CN114410489B

CN114410489B - Wilkham yeast CAP5 strain with abnormal condition and application thereof

Info

Publication number: CN114410489B
Application number: CN202111676824.7A
Authority: CN
Inventors: 秦世雯; 索玉凯; 何飞飞; 张树竹; 铁丽萍; 高晶
Original assignee: Yunnan University YNU
Current assignee: Yunnan University YNU
Priority date: 2021-12-31
Filing date: 2021-12-31
Publication date: 2023-06-23
Anticipated expiration: 2041-12-31
Also published as: CN114410489A

Abstract

The invention discloses an abnormal Wickettsia (Wickerhamycesanomalus) CAP5 strain and application thereof. The CAP5 strain of the present invention was deposited at the microorganism strain collection, canon province, at 2021, 8/4, under the accession number GDMCC No:61857. the CAP5 strain has good acid resistance and pectinase activity, and the produced pectinase has high activity, and can be used in the production of pectinase or in the biological degumming process of small coffee and the like. In addition, the CAP5 strain has high ethanol yield and can be used in the fermentation production of ethanol; the combination of pectase activity of the fruit wine can also be used for brewing fruit wine.

Description

Wilkham yeast CAP5 strain with abnormal condition and application thereof

Technical Field

The invention belongs to the technical field of microorganisms. More particularly relates to an abnormal Wilkamella strain CAP5 and application thereof.

Background

The small-grain coffee (Coffeaaica L.) is one of important high-altitude special advantage industries in Yunnan province, and has important significance for promoting ecological protection and green development in border areas and enriching agricultural production varieties in border areas. The primary processing mode of Yunnan small-grain coffee is mainly a wet processing method, wherein a fermentation degumming link has the highest technical requirements, the most complex process and the easiest occurrence of problems, the link is closely related to the quality of coffee commodity beans, and the quality of degumming directly influences the storage effect and specific flavor of coffee, thereby influencing the profit of the coffee industry.

At present, the fermentation degumming link of the small-grain coffee mainly adopts natural fermentation degumming, and physical degumming is also popularized and applied. Wherein, the natural fermentation degumming is to peel coffee and then put the coffee into a fermentation tank, and water is used as a medium for natural fermentation; however, the natural fermentation degumming period is long, the fermentation process is influenced by coffee variety, fermentation quantity, fresh coffee fruit maturity, air temperature and the like, the degumming process is not easy to control, the degumming is easy to be incomplete or the fermentation time is too long, so that the quality of the coffee is reduced due to the over-acid taste of the coffee, microorganisms in the natural fermentation process are not screened, the variety is various, and pollutants produced in the microorganism metabolism process also easily influence the quality of the coffee. The physical degumming is to clean fresh coffee fruits after peeling, and continuously rub the coffee beans in the cleaning process to achieve the degumming purpose; however, physical degumming is easy to cause incomplete degumming, and coffee beans are easy to undergo secondary fermentation, so that the quality and the storage period of the coffee beans are seriously affected. Biological degumming is to inoculate the selected degumming strain onto dehulled coffee beans, and decompose colloid by utilizing enzymes secreted by the strain; or degumming by adding enzyme preparation. Compared with natural fermentation, the biological degumming process is easy to control, and toxic and harmful substances are not generated in the process, so that the method has the advantages of being green, environment-friendly, high in efficiency and the like.

For example, in the Chinese patent' an enzyme preparation and a method for degumming fresh coffee, degumming is performed by using an enzyme preparation consisting of pectin esterase, pectin lyase and polygalacturonase, so that the degumming efficiency of coffee beans is improved, the mildew rate of the coffee beans is reduced, the quality of the coffee beans is improved, and meanwhile, the water consumption is reduced, so that the method is more environment-friendly. However, there are few reports about the degumming strains of coffee, and practical application is also in the experimental demonstration stage, so that more strains for degumming need to be developed, and development of biological degumming technology of coffee is promoted.

Wickenhamella anomala (Wickerhamnomycesanomalus) is a relatively common aroma-producing yeast. The Chinese patent discloses a strain of yeast for decomposing pectin and application thereof, namely the strain of yeast for decomposing pectin, namely Wick ham yeast, which is only subjected to qualitative experiments, has low yields of pectase and ethanol and is not suitable for the production of pectase and ethanol.

Disclosure of Invention

The invention aims to overcome the defects and the shortcomings of the prior art and provide an abnormal Wickettsia (Wickettsia anomala) CAP5 strain and application thereof.

The first object of the present invention is to provide a Wickettsia anomala (Wickettsia anomala) CAP5 strain.

It is a second object of the present invention to provide a microbial preparation.

A third object of the invention is to provide the use of said CAP5 strain in biological degumming.

It is a fourth object of the present invention to provide the use of said CAP5 strain for the preparation of pectase.

It is a fifth object of the present invention to provide the use of said CAP5 strain for the production of ethanol.

A sixth object of the invention is to provide the use of said CAP5 strain in the production of fruit wine.

The above object of the present invention is achieved by the following technical scheme:

a strain of wilhelminth yeast (wickermophila) CAP5 deposited at the collection of microbiological strains (GDMCC) in the cantonese province at day 8 and 4 of 2021, deposited at the institute of microbiological culture, university of cantonese province (No. 100 in the first middle, vietnamese, cantonese province) under the accession number GDMCC No:61857; the ITS sequence of the CAP5 strain is shown as SEQ ID NO. 1.

The Wickettsia anomala (Wickettsia anomala) CAP5 strain is separated from a fermentation liquid of Coffeaaica L in Yunnan province, and can not only produce pectase to decompose pectin, but also produce pectase with high activity which is up to 411.45U/mL, and can be used for producing pectase or for biological degumming processes of small coffee and the like. In addition, the CAP5 strain can also ferment to produce ethanol, the highest ethanol yield can reach 127.23g/L, and the CAP5 strain can be used in the fermentation production of ethanol, and can also be used in the brewing of fruit wine by combining with the pectase activity of the CAP5 strain. Accordingly, the present application protects the following applications:

the application of the CAP5 strain in biological degumming, especially coffee biological degumming, is protected.

The invention discloses application of CAP5 strain in preparing pectase.

The invention discloses application of CAP5 strain in preparing ethanol.

The invention discloses application of CAP5 strain in fruit wine production.

Specifically, the method for preparing pectase comprises the following steps: inoculating CAP5 strain into fermentation medium containing pectin for fermentation culture.

Specifically, the components and the content in the fermentation medium are as follows: mgSO (MgSO) ₄ 0.3g/L，K ₂ HPO ₄ 0.4g/L, KCl:0.3g/L, 0.5% -2.5% (w/v) peptone, mn ²⁺ 1 to 2.5mmoL/L,1 to 1.5% (w/v) pectin.

Preferably, the fermentation medium contains 1% (w/v) pectin, see example 4.

Preferably, the fermentation medium contains 2.5% (w/v) peptone, see example 4.

Preferably, the fermentation medium contains 2mmoL/L Mn ²⁺ See example 4.

Specifically, the culture temperature of the fermentation culture is 28 ℃, the culture time is 30-42 h, and the fermentation pH is 5-8.

Preferably, the incubation time is 36h, see example 4.

Preferably, the fermentation pH is 6.0, see example 4.

More preferably, the fermentation medium contains MgSO ₄ 0.3g/L，K ₂ HPO ₄ 0.4g/L, KCl:0.3g/L, peptone 21.6g/L, mn ²⁺ 1.5mmoL/L, carbon source: 1% (w/v) pectin, see example 4.

More preferably, the fermentation temperature of the fermentation culture is 28 ℃; fermenting to pH 4.32; the fermentation time was 30h, see example 4.

Specifically, the method for preparing ethanol comprises the following steps: the CAP5 strain was inoculated into ethanol fermentation medium for liquid fermentation culture. .

Specifically, the ethanol fermentation medium comprises the following components in percentage by weight: 3% (w/v) soy flour, 25% (v/v) glucose.

Specifically, in preparing an ethanol fermentation medium, a glucose solution having a concentration of 600g/L was prepared and then added to the medium in a volume ratio, see example 6.

Specifically, the culture temperature of the fermentation culture is 28-32 ℃ and the culture time is 60-84 h.

Preferably, the incubation temperature is 28℃as described in example 6.

Preferably, the incubation time is 72 hours, see example 6.

The invention also provides a microbial preparation, which contains the Wicke Han's yeast CAP5 strain or fermentation broth thereof.

The invention has the following beneficial effects:

the invention provides a Wickettsia anomala (Wickettsia anomala) CAP5 strain which is deposited in the microorganism strain deposit center of Guangdong province at 8-4 days of 2021, and has a strain deposit number of GDMCC No:61857. the Wilkham yeast CAP5 strain has good acid resistance and pectinase activity, can degrade pectin, and has high pectinase activity, can produce a large amount of ethanol in fermentation, and has high ethanol yield. Therefore, the CAP5 strain can be used for producing pectase or used in biological degumming process of small-grain coffee, etc., shortening degumming time, improving quality of coffee commercial beans, and also can be used for producing ethanol and brewing fruit wine.

Drawings

FIG. 1 is a bromophenol blue staining pattern of the Wilkham yeast CAP5 strain.

FIG. 2 is a colony morphology of the Wilkham yeast CAP5 strain.

FIG. 3 is a microstructure of the Wilkham's yeast CAP5 strain, which was magnified 400 times under an optical microscope.

FIG. 4 is an electrophoretogram of the ITS sequence of the Wilkamella anomala CAP5 strain.

FIG. 5 is a phylogenetic tree of the Wilkham yeast CAP5 strain, which is based on the ITS-rDNA sequence.

FIG. 6 shows pectase activity of the Wikipedia anomala CAP5 strain at various pectin concentrations.

FIG. 7 shows pectase activity of the Wilkamella anomala CAP5 strain at various fermentation times.

FIG. 8 shows pectase activity of the Wikipedia anomala CAP5 strain at various fermentation pH conditions.

FIG. 9 shows pectase activity of the Wikipedia anomala CAP5 strain under different nitrogen source conditions.

FIG. 10 shows pectase activity of the Wilkinsonii CAP5 strain at various nitrogen source additions.

FIG. 11 shows pectase activity of the Wikipedia anomala CAP5 strain under various ionic conditions.

FIG. 12 shows the Mn of the steel ²⁺ Pectinase activity of Wilkham yeast CAP5 strain at concentration.

FIG. 13 is a graph of ethanol vapor phase standard curve.

FIG. 14 shows ethanol production by the Wilkinsonii CAP5 strain at various sugar concentrations.

FIG. 15 shows ethanol production by Wilkamella anomala CAP5 strain at various fermentation times.

FIG. 16 shows ethanol production by Wilkamella anomala CAP5 strain at various fermentation temperatures.

FIG. 17 shows ethanol production by Wilkinsonii CAP5 strain under different nitrogen source conditions.

FIG. 18 shows the results of acid resistance analysis of Wilkham's yeast strain CAP 5.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

EXAMPLE 1 isolation and purification of strains

And (3) separating pectin degrading bacteria in the Yunnan small-particle coffee (Coffeaaica L.) fermentation broth by using a flat plate dilution coating separation method. The specific process is as follows:

filtering the fermentation broth with six layers of gauze, and filtering the filtrate for 10 times ⁰ 、10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 Gradient dilution was performed by plating 100. Mu.L of each dilution in different dilution concentrations into the primary screening medium, 3 replicates per gradient, and blank plates without filtrate inoculation were used as controls. Culturing at 28 deg.c for 4-5 d until colony grows out, observing colony morphology, picking single colony with different morphology, inoculating to PDA culture medium for 3-4 d purification culture, serial number after 3 times continuous purification, and preserving strain with glycerin process.

The primary screening medium and PDA medium are shown below, respectively:

primary screening of the culture medium: pectin 2g, K ₂ HPO ₄ 1.0 g，MgSO ₄ 0.5 g，NaNO ₃ 3.0 g，FeSO ₄ 7H ₂ O0.01 g, agar 20g, ddH ₂ O is fixed to 1000mL. pH:5.5 Sterilizing at 121deg.C for 20min.

PDA medium: 200g of potato, and adding a proper amount of ddH ₂ O, boiling for 20min, filtering with four layers of gauze, adding glucose 20g, agar 20g, ddH ₂ O is fixed to 1000mL, pH is natural, and sterilization is carried out for 20min at 121 ℃.

EXAMPLE 2 screening of strains

(1) Primary screen

The invention adopts bromophenol blue method to screen the separated pectin degradation strain. The isolated and purified strain was inoculated on bromophenol blue agar medium containing pectin as the only carbon source, and after a period of incubation, the size of yellow transparent ring was observed, and 3 replicates were set. Culturing at 28 ℃ for 72 hours, measuring the diameter (D) of a transparent ring of a culture medium and the diameter (D) of a colony, and primarily judging the degumming capability of the strain. The strains with large D/D ratio are selected for the next re-screening test.

The invention separates and screens the strain CAP5 with strong pectin degradation capability through bromophenol blue agar medium (see figure 1). As can be seen from FIG. 1, a clear transparent ring appeared around CAP5 colonies, followed by liquid shake flask fermentation of CAP5 strain, followed by crude enzyme activity assay.

(2) Crude enzyme activity assay

Inoculating CAP5 strain on YPD culture medium, culturing at 28deg.C for 1-2 d until single colony grows, picking single colony, placing into 50mL conical flask containing 25mLYPD liquid culture medium, and shake culturing at 28deg.C under 150r/min for 24h to obtain seed solution. 100 mu L of seed liquid is inoculated into 150mL of fermentation medium for fermentation culture, after 48h of shaking culture at 28 ℃ and 150r/min, centrifugation is carried out at 4 ℃ and 8000r/min for 15min, and the obtained supernatant is crude enzyme liquid. The supernatant is sucked and properly diluted, and the pectase activity of the diluted crude enzyme solution is measured by adopting a DNS method.

YPD medium: peptone 20g, yeast extract 10g, glucose 200g, ddH ₂ O constant volume to 1000mL, pH:5.5 Sterilizing at 121deg.C for 20min.

Fermentation medium: pectin 5g, peptone 5g, KCl 1g, K ₂ HPO ₄ 1 g，KH ₂ PO ₄ 0.5 g，MgSO ₄ 1.0 g，ddH ₂ O constant volume to 1000mL, pH:5.5 Sterilizing at 121deg.C for 20min.

Determination of pectase Activity

0.75mL of substrate buffer solution with the concentration of 10mg/mL is sucked into a 2mL EP tube, 0.25mL of crude enzyme solution is added, the mixture is uniformly mixed, the water bath reaction is carried out for 15min at the temperature of 30 ℃, 500 mu L of reaction solution is taken out, 400 mu LDNS is added for stopping the reaction, the reaction is placed into boiling water for boiling for 5min, and then the reaction solution is rapidly cooled by flowing water. The absorbance was measured at a wavelength of 540nm using the inactivated crude enzyme solution as a control.

Definition of pectase activity: the ability of 1mL of enzyme solution to hydrolyze pectin substrate to 1. Mu. Mol galacturonic acid per minute at reaction conditions of 30deg.C and pH 5.0 is defined as 1 enzyme activity unit (U).

Enzyme activity (U/mL): (A1-A0) ×1000×N/0.25×K×T

A1: OD540 values of experimental groups; a0: OD540 value of control group; 1000:1mg = 1000 μg;0.25: diluted enzyme liquid volume (mL) used in enzyme activity measurement; k: slope of galacturonic acid standard curve; t: reaction time (min); n: dilution factor of supernatant

The PG activity of CAP5 strain was determined to be 185.46U/mL.

EXAMPLE 3 identification of CAP5 Strain

(1) Morphological identification

The pure culture of CAP5 strain was inoculated on YPD medium, and after 48 hours, the morphological characteristics of the pure culture on the medium were observed, and the results are shown in FIG. 2; this was observed under an optical microscope at 400 x magnification, and the results are shown in fig. 3.

As can be seen from FIG. 2, the colony of the CAP5 strain of the invention is dome-shaped, white, smooth and opaque in surface, and has a clean edge and a sticky shape; as can be seen from FIG. 3, the CAP5 strain has a circular or oval microstructure, which is budding. In addition, CAP5 strain produced an alcoholic aroma during the culture, presumably the strain was a Wickeham yeast strain.

(2) Molecular biological identification

The genomic DNA of CAP5 strain was extracted using a fungal DNA extraction kit, and ITS ITS sequences were amplified using ITS amplification primers as follows:

forward primer ITS3:5'-GATGAAGAACGYAGYRAA-3'

Reverse primer ITS4:5'-TCCTCCGCTTATTGATATGC-3'

The PCR reaction system is as follows: 2 XPCR Buffer 25. Mu.L, 2mM dNTPs 10. Mu.L, 10pmoL/mL ITS 3.5. Mu.L, 10pmoL/mL ITS 4.5. Mu.L, KOD FX (1.0U/. Mu.L) 1.0. Mu. L, DNA 2.0. Mu. L, ddH ₂ O 9μL；

The PCR amplification procedure was: pre-denaturation at 94 ℃ for 5min, denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 30s, extension at 68 ℃ for 30s, total 35 cycles, and extension at 68 ℃ for 5min;

the PCR amplification product was examined by 1% agarose gel electrophoresis, and the result is shown in FIG. 4. As can be seen from FIG. 4, the size of the amplification product was consistent with the expected size. And (3) after the amplification products are recovered in a clean way, sequencing the amplification products and constructing a phylogenetic tree by using the amplification products of the COX in the Optimachiatry of the Optimachiaceae.

The ITS sequence of CAP5 strain is shown below (SEQ ID NO. 1):

TATGGATCTATTGCAGCGCTTATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGCATCAGCCTAGCTGCGTGCCCAAAGGTCTAAACACATTTTTTTTAATGTTAAAACCTTTAACCAATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAATGTATTAGGTTCTTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGT AGGACTACCCGCTGAACTT

BLAST homology comparison and analysis are carried out on the ITS sequence of the CAP5 strain and the ITS sequence of the known strain in NCBI database, and the result shows that the strain has more than 98 percent of similarity with the ITS sequences of other multi-strain Wick ham yeast. To further confirm the relatedness and phylogenetic status of CAP5 strain to known yeasts, the multiple sequences of CAP5 strain and related strains were aligned using MEGA X biology software to construct phylogenetic trees using the neighbor-joining method based on homology search results.

The phylogenetic tree constructed is shown in FIG. 5. As can be seen from the above experimental results, the CAP5 strain of the present invention is a Wickerham yeast (Wickerham yeast) CAP5 strain, which was designated as Wickerham yeast (Wickerham yeast) and was deposited at the Cantonese institute of microorganism culture (GDMCC) on month 8 and 4 of 2021 at the national institute of microbiology (Mitsubishi, va. Of Cantonese, calif.) with a deposit address of 100.

Example 4 optimization of the fermentation Process by the CAP5 Strain

(1) Influence of pectin addition on pectase Activity

Fermentation media of different pectin contents were prepared with reference to example 2, wherein the pectin was added in a ratio of 0.5%, 1%, 1.5%, 2%, 2.5% and 3% (w/v). CAP5 strain is cultured in fermentation culture medium with different pectin content at 28deg.C under 150r/min shaking for 48 hr, and centrifuged at 4deg.C for 15min at 8000r/min, and the supernatant is used to measure pectase activity. Test methods refer to example 2.

The results of the pectase activity test of the CAP5 strain at different pectin addition amounts are shown in FIG. 6, and as can be seen from FIG. 6, the pectase activity of the CAP5 strain is highest and is 197.74U/mL when the pectin addition amount is 1% (w/v).

(2) Influence of fermentation time on pectase Activity

Preparing a fermentation medium with pectin addition amount of 1% (w/v) for fermenting CAP5 strain, taking fermentation liquor once when fermenting for 24 hours, taking the fermentation liquor once every 6 hours, placing the fermentation liquor in a refrigerator at 4 ℃ for temporary storage until the fermentation is stopped for 60 hours, respectively centrifuging all fermentation liquor, taking supernatant, and measuring pectase activity.

The detection results of pectase activity of CAP5 strain under different fermentation time are shown in FIG. 7, and as can be seen from FIG. 7, the pectase activity of CAP5 strain is highest and is 195.28U/mL when the fermentation time is 36 h.

(3) Influence of fermentation pH on pectase Activity

Preparing fermentation media with different pH values (3.0, 4.0, 5.0, 6.0, 7.0, 8.0 and 9.0) and pectin addition amount of 1% (w/v) to ferment CAP5 strain, fermenting at 28deg.C for 36h, collecting supernatant of fermentation liquor, and measuring pectase activity.

The detection results of the pectase activity of the CAP5 strain at different fermentation pH values are shown in FIG. 8, and as can be seen from FIG. 8, the pectase activity of the CAP5 strain is highest and is 218.01U/mL when the fermentation pH value is 6.0.

(4) Influence of Nitrogen Source on pectase Activity

Preparing a fermentation medium with pH of 6.0,1% (w/v) pectin, respectively selecting yeast powder, peptone, beef extract, ammonium sulfate and sodium nitrate as nitrogen sources to ferment the CAP5 strain, fermenting at 28deg.C for 36h, collecting the supernatant of the fermentation broth, and measuring pectase activity.

The detection results of the pectase activity of the CAP5 strain under different nitrogen source conditions are shown in FIG. 9, and as can be seen from FIG. 9, the pectase activity of the CAP5 strain is highest when peptone is taken as a nitrogen source, and is 269.59U/mL.

(5) Influence of the amount of Nitrogen Source added on the pectase Activity

Preparing a fermentation medium with pH of 6.0,1% (w/v) pectin, wherein the addition amounts of peptone are 0, 0.5%, 1%, 1.5%, 2%, 2.5% and 3% (w/v), fermenting CAP5 strain, fermenting at 28deg.C for 36h, collecting supernatant, and measuring pectase activity.

As shown in FIG. 10, the results of the pectase activity test of CAP5 strain at different peptone concentrations are shown in FIG. 10, and when the peptone addition amount is 2.5%, the pectase activity of CAP5 strain is the highest and is 288.63U/mL.

(6) Influence of ions on pectase Activity

Preparing fermentation medium with pH of 6.0,1% (w/v) pectin and 2.5% (w/v) peptone, and adding Zn respectively ²⁺ 、Al ³⁺ 、Cu ²⁺ 、Mn ²⁺ 、Fe ³⁺ 、Fe ²⁺ 、Ba ²⁺ Fermenting CAP5 strain, fermenting at 28deg.C for 36 hr, collecting supernatant, and measuring pectase activity.

The pectase activity of CAP5 strain under different ionic conditions is shown in FIG. 11, and it can be seen from FIG. 11 that when Mn is added ²⁺ When the CAP5 strain had the highest pectase activity, 303.42U/mL.

(7) Influence of the ion addition on the pectase Activity

Preparing fermentation medium with pH of 6.0,1% (w/v) pectin and 2.5% (w/v) peptone, adding Mn at different concentrations ²⁺ Fermentation of CAP5 Strain, mn ²⁺ The concentration of the pectin is 0, 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0mM/L in sequence, fermentation is carried out for 36 hours at 28 ℃, and the supernatant of the fermentation broth is taken to determine the pectase activity.

Different Mn ²⁺ The pectase activity of CAP5 strain at the concentration is shown in FIG. 12, and it can be seen from FIG. 12 that when Mn is added ²⁺ At 2mM/L, the pectase activity of CAP5 strain was highest and was 312.36U/mL.

Based on the experimental results, the invention optimizes the fermentation conditions of the CAP5 strain by a response surface method. The optimal fermentation scheme of CAP5 is shown by the optimization result:

fermentation medium: mgSO (MgSO) ₄ 0.3g/L，K ₂ HPO ₄ 0.4g/L, KCl:0.3g/L, peptone 21.6g/L, mn ²⁺ 1.5mmoL/L, carbon source: 1% (w/v) pectin;

fermentation conditions: the fermentation temperature is 28 ℃; fermenting pH 4.32; fermentation time: and 30h.

And the optimal fermentation scheme is adopted to ferment the CAP5 strain, and the activity of the obtained pectase is as high as 411.45U/mL.

Example 5 cultivation of CAP5 Strain and determination of ethanol production

(1) Culture of strains

CAP5 strain was cultured using YPD medium and its ethanol production was determined. Inoculating CAP5 strain to YPD solid culture medium, culturing at 28deg.C for 1-2 d until single colony grows, picking single colony, placing into 50mL conical flask containing 25mLYPD liquid culture medium, and shake culturing at 28deg.C under 150r/min for 24h to obtain seed solution. 100. Mu.L of the seed solution was inoculated into 150mL of YPD liquid medium, and after 48 hours of shaking culture at 28℃and 150r/min, the culture was centrifuged at 8000r/min at 4℃for 15 minutes, and the supernatant was collected.

(2) Ethanol gas phase standard curve

Ethanol gas phase standard curves were prepared, and ethanol standard solutions of 0, 0.5, 1, 2.5, 5, 10 and 20mg/mL were prepared, respectively. Isopropyl alcohol is selected as an internal standard, and chromatographic grade isopropyl alcohol is used for preparing 10mg/mL internal standard solution.

500. Mu.L of each prepared ethanol standard solution and each prepared internal standard solution were mixed in a 2mL centrifuge tube, filtered through a 0.22 μm needle filter membrane into a gas phase bottle using a 1mL syringe, and the gas phase bottle was sealed with a cap and placed into a gas chromatograph for measurement.

The ethanol concentration was analyzed and detected by gas chromatography. The injector temperature of the gas chromatograph was 250 ℃. The chromatographic column has the specification that: 19091J-413 (30 m.times.0.32 mm.times.0.25 μm). The column temperature box adopts the programming temperature: the initial temperature is 40 ℃, and the temperature is kept for 3min; heating to 140 ℃ at 10 ℃/min; then heating to 230 ℃ at 50 ℃/min; finally, the mixture was kept at 230℃for 2 minutes. The temperature of the detector is controlled at 300 ℃, wherein the carrier gas is nitrogen, and the flow rate is 30mL/min; the flow rate of hydrogen is 40mL/min; the air flow rate was 350mL/min. The sample loading per run was 1 μl.

Taking the ethanol concentration as the abscissa and the ratio of the ethanol peak area to the internal standard peak area as the ordinate, performing linear regression, and obtaining the equation as shown in fig. 13: y= 0.1215x-0.016 (R ² ＝0.9919)。

(3) Sample ethanol yield determination

Fermenting the sample with YPD culture medium, and filtering the supernatant obtained by fermentation with a 0.22 μm needle filter membrane to obtain a sample liquid; the method for measuring the ethanol concentration of the sample liquid is the same as that of the standard liquid.

The CAP5 strain was determined to have an ethanol yield of 98.76g/L under this culture condition.

Example 6 optimization of the fermentation Process for producing ethanol by CAP5 Strain

(1) Influence of carbon Source addition on ethanol yield

The ethanol fermentation culture of CAP5 strain uses YPD culture medium, which contains 10g/L yeast powder and 20g/L peptone, and glucose mother liquor with concentration of 600g/L is prepared and added into YPD culture medium according to the amount, so that the final concentration of glucose is 100g/L,200g/L,300g/L and 400g/L respectively, and each concentration is repeated three times; after 84h shaking culture at 28℃and 150r/min, centrifugation was carried out at 8000r/min at 4℃for 15min, the supernatant was collected, diluted 5-fold and mixed with 500. Mu.L of each internal standard, and filtered through a 0.22 μm needle filter, and gas phase analysis was carried out, and the analytical method was as described in example 5.

As can be seen from FIG. 14, the ethanol yield of CAP5 strain at various sugar (carbon source) concentrations was the highest at 300g/L, and it was 109.3g/L, as can be seen from FIG. 14. As the glucose in the YPD culture medium is not fully utilized after the fermentation is completed, the glucose is changed into 250g/L glucose in the subsequent ethanol fermentation culture to avoid the waste of carbon sources.

(2) Effect of fermentation time on ethanol production

Fermenting CAP5 strain with YPD culture medium with glucose concentration of 250g/L, culturing under the same condition, placing 10mL fermentation liquor every 12h in a refrigerator at-18deg.C, centrifuging all fermentation liquor respectively and collecting supernatant after stopping fermentation for 84h, diluting 5 times, mixing with 500uL of internal standard, filtering with 0.22 μm needle filter membrane, and performing gas phase analysis.

The results of the ethanol yield detection of the CAP5 strain under different fermentation times are shown in FIG. 15, and as can be seen from FIG. 15, the ethanol yield of the CAP5 strain is highest within 72-84 h, and the ethanol yield reaches 106.43g/L at 72 h.

(3) Effect of fermentation temperature on ethanol production

Fermenting CAP5 strain with YPD culture medium with glucose concentration of 250g/L, setting temperature gradients of 24, 28, 32 and 36 ℃, repeating each temperature, stopping fermentation for 84 hours under the same culture conditions, centrifuging fermentation liquor to obtain supernatant, diluting 10 times, mixing with internal standard 500uL, filtering with 0.22 μm needle filter membrane, and performing gas phase analysis.

The results of the ethanol yield test of CAP5 strain at different fermentation temperatures are shown in FIG. 16, and it can be seen from FIG. 16 that the ethanol yield is higher at 28℃to 126.91g/L.

(4) Effect of Nitrogen Source on ethanol production

Fermenting CAP5 strain with culture medium with glucose concentration of 250g/L, selecting yeast powder, peptone and soybean powder as nitrogen sources, repeating each nitrogen source, stopping fermenting for 84 hr, centrifuging fermentation liquid to obtain supernatant, diluting 10 times, mixing with internal standard 500uL, filtering with 0.22 μm needle filter membrane, and performing gas phase analysis.

The results of ethanol yield detection of CAP5 strain under different nitrogen source conditions are shown in FIG. 17, and it can be seen from FIG. 17 that among 3 nitrogen sources, ethanol yield is highest when soybean is the nitrogen source, reaching 127.23g/L.

EXAMPLE 7 acid and alkali resistance analysis of CAP5 Strain

pH tolerance test: adding 100mL YPD liquid culture medium into a conical flask with volume of 250mL, sterilizing, cooling, and adding H with different concentrations ₂ SO ₄ Solutions were prepared to give medium pH values of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0 and 8.0, respectively, three replicates for each pH. After 5% (v/v) seed solution was inoculated, the culture was carried out at 28℃and 150rpm, and ethanol concentration was measured by sampling every 12 hours during the culture.

As a result, as shown in FIG. 18, it was revealed that the CAP5 strain was still able to grow normally and produce ethanol under acidic conditions, and that the CAP5 ethanol yield reached the highest value of 96.01g/L at pH 6.0, and that the CAP5 ethanol yield decreased under alkaline conditions, indicating that the CAP5 strain was an acid-resistant strain.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Sequence listing

<110> university of Yunnan

<120> an abnormal Wikimann yeast CAP5 strain and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 565

<212> DNA

<213> Exception Wilkham yeast (Wickerhamomyces anomalus)

<400> 1

tatggatcta ttgcagcgct tattgcgcgg cgataaacct tacacacatt gtctagtttt 60

tttgaacttt gctttgggtg catcagccta gctgcgtgcc caaaggtcta aacacatttt 120

ttttaatgtt aaaaccttta accaatagtc atgaaaattt ttaacaaaaa ttaaaatctt 180

caaaactttc aacaacggat ctcttggttc tcgcaacgat gaagaacgca gcgaaatgcg 240

atacgtattg tgaattgcag attttcgtga atcatcgaat ctttgaacgc acattgcacc 300

ctctggtatt ccagagggta tgcctgtttg agcgtcattt ctctctcaaa ccttcgggtt 360

tggtattgag tgatactctg tcaagggtta acttgaaata ttgacttagc aagagtgtac 420

taataagcag tctttctgaa ataatgtatt aggttcttcc aactcgttat atcagctagg 480

caggtttaga agtattttag gctcggctta acaacaataa actaaaagtt tgacctcaaa 540

tcaggtagga ctacccgctg aactt 565

Claims

1. Abnormal Wikimann yeastWickerhamomyces anomalus) A CAP5 strain deposited at the collection of microorganisms, inc. Cantonese, at month 8 and 4 of 2021 under the accession number GDMCC No:61857.

2. a microbial preparation comprising the Wilker's yeast CAP5 strain of claim 1 or a fermentation broth thereof.

3. Use of the CAP5 strain of claim 1 in biological degumming.

4. Use of the CAP5 strain of claim 1 for the preparation of pectinase.

5. Use of the CAP5 strain of claim 1 for the preparation of ethanol.

6. Use of the CAP5 strain of claim 1 in the production of fruit wine.

7. The use according to claim 4, wherein the method for preparing pectinase is: inoculating CAP5 strain into fermentation medium containing pectin for fermentation culture.

8. The use according to claim 5, wherein the process for preparing ethanol is: inoculating CAP5 strain into an ethanol fermentation culture medium for liquid fermentation culture, wherein the ethanol fermentation culture medium comprises the following components in percentage by weight: 3% w/v of soybean powder and 25% v/v of glucose.

9. The use according to claim 7, characterized in that the components and contents of the fermentation medium are: mgSO (MgSO) ₄ 0.3 g/L，K ₂ HPO ₄ 0.4g/L, KCl:0.3g/L, peptone 0.5% -2.5% w/v, mn ²⁺ 1 to 2.5mmoL/L,1 to 1.5 percent w/v of pectin; the fermentation culture temperature is 28 ℃, the culture time is 30-42 h, and the fermentation pH is 5-8.

10. The use according to claim 8, wherein the fermentation temperature is 28-32 ℃ and the incubation time is 60-84 h.