CN114438086B

CN114438086B - Application of silkworm Period gene in silkworm breeding and silkworm cocoon production

Info

Publication number: CN114438086B
Application number: CN202210210832.0A
Authority: CN
Inventors: 徐世清; 王永峰; 李江岚; 戴泰明; 邱剑丰; 崔文沼; 彭如及
Original assignee: Suzhou University; Nantong Textile and Silk Industrial Technology Research Institute
Current assignee: Suzhou University; Nantong Textile and Silk Industrial Technology Research Institute
Priority date: 2022-03-03
Filing date: 2022-03-03
Publication date: 2023-12-29
Anticipated expiration: 2042-03-03
Also published as: CN114438086A

Abstract

The invention relates to application of a silkworm Period gene in silkworm breeding and silkworm cocoon production, in particular to application of inhibiting expression of a gene shown in SEQ ID NO.1 in silkworm breeding or silkworm cocoon production, cultivating a special silkworm variety for silk floss production, improving the thickness of a silkworm cocoon layer and the whole cocoon quantity of the silkworm cocoon, improving the silk yield of the silkworm cocoon and improving the content of silk fibroin protein in cocoon silk fibers. The invention obviously promotes the development of the rear silk gland by inhibiting the expression of the Period gene of the silkworm, obviously increases the content proportion of silk fibroin in silk fibers while improving the output of the silkworm cocoons, effectively improves the silk yield of the dry cocoons, and can also stably change the shape of cocoons grown by mature larvae of the silkworm.

Description

Application of silkworm Period gene in silkworm breeding and silkworm cocoon production

Technical Field

The invention relates to the technical field of silkworm breeding, in particular to application of a silkworm Period gene in silkworm breeding and silkworm cocoon production.

Background

Silkworm raising production for raising silkworm (Bombyx mori) to produce silkworm cocoons and silk weaving production for processing silkworm cocoon silk are traditional and dominant industries in China. More than 98% of cocoon filaments of silkworms are proteins, including fibrous protein silk fibroin and non-fibrous protein sericin. Cocoon silk proteins are synthesized by silk gland tissues with particularly developed larval stages, secreted and stored in gland cavities of silk glands, wherein sericin proteins are completely synthesized by middle silk gland cells, while silk fibroin proteins are mostly synthesized by rear silk gland cells, and a small amount is synthesized by the posterior region of the middle silk gland. Silk fibroin in the gland cavity of the rear silk gland of mature silkworm larvae slowly moves to the middle silk gland by using high-concentration aqueous solution colloid in a metastable state of protein polymers, and after entering the middle silk gland, the surface is gradually surrounded by sericin protein aqueous solution. Silk fibroin moving in the middle silk gland cavity, the water loss and the metal ion content change, and silk fibroin maturation changes such as the increase of molecular polymerization degree and specific viscosity of aqueous solution colloid appear; further, when the larvae mature and spin cocoons, the silk fibroin is pushed to the front silk gland with the diameter of the gland sharply reduced by the action of the intra-glandular pressure, and is subjected to silk fibroin fiber forming changes such as molecular fibrosis and finally is discharged outside the body through a silk squeezing area and a silk outlet, so that the silk fibroin becomes a fiber fibroin, namely the silk core of the cocoon silk, and the fiber outer layer is wrapped with water-soluble sericin proteins (Feng Lichun and the like, 2015). The water-soluble sericin proteins on the surfaces of silk fibers of the domestic cocoons are mutually adhered in the dehydration and drying processes, so that a tight cocoon shell is formed.

The main processing modes of domestic cocoons are two types, namely, the silk cocoons are processed into ultra-long fiber raw silk for silk weaving and the like through reeling, the other type is flocculent silk floss for being used or non-woven fabric materials and the like, and the processes and the technologies for processing the two types of products are that the tightly adhered cocoon shells of the cocoons are dissociated by utilizing sericin proteins of the cocoon silk fibers, the difference is that the raw silk production requires that the cocoons conform to the regular cocoon shape required by machine or manual silk reeling, the surface of the cocoon silk fibers has higher stable sericin content so as to ensure the high reelability rate of the cocoon silk fibers, and the sericin content on the surface of the cocoon silk fibers can have larger variation range in the silk floss processing process.

Whether raw silk or silk floss, the final product really needs only silk fibroin, and the sericin needs to be removed. The main purpose of silk floss is to produce silk floss quilt, and permeability and warmth retention taking fluffiness as marks are the main performance requirements of silk floss. The production technology of textile engineering is to refine and degumm by high Wen Jianshui, fully remove sericin protein layer on the surface of cocoon silk fiber, and ensure the fiber bulkiness and comfort of silk floss. Therefore, in the cultivation process of silkworm varieties, the content of sericin protein in cocoon filaments is greatly reduced, the content of silk fibroin is improved, and the method is an effective way for improving the quality and the production efficiency of silk floss.

In recent years, the production and use amount of silk floss rapidly increases to be more than 35% of the production amount of domestic silk, and the demand for cultivating special silkworm varieties for silk floss production is also increasing continuously. The silk fiber of the conventional genetic mutant cotton cocoon silkworm genetic resource is reduced by 30% -50% compared with the conventional silkworm variety, but the serious degeneration or deformity of the middle silk gland has the prominent problems of the overall function degeneration of the silk gland and the low cocoon silk yield, so that the practical silkworm variety breeding success report of silkworm raising production does not exist yet. The sericin protein gene expression in the middle silk gland cells is knocked out or knocked down by genetic engineering means, so that the problems of silk gland development malformation, obvious reduction of cocoon silk yield, obvious reduction of individual vitality of silkworms and the like are commonly caused. Therefore, research discovers that a new mechanism for silk gland development or silk gland cell silk protein synthesis regulation is an effective way for developing a control technology for improving the relative content of silk fibroin and sericin of silk fibers of domestic cocoons and improving the quality and production efficiency of silk floss.

In a large number of biological species including bombyx mori, the reported function of the periodic gene (Period) is a core element of the transcriptional regulatory network of the biological clock. The reported functions of silkworm periodic genes (BmPeriod) have been focused on regulating circadian behaviors and physiology (Ikeda et al 2019;Sandrelli et al, 2007), and there has been no report of BmPeriod gene regulating tissue development. Therefore, the influence of the BmPeriod gene on silkworm silk gland development, silk protein synthesis, silk cocoon characters, silk spinning behavior and other silk cocoon production is identified, so that new understanding can be provided for silk cocoon production in the silkworm industry, and particularly, breeding materials and methods are provided for cultivating special silkworm varieties for silk floss product production which is rapidly developed.

Disclosure of Invention

In order to solve the technical problems, the invention provides a novel silkworm breeding method, which can obviously promote the development of a rear silk gland by changing the expression of a silkworm Period gene structure in a targeted manner, obviously increase the content proportion of silk fibroin in cocoon fibers while improving the cocoon yield, effectively improve the silk yield of dry cocoons and stably change the shape of cocoons grown by mature silkworm larvae.

The first object of the present invention is to provide an application of a silkworm Period gene (Bmperiod gene) shown in SEQ ID NO.1 in silkworm breeding, specifically, to inhibit the expression of the gene shown in SEQ ID NO.1 in silkworm breeding.

Further, the application of the substances for inhibiting BmPeriod genes in silkworm breeding.

Further, the breeding includes cultivating silkworm varieties for silk floss production. The invention can improve the weight relative ratio or the length relative ratio of the rear silk gland and the middle silk gland by targeting BmPeriod genes, inhibit the expression of BmPeriod genes or destroy the BmPeriod gene structure, remarkably improve the silk fibroin relative content of cocoon silk and improve the whole cocoon quantity and cocoon layer rate, and can be used for cultivating silkworm materials and varieties with high silk fibroin content, less sericin and high silk yield required by silk floss production in silkworm production.

Further, the method for cultivating the silkworm variety for silk floss production comprises the steps of constructing a recombinant expression vector for knocking out BmPeriod genes, transforming the recombinant expression vector into silkworm eggs, and breeding a target variety.

Preferably, the BmPeriod gene of the silkworm is knocked out to obtain a BmPeriod gene expression silencing mutant, the BmPeriod gene expression silencing mutant is used as a breeding material, the BmPeriod mutant gene is introduced into a middle line variety or a daily line variety of a practical high-yield silkworm variety hybrid combination or simultaneously introduced into the middle line variety and the daily line variety, and a high-yield silkworm cocoon production hybrid variety combination suitable for processing silk floss products is bred. In one embodiment of the invention, the medium variety is Su Yu and the daily variety is spring orange.

Further, methods of inhibiting the expression of the gene shown in SEQ ID NO.1 include, but are not limited to, gene mutation, gene silencing, and gene knockout.

Further, the method of gene knockout comprises the steps of: gene editing is carried out by using a CRISPR/Cas9 system, and BmPeriod genes are knocked out.

Further, the gene editing method is to select the sgRNA binding site according to the cDNA sequence of BmPeriod gene, synthesize the sgRNA sequence, mix the sgRNA with Cas9 protein and inject into silkworm eggs.

Further, the silkworm egg is a silkworm egg which is laid for 3-6 hours.

Further, the sequence of the sgRNA binding site is shown as SEQ ID NO.2 and SEQ ID NO. 3.

Further, the sgRNA sequences are shown as SEQ ID NO.4 and SEQ ID NO. 5.

The second object of the invention is to provide an application of the gene shown in SEQ ID NO.1 in the production of home cocoons, in particular to inhibit the expression of the gene shown in SEQ ID NO.1 when home cocoons are produced.

Further, the application of the substance inhibiting BmPeriod gene in the production of domestic cocoons.

Further, the cocoon layer thickness and/or the whole cocoon quantity of the cocoons are increased.

Further, the silk yield of the cocoons is improved.

Further, the silk fibroin content of the cocoon silk fiber of the silkworm cocoon is increased.

According to the invention, the weight coefficient of silk glands of mature larvae can be increased by inhibiting BmPeriod gene expression, the weight relative ratio or length relative ratio of the rear silk glands to the middle silk glands of the mature larvae is further increased, the silk fibroin protein content produced by the rear silk glands is increased while the silk cocoon yield is increased, and the silk fibroin protein content produced by the middle silk glands is reduced, so that the silk protein component proportion of silk cocoon fibers is regulated, and the silk yield is increased.

By means of the scheme, the invention has at least the following advantages:

compared with the silkworm cocoons produced by wild varieties, the silkworm cocoons produced by the BmPeriod gene knockout mutant silkworm have the advantages that the whole cocoon quantity is increased by 20%, the cocoon layer rate is increased by 25%, the cocoon layer thickness is increased by more than 1 time, the relative content of silk fibroin in cocoon silk fibers is increased by 5.8%, and the dry cocoon silk yield is increased by 19.0%.

The foregoing description is only an overview of the present invention, and is presented in terms of preferred embodiments of the present invention and the following detailed description of the invention in conjunction with the accompanying drawings.

Drawings

In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings.

FIG. 1 is a schematic structural diagram of silkworm BmPeriod gene and sgRNA Target (TS) sequence thereof;

FIG. 2 is a graph showing the results of gene mutation induced by CRISPR/Cas9 in accordance with the present invention;

FIG. 3 shows a BmPeriod gene knockout silkworm large homozygous strain BmPeriod ^-/- Differences from the cocoons of wild type large strain WT; wherein A is WT and BmPeriod ^-/- Is the contrast of cocoon layer thickness, B is WT and BmPeriod ^-/- The sizes of cocoons are compared;

FIG. 4 shows a BmPeriod gene knockout silkworm large homozygous strain BmPeriod ^-/- Comparing with the development status of wild type large strain WT; wherein A is WT and BmPeriod ^-/- Morphological development of 5-year-old larvae, B being WT and BmPeriod ^-/- Morphological development of pupa, C is WT and BmPeriod ^-/- Silk gland development.

Detailed Description

The present invention will be further described with reference to the accompanying drawings and specific examples, which are not intended to be limiting, so that those skilled in the art will better understand the invention and practice it.

EXAMPLE 1 CRISPR/Cas9 knockout vector construction of silkworm BmPeriod Gene

(1) Firstly, the invention selects 2 silkworm BmPeriod gene specific sgRNA recognition targets (SEQ ID NO.2 and SEQ ID NO. 3) and full-length sequences thereof (SEQ ID NO.4 and SEQ ID NO. 5) on the 6 th exon of the BmPeriod gene by utilizing a CRISPRdirect website (http:// crispr. Dbcls. Jp /) through a large number of selections and experiments. The nucleotide sequence of the BmPeriod gene is shown as SEQ ID NO. 1. The structural schematic diagram of the silkworm BmPeriod gene and the sgRNA target sequence are shown in figure 1.

The sgRNA recognition target sequences were as follows:

sgRNA1：5’-TCTCCAGCGCATGTACAGGT-3’(SEQ ID NO.2)

sgRNA2：5’-CACTGAAGGCGACAAGGTAG-3’(SEQ ID NO.3)

the full-length sgRNA sequence is as follows:

sgRNA1：

5’-GACCTGTACATGCGCTGGAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’(SEQ ID NO.4)

sgRNA2：

5’-GCACTGAAGGCGACAAGGTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’(SEQ ID NO.5)

(2) According to the two U6 post cleavage sites in the pBac-PXLU6 vector plasmid: nhel I and Sal I, and designing sgRNA homologous recombination primer with the primer sequence shown in SEQ ID NO. 6-SEQ ID NO. 9.

The sgRNA target sequence primers were as follows:

sgRNA-F1-NhelⅠ:

5’-TATCGTGCTCTACAAGTGGACCTGTACATGCGCTGGAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA-3’(SEQ ID NO.6)

sgRNA-F2-SalⅠ：

5’-TATCGTGCTCTACAAGTGGCACTGAAGGCGACAAGGTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA-3’(SEQ ID NO.7)

sgRNA-R-NhelⅠ：

5’-TAGATATCAAGCTGCTAGAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT-3’(SEQ ID NO.8)

sgRNA-R-SalⅠ：

5’-CTTATCGATACCGTCGAAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT-3’(SEQ ID NO.9)

(3) And (3) carrying out PCR reaction by using the sgRNA homologous recombination primer, and carrying out gel recovery from the separation electrophoresis gel of the PCR reaction product, wherein the sequences of the obtained PCR products are shown as SEQ ID NO.10 and SEQ ID NO. 11.

The sequences of the PCR homologous recombination products are as follows:

CE-sgRNA-NhelⅠ：

5’-TATCGTGCTCTACAAGTGGACCTGTACATGCGCTGGAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTCGACGGTATCGATAAG-3’(SEQ ID NO.10)

CE-sgRNA-SalⅠ：

5’-TATCGTGCTCTACAAGTGGCACTGAAGGCGACAAGGTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTCGACGGTATCGATAAG-3’(SEQ ID NO.11)

(4) Assembling target sequence sgRNA expression cassette to pBac-PXLU6 vector plasmid, taking ClonExpress rapid cloning recombination kit of Nanjinouzan biotechnology limited company as an example, carrying out homologous recombination on PCR product and digested pBac-PXLU6 vector plasmid by using the principle of homologous recombination, and obtaining recombinant vector plasmid sequencing verification for microinjection.

EXAMPLE 2 establishment of silkworm BmPeriod Gene knockout homozygous line

(1) Preparing silkworm eggs: the non-diapause eggs of the large silkworm breeds are obtained by a conventional low-temperature dark induced-hatching non-diapause egg production method. Collecting female moth spawning within 30min by using preservative film as egg attachment material, soaking in clean water for 20min, and gently washing off silkworm eggs. The silkworm eggs are rapidly collected, the full silkworm eggs in a wet state are orderly arranged on a sterilized glass slide, the filter paper is dried for 20min after water stains are absorbed, then the silkworm eggs are put into 3% formaldehyde aqueous emulsion for sterilization for 2min, and the silkworm eggs are dried for more than 20min after being washed by sterilized water for microinjection.

(2) The recombinant vector plasmid is introduced into silkworm eggs: the recombinant vector plasmid constructed in example 1 was introduced into a non-diapause silkworm egg in the cleavage stage. Taking an egg microinjection method for introducing recombinant vector plasmid as an example, injecting 5-10ng of recombinant vector plasmid into each egg at the age of 3-6 h, plugging an injection port of the injected silkworm egg by neutral glue, and placing the silkworm egg in a sterile artificial climate box for protection until hatching. The silkworm egg protection environment is high humidity relative humidity 80-90%, and 4% formaldehyde water solution is placed around the silkworm egg, and the silkworm egg is prevented from mildew by means of air naturally evaporated by formaldehyde, and ventilation is carried out for 5min every 12 h.

(3) Screening of BmPeriod Gene knockout mutant: and (3) breeding G0 generation larvae hatched in the microinjected silkworm eggs by using fresh mulberry leaves or artificial feed to obtain silkworm chrysalis after cocooning, and further obtaining the emerging adults. Mating the G0 generation adult with a wild type idiosyncratic adult, taking the heads of all the G0 generation silkworm moths to extract genome DNA after the female moths spawn, designing a specific detection primer for amplifying and sequencing the genome sequence of the editing position BmPeriod aiming at the sgRNA sequence of the BmPeriod gene, and screening the adult with the edited BmPeriod gene with lost function, wherein the detection primers are as follows:

BmPeriod-TS-R:5’-ACGATTGGCGATAGGGAAA-3’(SEQ ID NO.12)

BmPeriod-TS-F:5’-TTGGAAAAGTTTGTGGCTAATA-3’(SEQ ID NO.13)

and (3) carrying out secondary breeding on the selected G1 generation heterozygote eggs produced by the G0 generation BmPeriod gene knockout mutant adults and the wild adults, and carrying out individual selfing seed reserving in a moth region, and continuously detecting BmPeriod gene mutation and gene transcription and translation of the paired adults until BmPeriod gene knockout homozygous silkworms are obtained, wherein the mutation type is shown in figure 2.

(4) Silkworm cocoon observation of BmPeriod gene knockout homozygous line silkworm:

the homozygous line silkworms with the BmPeriod gene knocked out obtained by screening are bred under the same condition with wild silkworms, the forms of cocoons grown on mature larvae are obviously different, the result is shown in figure 3, the thickness of cocoon layers of cocoons grown on the homozygous line silkworms with the BmPeriod gene knocked out is obviously increased (figure 3A), and the cocoons are obviously enlarged (figure 3B).

The silk gland development in the larval stage and the morphological development of the larvae and pupae are observed, and the result is shown in figure 4, and the silk gland, the late stage 5 stage larvae and the morphological development of the silkworm pupae of the homozygous line silkworm mature larvae are normal without obvious difference from the wild type.

The following table 1 survey data system demonstrates the advantages and mechanisms of the BmPeriod gene knockout mutant of example 2 to produce cocoons for silk floss. The coefficient of mature silk gland shows that the weight of the rear silk gland of the mutant is obviously increased, the weight percentage of the whole silk gland is obviously increased compared with that of a wild type, the cocoon weight and the cocoon layer rate (the weight percentage of cocoon silk) of the produced silk gland of the mutant are further improved by 20 percent and 25 percent respectively compared with that of the wild type, the better developed rear silk gland enhances the synthesis capacity of silk fibroin, the relative content of silk fibroin to sericin is obviously improved, the reduction of the proportion of sericin leads to the reduction of cocoon silk adhesion of the silk cocoons, the further increase of the cocoon layer thickness by more than 1 time is caused, and the increase of the cocoon layer rate and the silk fibroin proportion leads to the increase of the silk floss yield of silk cocoons produced by more than 19 percent.

TABLE 1

Note that: the surface cocoon silk investigates 30 cocoons from female and male samples.

Example 3 selection of silkworm BmPeriod Gene mutant hybrid for Silk floss production

(1) Preparing a silkworm BmPeriod gene knockout mutant according to the method of the embodiment 1 and the embodiment 2, mating female moths of BmPeriod gene knockout mutant homozygotes serving as female parents with spring orange male moths of yellow cocoon-forming binary practical hybridization combination Su Yu spring oranges to obtain H1 generation silkworm eggs, breeding larvae hatched in the H1 generation silkworm eggs by a single moth breeding method, and mating in a moth area by taking a low cocoon layer compactness and thick cocoon layer as indexes, preferably 10% of moth areas and 10% of individuals with high cocoon silk quantity in the selected moth areas to obtain H2 generation silkworm eggs;

(2) Feeding H2 generation larvae by a single moth breeding method, sampling silkworm eggs in embryo development to a green-turning stage, detecting single egg DNA by a BmPeriod gene knockout mutant screening step in the embodiment 2, estimating the BmPeriod gene mutation rate of the silkworm eggs in a moth area, feeding the larvae hatched in the silkworm eggs in the moth area with the mutation rate of more than 90%, and carrying out mating in the moth area by taking low cocoon tightness and thick cocoon layers as indexes, preferably 10% of the moth area and 10% of individuals with high cocoon silk quantity in the selected moth area to obtain H3 generation silkworm eggs;

(3) Breeding larva hatched in H3 generation silkworm eggs by using the ant in the moth area, and backcrossing female individuals with low tightness of cocoon layer and thick cocoon layer, preferably 10% of moth area and 10% of high cocoon silk content in the selected moth area with spring orange male moth used in the step (1), and oviposition by single moth to obtain H4 generation silkworm eggs;

(4) Raising larvae hatched in the H4 generation silkworm eggs by a single moth breeding method, repeating the steps (1) to (3) for 2 times, and selecting and reserving the moth areas and individuals and mating the larvae to obtain the H10 generation silkworm eggs, namely obtaining the practical Japanese system dedicated stock spring orange P of the mutation homozygous yellow cocoons of BmPeriod genes used for silk floss production;

(5) Obtaining a practical Chinese system special stock Su Yu P of yellow cocoons of mutation homozygous type of BmPeriod genes used in silk floss production according to the methods from the step (1) to the step (4);

(6) Su Yu P was crossed with spring orange P to produce Su Yu P.times.spring orange P first-generation hybrid, the main properties of which are shown in Table 1.

By using the method of the embodiment 3 of the invention, the high combining force and excellent cocoon silk production performance of Su Yu spring orange hybridization combination of a practical variety produced by yellow cocoons in the silkworm industry can be utilized, and BmPeriod mutant genes of large mutant can be introduced into Chinese system Su Yu and Japanese system spring oranges to cultivate first-generation hybrid seeds with low sericin content and high silk fibroin content for production of silkworms.

By using the method of the embodiment 3 of the invention, cocoon silk quality such as cocoon silk fineness, purity and strength of the large mutant can be quickly and directionally modified, the cocoon silk yield can be improved, and the requirements of practical varieties can be met.

The advantages of the Su Yu P.times.spring orange P-generation hybrid bred in example 3 as silk floss production are shown in Table 2 below.

TABLE 2

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations and modifications of the present invention will be apparent to those of ordinary skill in the art in light of the foregoing description. It is not necessary here nor is it exhaustive of all embodiments. And obvious variations or modifications thereof are contemplated as falling within the scope of the present invention.

Sequence listing

<110> Nantong textile Silk industry technical institute, university of Suzhou

Application of <120> silkworm Period gene in silkworm breeding and silkworm cocoon production

<140> 2022102108320

<141> 2022-03-03

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3327

<212> DNA

<213> (Artificial sequence)

<400> 1

atggataacc ttgaaaactc tgagaacact gacaaaatat cagattcggc atactcaaac 60

agctgcagtt acagtcaatc aagaagaagt cacagctcaa aatctactca ttccgggagt 120

tattctagcg gcagtagcgg atacggaggt cgacatgtta ctggcactaa cagtaataag 180

ttggctcagt caccaaataa agataaagag ttaaagaaaa agaaacaatc acaaacagag 240

ctaacgacta ccaaagaaca aaatgaagga gaaagcggac ctcaagaatc tgtgaacctg 300

gaaactctag aggaggagaa gcatgatgtt acgagcgcac cctctccagc gcatgtacag 360

gtcgagaagg gacctgagaa tatggatata gcttcaacag acactgaagg cgacaaggta 420

gaggttttat cgtgtgacct gcaaccgcag aactctactg tcgatgtagt tacgagtcgt 480

tcgaatctaa tctgttacac tgatggattt tcatgcgtta tatcgatgca cgatggaatc 540

gtaatgtaca cgacatcatc gctgacggct acactcggtt tcccgaagga catgtggatc 600

gggaggtcat ttatcgattt cgttcatcca agggaccgta gcacgttcgc gtcacagata 660

accagtggtt tggccgtccc gaaaactgca aacggtacgc aagaaaaagc tcaatcgccg 720

ggtaattctg gatcgactat ggtgtgtcgg ataagacgtt acagaggtct gagcacgggg 780

ttcggagtta aggaaagagt ggtcacgttc atgccgttcc ttttgaaatt cacgttcaag 840

aacataagcg atgaagaggg aaatgtcatc tacctcgtca tacaggccac accatttttt 900

tcagcgttca aaacgtcgtt tgaaatatta ccgaaagtta atcctttcgt gatgcgtcac 960

tccgcgaatg gtaatctcga gtacttagac ccagaatctg taccttatct cggatattta 1020

cctcaagatg tccaagacaa ggacgcattg caactctatc atccggaaga tttggaatac 1080

ctccagcaag tatacgaggt aatcgttaag gatggtggca tgccgcgttc caaaacttac 1140

agaatgatga cacaaaacgg tgattacata aaaatcgaaa ccgaatggtc ttcgtttatt 1200

aatccttggt cgaagaagct ggaattcgtc atcgggaaac attacatcat tgaaggcccc 1260

gagaatccag atgtattcca gtcccaagat ccggagaaac atacaaaatt atgcgacgaa 1320

caaataaaaa agtccatggt atttcgcgag aatatcgtta aacttatgaa tgaggctcta 1380

acgaaaccag cggaagttgc caaacagcaa atgagcaagc gttgccagga cttagcgtcg 1440

ttcatggaga gcctcatgga ggaaccaccg aaaaatgacg aggaattacg cctagaaata 1500

caggatccgg accacagtta ttatgagcgt gattcggtaa tgctcggcgg gatatctccc 1560

catcacgact acaatgacag caaatcaagc acagaaacac cgctgagtta taatcaacta 1620

aactataacg agacattaca aagatatttc gacagtcatg aacccttttc gagcgagaac 1680

ttcaatccct tgattgtggc aaaggagcca aataatttaa aatcgatact aagtacttgt 1740

ttatcaccaa tggctcagaa ctctggcgat tcgaccgagt tgaatagttc gtccgattct 1800

agtagtatgg ccctgggagg agtaagtcct gtgggtatat taggcgacta ccaccacgtt 1860

cggctcaccg agttcctact aaccaaacac aatgatgaaa tggaaaagga actgataaat 1920

atgcatagag agagccggtc caatagtaaa ggagaaagag ataagacatc taacgaaacg 1980

agacagaaga aaaaggaaca tctagcgagg tgtaaagctt cgtttcatcc aaccgcgacc 2040

agcaccacac ctgtggacaa agaagtgtat aaaaaacctc acggtgtcaa acgtgcttcg 2100

aaacatatcg aaacggaaac tgtatcgcac aaataccatt gtccatcgcc cagagcgtct 2160

agacctaggc aaaccaccag tgcggcgcct gtacaaactt cgtccacttt gactacttct 2220

gttgcctcga ctacctggcc acccagcacc aatgctgctg gaaatatgaa cacattcata 2280

ctaggagtcg gaatggctcc acagatgtcc cttataagtc cggttccgcc aatggcagga 2340

atgcttccgt tgtattacac tccgatggcc acaatggctc ccgtgccttc cacatcggag 2400

gccgcgaacc atcaaaatct tcataataat ccacagcagt atgctccacc tccaatgcaa 2460

tgtgtattgt acggtcagcc tatatacggt cagccgatgt acagttcgcc gttcgtgtac 2520

tcaccaatga acccgcacac taactatcct atgcaacaga ccacgccgca accgaatgct 2580

cagttcacac ccacaaacac aatgaatccc ttgtgtttgg ccaatagcaa ctatgaagag 2640

agaacagaag cagggcatgc cacaacgcca tctaaagaca ttaagaaaac gagcaggttg 2700

ggtaacaccg aggaggttgt agacaaaact gacggagaat ctagctattc ctcgttttac 2760

tcgtcgtttt tcaagacgga atctggcagc gcggaagaga gtggcgaaag caagaaaagg 2820

gacacaagaa atcacgtcaa attttgggat aaaaactatc gtggcgacga tgggatggcg 2880

atgcctggtt caacggaggt ccgccaaact ttttccgatc accatattcc agcgaaggta 2940

cccagacgaa acattgaacc accatggatg gagcaggtat gcctgacgtc agagctcgtc 3000

tacaattacc agataaggac aaaaacaatg gaggaagtac tttcatctga caagcagaag 3060

attagtaacc ttgagcagcc gtcactagtg aacgagcaac ttggtcagct gtacctggac 3120

cttcagttgg aaggtgtcgc cgcgcgactc accctcgagg agggtatcac cagttccagc 3180

agttccggtg aagagacaac aacctcgtcc aagaggaaac gggaatacag caaattggtt 3240

atgatatatg aagagaacgc tcccttccca cctccccctt ctgaagagat acaagagata 3300

ccgacagcca atcagtccga gtcctag 3327

<210> 2

<211> 20

<212> DNA

<213> (Artificial sequence)

<400> 2

tctccagcgc atgtacaggt 20

<210> 3

<211> 20

<212> DNA

<213> (Artificial sequence)

<400> 3

cactgaaggc gacaaggtag 20

<210> 4

<211> 101

<212> DNA

<213> (Artificial sequence)

<400> 4

gacctgtaca tgcgctggag agttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt t 101

<210> 5

<211> 101

<212> DNA

<213> (Artificial sequence)

<400> 5

gcactgaagg cgacaaggta ggttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt t 101

<210> 6

<211> 71

<212> DNA

<213> (Artificial sequence)

<400> 6

tatcgtgctc tacaagtgga cctgtacatg cgctggagag ttttagagct agaaatagca 60

agttaaaata a 71

<210> 7

<211> 71

<212> DNA

<213> (Artificial sequence)

<400> 7

tatcgtgctc tacaagtggc actgaaggcg acaaggtagg ttttagagct agaaatagca 60

agttaaaata a 71

<210> 8

<211> 91

<212> DNA

<213> (Artificial sequence)

<400> 8

tagatatcaa gctgctagaa aaaaaagcac cgactcggtg ccactttttc aagttgataa 60

cggactagcc ttattttaac ttgctatttc t 91

<210> 9

<211> 90

<212> DNA

<213> (Artificial sequence)

<400> 9

cttatcgata ccgtcgaaaa aaaaagcacc gactcggtgc cactttttca agttgataac 60

ggactagcct tattttaact tgctatttct 90

<210> 10

<211> 140

<212> DNA

<213> (Artificial sequence)

<400> 10

tatcgtgctc tacaagtgga cctgtacatg cgctggagag ttttagagct agaaatagca 60

agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt 120

ttttcgacgg tatcgataag 140

<210> 11

<211> 140

<212> DNA

<213> (Artificial sequence)

<400> 11

tatcgtgctc tacaagtggc actgaaggcg acaaggtagg ttttagagct agaaatagca 60

agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt 120

ttttcgacgg tatcgataag 140

<210> 12

<211> 19

<212> DNA

<213> (Artificial sequence)

<400> 12

acgattggcg atagggaaa 19

<210> 13

<211> 22

<212> DNA

<213> (Artificial sequence)

<400> 13

ttggaaaagt ttgtggctaa ta 22

Claims

1. The application of the method for knocking out the Period gene of the silkworm in the breeding of the silkworm is characterized in that: the application comprises inhibiting the expression of the silkworm Period gene during silkworm breeding, wherein,

the silkworm Period gene sequence is shown as SEQ ID NO.1, the breeding comprises cultivating a silkworm variety for silk floss production, and the gene knockout comprises the following steps: adopting a CRISPR/Cas9 system, selecting an sgRNA binding site according to the cDNA sequence of a silkworm Period gene, synthesizing an sgRNA sequence, mixing the sgRNA and the Cas9 protein, and injecting the mixture into silkworm eggs; wherein the sequence of the sgRNA binding site is shown as SEQ ID NO.2 and SEQ ID NO.3, and the sequence of the sgRNA is shown as SEQ ID NO.4 and SEQ ID NO. 5.

2. The use according to claim 1, characterized in that: the cultivation of the silkworm variety for silk floss production comprises the steps of constructing a recombinant expression vector for knocking out the gene shown in SEQ ID NO.1, transforming the recombinant expression vector into silkworm eggs, and breeding a target variety.

3. The use according to claim 2, characterized in that: knocking out the gene shown in SEQ ID NO.1 to obtain a gene expression silencing mutant, taking the gene expression silencing mutant as a breeding material, introducing the mutant gene into a hybrid combined intermediate line variety or a hybrid combined daily line variety or simultaneously introducing the intermediate line variety and the daily line variety, and breeding to obtain a dominant variety.

4. The application of the method for knocking out the silkworm Period gene in the production of silkworm cocoons is characterized in that: the application comprises inhibiting the expression of silkworm Period gene during the production of silkworm cocoons, wherein,

5. The use according to claim 4, characterized in that: the silkworm cocoon with the Period gene knocked out is increased in thickness and/or whole cocoon quantity compared with the wild silkworm cocoon.

6. The use according to claim 4, characterized in that: the silk yield of the silkworm cocoons with the Period gene knocked out is improved compared with that of wild silkworm cocoons.

7. The use according to claim 4, characterized in that: the content of silk fibroin in the cocoon fiber of the silkworm cocoon subjected to Period gene knockout is improved compared with that of the wild silkworm cocoon.