong repeatability and capability of being carried out in a common laboratory.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 shows the sequencing result of PCR products amplified by INHA gene primer INHA-I1F-1/INHA-I1R-1;

FIG. 2 shows the results of the NCBI alignment of PCR sequences amplified with primers INHA-I1F-1/INHA-I1R-1 of the INHA gene;

FIG. 3 shows the result of the alignment of PCR sequences amplified by INHA gene primer INHA-I1F-1/INHA-I1R-1 in UCSC chicken genome;

FIG. 4 is the position of C22056470T locus on chromosome 7 of chicken, wherein bold upper case letters indicate the C22056470T locus, black upper case letters indicate the aligned sequences, and lower case letters indicate the sequences upstream and downstream of the aligned sequences;

FIG. 5 is a sequence diagram of the different genotypes at the C22056470T locus of the INHA gene, wherein the shaded portion is the C22056470T locus;

FIG. 6 shows the result of detecting the PCR product of INHA gene primer INHA-I1F-2/INHA-I1R-2, wherein M is DL2000 marker, and 1-6 are PCR products;

FIG. 7 is an electrophoretogram of different genotypes at the C22056470T locus of INHA gene.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1

1 materials and methods

1.1 test materials, index determination and sample Collection

The test chicken flock is provided by south Jiangxi teacher science and technology Limited, the feeding time is 4 months-8 months in 2018, the number of the young chicken is 700 feathers, the feeding mode is a breeding cock cage-breeding mode, unified immunization is carried out according to a conventional immunization program of broiler breeders, and the rest is carried out feeding management according to a conventional method. The wing size was worn on the first day of birth and the foot size was worn on week 5. The experiment respectively carries out the measurement of the whole group of the meat drop thickness indexes at the ages of 6 weeks, 8 weeks, 10 weeks, 12 weeks, 14 weeks and 16 weeks, death, escape, obvious errors and repeated data are removed, and 499 test cocks are finally obtained. The index measurement is carried out according to the method specified in NY/T823-2004 "poultry Performance noun terminology and metrics statistics method". Collecting blood 1-2 mL in a infrawing vein, anticoagulating with 2% EDTA, and storing at-20 ℃ for later use. The blood samples were extracted with genomic DNA by conventional phenol/chloroform extraction and diluted to 100 ng/. mu.L for use.

1.2 primer design and Synthesis

For screening SNP sites on intron 1, the chicken INHA genome sequence (GenBank accession number: NM-001031257.2) is downloaded from NCBI, Genetool software is used to design upstream and downstream primers, a sequence containing 750bp upstream and downstream of all intron 1 is amplified, and the name and the sequence of the primers are respectively as follows:

INHA-I1F-1(SEQ ID No.3):5'-GCAGGGAGGTGACGTGGGAGAGT-3'，

INHA-I1R-1(SEQ ID No.4):5'-GGCCGAGTGGTTGGGAGCAG-3'。

the template was genomic DNA from 20 individuals randomly drawn from a 499 population. The primers were synthesized by Hainan Okangke BioLimited.

Designing a primer to amplify a 492bp fragment on the upstream and downstream of the C22056470T locus on the intron 1 of the INHA gene, wherein the name and the sequence of the primer are respectively as follows:

INHA-I1F-2(SEQ ID No.5):5'-CAGGGATGGGGCCGCAGAAG-3'，

INHA-I1R-2(SEQ ID No.6):5'-CCGAGGGCTGGAAGAGGTAAGT-3'。

the template was genomic DNA from 499 Ningdu yellow rooster chickens. The primers were synthesized by Hainan Okangke BioLimited.

PCR amplification was performed with primers INHA-I1F-1/INHA-I1R-1, the PCR reaction system (50. mu.L): 2 XPCR mix 25 uL, upstream and downstream primers 0.4 uL each, DNA template 1.0 uL, ddH₂O23.2. mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 45s, and 35 cycles; post extension at 72 ℃ for 10 min. The PCR product was electrophoresed through 1% agarose gel to determine if the fragment size was as expected. And (3) sending the detected PCR product to Hunan Optimalaceae organism Limited to perform direct sequencing by using an upstream primer, and judging the genotype according to the sequencing result of each individual.

PCR amplification was performed with primers INHA-I1F-2/INHA-I1R-2, the PCR reaction system (10. mu.L): 2 XPCR mix 5 uL, upstream and downstream primers 0.2 uL, DNA template 0.6 uL, ddH₂O4. mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; post extension at 72 ℃ for 7 min. The PCR product was electrophoresed through 1% agarose gel to determine if the fragment size was as expected. And typing the PCR product after detection by using RFLP. The enzyme digestion reaction system is as follows: 6.5. mu.L of PCR product, 0.3. mu.L of endonuclease Pst I, 1.0. mu.L of 10 XBuffer buffer, ddH₂O2.2. mu.L, left overnight in an incubator at 37 ℃. Detecting the enzyme digestion product by 2 percent agarose gel electrophoresis. The gel imaging system takes pictures and judges the genotype according to the banding pattern.

1.3 statistical analysis

As the observed groups have the same genetic background and are all 16w cocks, and the cocks are raised under the same raising standard, the correlation analysis between the marker and the meat drooping thickness character is statistically analyzed by adopting the SAS 9.0GLM program, and the model is constructed as follows: y is_ij＝μ+G_i+e_ij. Wherein Y is_ijIs the phenotypic value of a trait, μ is the overall mean of that trait, G_iIs the genotype effect value, e_ijIs a random residual effect.

2 results and analysis

2.1 primer INHA-I1F-1/INHA-I1R-1 PCR product detection results

The PCR product amplified by primer INHA-I1F-1/INHA-I1R-1 was detected by 1.0% agarose gel electrophoresis and found to have a clear single band at 750bp, which is consistent with the expected fragment size. The detected PCR product is directly sequenced, the sequencing sequence is shown in figure 1(SEQ ID No.1), and the parts with poor sequencing results of the 5 'end and the 3' end are removed, so that the 675bp sequence is obtained. Comparing the obtained sequence by https:// blast.ncbi.nlm.nih.gov/blast.cgi, further verifying whether the obtained sequence is the sequence of the INHA gene, wherein the comparison result is shown in figure 2, and the sequence obtained by sequencing can be seen as a partial sequence of the INHA gene. The sequence obtained by sequencing was further aligned in the genome at http:// genome. ucsc.edu/cgi-bin/hgBlat, and the result is shown in FIG. 3, and the position of this sequence on chromosome 7 of the chicken genome is shown in FIG. 4. The sequencing results of the PCR products of 20 individuals were analyzed by the MegAlign program in the Lasergene 7.1 software package, and it was found that a polymorphic site of T → C of PstI endonuclease existed at the position of 22056470 in chromosome 7 of the genome (FIG. 5).

SEQ ID No.1：

CCAGGGAGATGGGGAGGGCTGAGGAGCGGGCAGAGCAGGACACTGGAGTGGGATGGTAGAGAATGGGGCAGGGTGCTGGGAATGGGATGCTAAGTGATGGGTTACGATGCTGAAGGATGGAGTGGGATACCCAGGGATGGGGCCGCAGAAGGATGCTCAGGGTTGCAACAGGATACTCGGGGTTGCAGCATAGTGCAGGAGGACAGAGCAGGACACAGTGGAATGGGTACACCAGACCATCCCGGGGCATGGAGGGGCTTGGTGACCTCACTAGGCAGCTCAGCCAAGCCCGGCCATATGAAGAAGGTGGCTGAATCCCACAGCCCCAAGACCGTGGGGTGCCAGGTGCCGCAGCTGTGCCTGGCTGGCAGCACAAGCCAGGCAGAGCCTTGCGCAGGGCTGGATCTGCTGCAGGGTTTGGCTGCAGGACACAGCAGCAGGTGCTGCGTGGCACTGGATGTCGTCAGCTCCTGTGTCTCCCCCCATACCCTATCCCCACAGTGGGGCACAACACCCTGAGCCACTCTTTCCCCACAGACGTGCCGGGCGAGCCCACGCAGCCAGACAAGCTGCTGGAGGAAGAAGGCATCTTCACTTACCTCTTCCAGCCCTCGGCGCACGCCCTGAGCCGCACGCTGACATCCGCCCAGCTCTGGTTCTACAGCGGCCCCTCGG

SEQ ID No.2：

2.2 detection of PCR products with primer INHA-I1F-2/INHA-I1R-2

The PCR product amplified by the INHA gene primer INHA-I1F-2/INHA-I1R-2 was detected by 1.0% agarose gel electrophoresis as shown in FIG. 6, and a clear single band at 492bp, which is consistent with the expected fragment size.

2.3 genotype detection of site C22056470T of INHA Gene

The PCR product of INHA gene C22056470T site of 499 Ningdu yellow cock is digested by PstI, and 3 genotypes including CC (492bp), CT (288bp +204bp +492bp) and TT (288bp +204bp) are respectively found by electrophoresis detection of the digested product (FIG. 7).

2.4 correlation of INHA Gene C22056470T site with the thickness of the sag of Ningdu yellow rooster at different ages

The correlation between different genotypes of the C22056470T locus in intron 1 of the INHA gene and the trait of the age-related prolapse of the flesh at different weeks is shown in Table 1. As can be seen from table 1, among the 6 measured flap thickness traits, there were significant differences (P <0.05) or very significant differences (P <0.01) between the 6w-12w different genotypes, and flap significance (P <0.05) or very significant (P <0.01) was thicker in TT type individuals than in CT type and CC type individuals; the difference in the flap thickness between this site and 14w and 16w was not significant (P > 0.05).

TABLE 1 correlation of rs16492031 genotype with the downy thick character of caged Ningdu yellow rooster

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> institute of agriculture and veterinary sciences of Jiangxi province, south Chang Master institute

<120> molecular marker related to chicken vertical thickness and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 675

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccagggagat ggggagggct gaggagcggg cagagcagga cactggagtg ggatggtaga 60

gaatggggca gggtgctggg aatgggatgc taagtgatgg gttacgatgc tgaaggatgg 120

agtgggatac ccagggatgg ggccgcagaa ggatgctcag ggttgcaaca ggatactcgg 180

ggttgcagca tagtgcagga ggacagagca ggacacagtg gaatgggtac accagaccat 240

cccggggcat ggaggggctt ggtgacctca ctaggcagct cagccaagcc cggccatatg 300

aagaaggtgg ctgaatccca cagccccaag accgtggggt gccaggtgcc gcagctgtgc 360

ctggctggca gcacaagcca ggcagagcct tgcgcagggc tggatctgct gcagggtttg 420

gctgcaggac acagcagcag gtgctgcgtg gcactggatg tcgtcagctc ctgtgtctcc 480

ccccataccc tatccccaca gtggggcaca acaccctgag ccactctttc cccacagacg 540

tgccgggcga gcccacgcag ccagacaagc tgctggagga agaaggcatc ttcacttacc 600

tcttccagcc ctcggcgcac gccctgagcc gcacgctgac atccgcccag ctctggttct 660

acagcggccc ctcgg 675

<210> 2

<211> 850

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtgctgctct ggggcaatgg ggatgtggca gggccagtgg gagaggggca ggtggcaggg 60

aggtgacgtg ggagagtgcc cagaggtgga acagggggac ccagggagat ggggagggct 120

gaggagcggg cagagcagga cactggagtg ggatggtaga gaatggggca gggtgctggg 180

aatgggatgc taagtgatgg gttacgatgc tgaaggatgg agtgggatac ccagggatgg 240

ggccgcagaa ggatgctcag ggttgcaaca ggatactcgg ggttgcagca tagtgcagga 300

ggacagagca ggacacagtg gaatgggtac accattacca gaccatcccg gggcatggag 360

gggcttggtg acctcactag gcagctcagc caagcccggc catatgaaga aggtggctga 420

atcccacagc cccaagaccg tggggtgcca ggtgccgcag ctgtgcctgg ctggcagcac 480

aagccaggca gagccttgcg cagggctgga tctgctgcag ggtttggccg caggacacag 540

agcagcaggt gctgcgtggc actggatgtc gtcagctcct gtgtctcccc ccatacccca 600

tccccacagt ggggcacgac accctgagcc actctttccc cacagacgtg ccgtgcgagc 660

ccacgcagcc agacaagctg ctggaggaag aaggcatctt cacttacctc ttccagccct 720

cggcgcacgc cctgagccgc acgctgacat ccgcccagct ctggttctac agcggcccct 780

cggctgctcc caaccactcg gcccccgctg tgctgaccct ctcaccgcag ggcagggtgc 840

cggtggtggc 850

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcagggaggt gacgtgggag agt 23

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggccgagtgg ttgggagcag 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagggatggg gccgcagaag 20

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccgagggctg gaagaggtaa gt 22

Claims

1. A molecular marker related to the vertical thickness of chicken is characterized in that the molecular marker is shown in figure 1.

2. The molecular marker related to chicken verticality according to claim 1, wherein the C/T base mutation exists at the C22056470T site of the sequence shown in figure 1, and the CC, CT or TT genotyping is realized.

3. A primer pair for detecting the molecular marker related to the chicken verticality according to claim 1 is characterized in that the nucleotide sequence of the primer pair is shown in SEQ ID Nos. 3-4 or SEQ ID Nos. 5-6.

4. A kit comprising the primer set according to claim 3.

5. A method for detecting the molecular marker related to the chicken vertical thickness of the claim 1 or 2, which is characterized by comprising the following steps:

(1) extracting the genome DNA of the chicken to be detected;

6. Use of the molecular marker of claim 1 or 2, the primer pair of claim 3, or the kit of claim 4 for detecting a trait related to chicken sagging thickness.

7. Use of the molecular marker of claim 1 or 2, the primer pair of claim 3, or the kit of claim 4 in chicken breeding.