CN114410489A

CN114410489A - Abnormal yeast Weikehan yeast CAP5 strain and application thereof

Info

Publication number: CN114410489A
Application number: CN202111676824.7A
Authority: CN
Inventors: 秦世雯; 索玉凯; 何飞飞; 张树竹; 铁丽萍; 高晶
Original assignee: Yunnan University YNU
Current assignee: Yunnan University YNU
Priority date: 2021-12-31
Filing date: 2021-12-31
Publication date: 2022-04-29
Anticipated expiration: 2041-12-31
Also published as: CN114410489B

Abstract

The invention discloses an abnormal Wickerhamomyces yeast (Wickerhamomyces anomalus) CAP5 strain and application thereof. The CAP5 strain is preserved in Guangdong province microorganism culture collection center at 8/4/2021, and the preservation number is GDMCC No: 61857. the CAP5 strain has good acid resistance and pectinase activity, and the generated pectinase has high activity and can be used in the production of pectinase or used in the biological degumming process of coffea arabica and the like. In addition, the CAP5 strain has high ethanol yield and can be used for the fermentation production of ethanol; the pectinase activity of the enzyme can be combined, and the enzyme can also be used for brewing fruit wine.

Description

Abnormal yeast Weikehan yeast CAP5 strain and application thereof

Technical Field

The invention belongs to the technical field of microorganisms. More particularly, relates to an abnormal yeast strain of Wickerhamia williamsii CAP5 and application thereof.

Background

Coffea arabica (Coffeaarabica L.) is one of the important plateau characteristic dominant industries in Yunnan province, and has important significance for promoting ecological protection and green development of border areas and enriching agricultural production varieties in the border areas. The primary processing mode of Yunnan arabica is mainly a wet processing method, wherein the fermentation degumming link has the highest technical requirement, the most complex process and the most easy problem, and the link is closely related to the quality of coffee commercial beans, and the quality of degumming directly influences the storage effect and the specific flavor of coffee, thereby influencing the profit of the coffee industry.

At present, the fermentation degumming link of the coffea arabica is mainly natural fermentation degumming, and physical degumming is also popularized and applied. Wherein, the natural fermentation degumming is to peel coffee and put the coffee into a fermentation tank, and to carry out natural fermentation by taking water as a medium; however, the natural fermentation degumming period is long, the fermentation process is influenced by the variety, fermentation quantity, maturity of fresh coffee fruits, air temperature and the like, the degumming process is not easy to control, the degumming is easy to be incomplete or the fermentation time is too long, so that the coffee tastes too acid, the quality is reduced, microorganisms in the natural fermentation process are not screened, the varieties are various, and pollutants generated in the microbial metabolism process also easily influence the coffee quality. The physical degumming is to peel fresh coffee fruits and then clean the peeled fresh coffee fruits, and continuously rub coffee beans in the cleaning process to achieve the purpose of degumming; however, the problem of incomplete degumming easily occurs in physical degumming, and the secondary fermentation of the coffee beans easily occurs, which seriously affects the quality and the storage period of the coffee beans. The biological degumming is to inoculate the screened degumming bacterial strain on the peeled coffee beans and decompose the colloid by using enzymes secreted by the bacterial strain; or degumming by adding enzyme preparation. Compared with natural fermentation, the process of biological degumming is easier to control, no toxic and harmful substances are generated in the process, and the method has the advantages of green, environmental protection, high efficiency and the like.

For example, in the chinese patent 'an enzyme preparation and method for degumming fresh coffee fruit', degumming is performed by using an enzyme preparation consisting of pectinesterase, pectin lyase and polygalacturonase, thereby improving the degumming efficiency of coffee beans, reducing the mildew rate of coffee beans, improving the quality of coffee beans, and reducing water consumption, which is more environment-friendly. However, there are few reports about the coffee degumming strain, and the practical application is still in the experimental demonstration stage, so that more strains which can be used for degumming need to be developed to promote the development of the coffee biological degumming technology.

The abnormal yeast Wickerhamomyces avermitilis is a common aroma-producing yeast. Chinese patent 'a yeast for decomposing pectin and application thereof' discloses a abnormal yeast Weikehan for decomposing pectin, but only qualitative experiments are carried out, the yield of pectinase and ethanol is not high, and the abnormal yeast Weikehan is not suitable for the production of pectinase and ethanol.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art and provides an abnormal Wickerhamomyces anshamii (CAP 5) strain and application thereof.

The first purpose of the invention is to provide an abnormal yeast Wickerhamomyces anserina (CAP 5) strain.

It is a second object of the present invention to provide a microbial preparation.

The third purpose of the invention is to provide the application of the CAP5 strain in biological degumming.

The fourth purpose of the invention is to provide the application of the CAP5 strain in preparing pectinase.

The fifth purpose of the invention is to provide the application of the CAP5 strain in preparing ethanol.

The sixth purpose of the invention is to provide the application of the CAP5 strain in the production of fruit wine.

The above purpose of the invention is realized by the following technical scheme:

an abnormal yeast Weikehan (Wickerhamomyces anamomeus) CAP5 strain, which is deposited in Guangdong province microbial culture collection center (GDMCC) at 8-4.2021, with the deposit address of Guangdong province academy of sciences microorganism research institute (Zuixianrejia 100 in Guangdong province, Guangzhou city), and the strain deposit number is GDMCC No: 61857, respectively; the ITS sequence of the CAP5 strain is shown as SEQ ID NO. 1.

The abnormal yeast Wickerhamomyces (Wickerhamomyces ananalus) CAP5 strain is separated from fermentation liquor of Yunnan small-grain coffee (Coffeaarabica L.), can generate pectinase to decompose pectin, has high activity of the generated pectinase up to 411.45U/mL, and can be used for producing the pectinase or used in the biological degumming process of the small-grain coffee and the like. In addition, the CAP5 strain can also be fermented to produce ethanol, the ethanol yield can reach 127.23g/L at most, and the CAP5 strain can be used in the fermentation production of ethanol, can be combined with the pectinase activity of the CAP, and can also be used in the brewing of fruit wine. The present application thus protects the following applications:

the application of the CAP5 strain protects the application of the CAP5 strain in biological degumming, especially coffee biological degumming.

The application of the CAP5 strain in preparing pectinase is protected.

The application of the CAP5 strain in the preparation of ethanol is protected.

The application of the CAP5 strain in the production of fruit wine is protected.

Specifically, the method for preparing the pectinase comprises the following steps: the CAP5 strain is inoculated into a fermentation medium containing pectin for fermentation culture.

Specifically, the fermentation medium comprises the following components in percentage by weight: MgSO (MgSO)₄ 0.3g/L，K₂HPO₄0.4g/L, KCl: 0.3g/L, proteinPeptone 0.5% -2.5% (w/v), Mn²⁺1-2.5 mmoL/L, 1-1.5% (w/v) pectin.

Preferably, the fermentation medium contains 1% (w/v) pectin, see example 4.

Preferably, the fermentation medium contains 2.5% (w/v) peptone, see example 4.

Preferably, the fermentation medium contains 2mmoL/L Mn²⁺See example 4.

Specifically, the culture temperature of the fermentation culture is 28 ℃, the culture time is 30-42 h, and the fermentation pH is 5-8.

Preferably, the incubation time is 36h, see example 4.

Preferably, the fermentation pH is 6.0, see example 4.

More preferably, the fermentation medium contains MgSO₄ 0.3g/L，K₂HPO₄0.4g/L, KCl: 0.3g/L, peptone 21.6g/L, Mn²⁺1.5mmoL/L, carbon source: 1% (w/v) pectin, see example 4.

More preferably, the fermentation temperature of the fermentation culture is 28 ℃; fermenting to pH 4.32; the fermentation time was 30h, see example 4.

Specifically, the method for preparing ethanol comprises the following steps: the CAP5 strain is inoculated in an ethanol fermentation medium for liquid fermentation culture. .

Specifically, the ethanol fermentation medium comprises the following components in percentage by weight: 3% (w/v) soybean meal, 25% (v/v) glucose.

Specifically, in the preparation of the ethanol fermentation medium, a glucose solution with a concentration of 600g/L was prepared and added to the medium in a volume ratio, see example 6.

Specifically, the culture temperature of the fermentation culture is 28-32 ℃, and the culture time is 60-84 h.

Preferably, the cultivation temperature is 28 ℃ as described in example 6.

Preferably, the incubation time is 72h, see example 6.

The invention also provides a microbial preparation which contains the abnormal yeast Wickerhamomyces ansamianus CAP5 strain or fermentation liquor thereof.

The invention has the following beneficial effects:

the invention provides an abnormal Wilm's yeast (Wickerhamomyces anomallus) CAP5 strain, which is preserved in Guangdong provincial microorganism strain collection center at 8.4.2021, and is addressed to the institute of microorganism research of Guangdong provincial academy of sciences, and the strain number is GDMCC No: 61857. the abnormal yeast Calmette-Hanjie CAP5 strain has good acid resistance and pectinase activity, can degrade pectin, has high generated pectinase activity, can generate a large amount of ethanol in fermentation, and has high ethanol yield. Therefore, the CAP5 strain can be used for producing pectinase or used in the biological degumming process of coffea arabica and the like, the degumming time is shortened, the quality of coffee commercial beans is improved, and the strain can also be used in the brewing of ethanol and fruit wine.

Drawings

FIG. 1 is a graph showing the staining of bromophenol blue by the abnormal yeast Calmette-Hanjie CAP5 strain.

FIG. 2 is a colony morphology of the abnormal yeast Tokamer CAP5 strain.

FIG. 3 is a micrograph of an abnormal yeast strain, Tokayama willebrand CAP5, magnified 400 times under an optical microscope.

FIG. 4 is an electrophoretogram of ITS sequence of abnormal yeast Calmette CAP5 strain.

FIG. 5 is a tree of abnormal yeast Calmette-Hanjie CAP5 strains evolved based on the ITS-rDNA sequence.

FIG. 6 shows the pectinase activity of an abnormal yeast strain, Velcro CAP5, at different pectin concentrations.

FIG. 7 shows the pectinase activity of an abnormal yeast Calmette-Guerin strain CAP5 at different fermentation times.

FIG. 8 shows the pectinase activity of an abnormal yeast Calmette-Hanjim CAP5 strain at different fermentation pH.

FIG. 9 shows the pectinase activity of an abnormal yeast strain, Tokammaria kanehensis CAP5, under different nitrogen sources.

FIG. 10 shows the pectinase activity of an abnormal yeast strain, Haemophilus Velcro CAP5, at different amounts of nitrogen source added.

FIG. 11 shows the pectinase activity of an abnormal yeast strain Calmette-Hanjim CAP5 under different ion conditions.

FIG. 12 shows different Mn²⁺Pectinase activity of the abnormal yeast Velcro CAP5 strain at the concentration.

FIG. 13 is a standard curve of ethanol gas phase.

FIG. 14 is a graph of ethanol production by an abnormal yeast Calmette-Hanjie CAP5 strain at different sugar concentrations.

FIG. 15 shows ethanol production by an abnormal yeast Calmette-Hanzi CAP5 strain at different fermentation times.

FIG. 16 is a graph of ethanol production by an abnormal yeast Calmette-Hanjie CAP5 strain at different fermentation temperatures.

FIG. 17 shows ethanol production by an abnormal yeast Calmette-Hanjie CAP5 strain under different nitrogen sources.

FIG. 18 shows the results of acid resistance analysis of the abnormal yeast strain Calamina CAP 5.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

EXAMPLE 1 isolation and purification of the Strain

Pectin degrading bacteria in fermentation liquor of coffea arabica (Coffeaarabica L.) of Yunnan province are separated by a plate dilution coating separation method. The specific process is as follows:

filtering the fermentation liquid with six layers of gauze, and filtering the filtrate by 10⁰、10^-1、10^-2、10^-3、10^-4、10^-5Dilutions were made in gradients, 100. mu.L of each dilution was pipetted at different dilution concentrations and plated onto prescreening medium, 3 replicates per gradient, and blank plates without inoculated filtrate were used as controls. Culturing for 4-5 days at 28 ℃ until bacterial colony grows out, observing the morphology of the bacterial colony, selecting single bacterial colonies with different morphologies, inoculating the single bacterial colonies in a PDA culture medium for purification culture for 3-4 days,the product is purified continuously for 3 times, and then numbered, and the strain is preserved by a glycerol method.

The primary screening culture medium and the PDA culture medium are respectively as follows:

primary screening of culture medium: pectin 2g, K₂HPO₄1.0 g，MgSO₄0.5 g，NaNO₃3.0 g，FeSO₄7H₂0.01 g of O, 20g of agar, ddH₂And O is metered to 1000 mL. pH: 5.5, sterilizing at 121 ℃ for 20 min.

PDA culture medium: 200g of potato, adding proper amount of ddH₂Boiling for 20min, filtering with four layers of gauze, collecting filtrate, adding glucose 20g, agar 20g, and ddH₂And O is metered to 1000mL, the pH is natural, and the mixture is sterilized for 20min at 121 ℃.

EXAMPLE 2 screening of strains

(1) Preliminary screening

The invention adopts a bromophenol blue method to screen the separated pectin degrading strains. Inoculating the separated and purified strain to bromophenol blue agar medium with pectin as the only carbon source, observing the size of the yellow transparent ring after a culture period, and setting 3 times. Culturing at 28 deg.C for 72h, measuring the diameter (D) of transparent ring of culture medium and the diameter (D) of bacterial colony, and primarily judging the degumming capability of the strain. And selecting the strain with large D/D ratio for the next re-screening test.

The strain CAP5 with stronger pectin degradation capability is separated and screened by a bromophenol blue agar culture medium (see figure 1). As can be seen from FIG. 1, clear circles appeared around the CAP5 colony, and the CAP5 strain was subsequently subjected to liquid shake flask fermentation and then to crude enzyme activity assay.

(2) Crude enzyme activity assay

Inoculating CAP5 strain on YPD culture medium, culturing at 28 deg.C for 1-2 days until single colony grows out, picking single colony, placing in 50mL conical flask containing 25mLYPD liquid culture medium, and performing shake culture at 28 deg.C and 150r/min for 24h to obtain seed solution. Inoculating 100 μ L of the seed solution into 150mL of fermentation medium, performing fermentation culture, performing shaking culture at 28 deg.C and 150r/min for 48h, and centrifuging at 4 deg.C and 8000r/min for 15min to obtain supernatant as crude enzyme solution. And (4) sucking the supernatant fluid for proper dilution, and measuring the pectinase activity of the diluted crude enzyme solution by adopting a DNS method.

YPD medium: peptone 20g, yeast extract 10g, glucose 200g, ddH₂O constant volume to 1000mL, pH: 5.5, sterilizing at 121 ℃ for 20 min.

Fermentation medium: pectin 5g, peptone 5g, KCl 1g, K₂HPO₄1 g，KH₂PO₄0.5 g，MgSO₄1.0 g，ddH₂O constant volume to 1000mL, pH: 5.5, sterilizing at 121 ℃ for 20 min.

Measurement of pectinase Activity

0.75mL of substrate buffer solution with the concentration of 10mg/mL is sucked into a 2mL EP tube, 0.25mL of crude enzyme solution is added, the mixture is uniformly mixed and reacts in a water bath at the temperature of 30 ℃ for 15min, then 500 mu L of reaction solution is taken out and added with 400 mu LDNS to stop the reaction, the mixture is placed in boiling water to be boiled for 5min, and then the mixture is rapidly cooled by flowing water. The absorbance was measured at 540nm using the inactivated crude enzyme solution as a control.

Definition of pectinase activity: the ability of 1mL of enzyme solution to hydrolyze pectin substrate to 1. mu. mol galacturonic acid per minute at 30 ℃ and pH 5.0 is defined as 1 enzyme activity unit (U).

Enzyme activity (U/mL): (A1-A0). times.1000 XN/0.25 XKXT

A1: OD540 values for experimental groups; a0: OD540 value of control group; 1000: 1mg ═ 1000 μ g; 0.25: volume of diluted enzyme solution (mL) used in the enzyme activity assay; k: the slope of the galacturonic acid standard curve; t: reaction time (min); n: dilution factor of supernatant

The PG activity of the CAP5 strain was determined to be 185.46U/mL.

Example 3 identification of CAP5 Strain

(1) Morphological identification

Pure cultures of CAP5 strain were inoculated on YPD medium, and morphological characteristics of the cultures were observed after 48 hours, as shown in FIG. 2; this was observed under an optical microscope at 400-fold magnification, and the result is shown in FIG. 3.

As can be seen from FIG. 2, the colony of the CAP5 strain of the invention is dome-shaped, white, smooth and opaque in surface, relatively neat in edge and sticky; as can be seen in FIG. 3, the microscopic structure of the CAP5 strain is circular or oval and is budding. In addition, the CAP5 strain produced an alcohol aroma during the culture, and was presumed to be a strain of the genus Wickerhamomyces sp.

(2) Molecular biological identification

The genomic DNA of CAP5 strain was extracted using a fungal DNA extraction kit, as described in the reference kit, and ITS ITS sequences were amplified using ITS amplification primers as follows:

forward primer ITS 3: 5 '-GATGAAGAACGYAGYRAA-3'

Reverse primer ITS 4: 5'-TCCTCCGCTTATTGATATGC-3'

The PCR reaction system is as follows: 2 XPCR Buffer 25. mu.L, 2mM dNTPs 10. mu.L, 10pmoL/mL ITS 31.5. mu.L, 10pmoL/mL ITS 41.5. mu.L, KOD FX (1.0U/. mu.L) 1.0. mu. L, DNA 2.0. mu. L, ddH₂O 9μL；

The PCR amplification procedure was: pre-denaturation at 94 ℃ for 5min, denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 30s, extension at 68 ℃ for 30s, 35 cycles in total, and finally extension at 68 ℃ for 5 min;

the PCR amplification product was checked by 1% agarose gel electrophoresis, and the results are shown in FIG. 4, from which it can be seen that the size of the amplification product coincides with the expected size. And (4) cleaning and recovering the amplification product, sending the amplification product to the department of science and technology limited company for sequencing, and constructing a phylogenetic tree.

The ITS sequence of CAP5 strain is shown below (SEQ ID NO. 1):

TATGGATCTATTGCAGCGCTTATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGCATCAGCCTAGCTGCGTGCCCAAAGGTCTAAACACATTTTTTTTAATGTTAAAACCTTTAACCAATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAATGTATTAGGTTCTTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGT AGGACTACCCGCTGAACTT

the ITS sequence of CAP5 strain was BLAST homologously aligned and analyzed with the ITS sequence of known strain in NCBI database, and the result showed that the strain has more than 98% similarity with the ITS sequences of other multiple strains of abnormal Hanjim yeast Wicker. To further confirm the relationship and the systematic status between the CAP5 strain and known yeasts, a phylogenetic tree was constructed by performing alignment analysis on multiple sequences of the CAP5 strain and related strains and a Neighbour-join method using MEGA X biology software based on homology search results.

The phylogenetic tree constructed is shown in FIG. 5. The results of the above experiments show that the CAP5 strain of the present invention is Saccharomyces carlsbergensis (Wickerhamomyces ananalus), which was named as Saccharomyces carlsbergensis (Wickerhamomyces ananalus) CAP5 strain, which was deposited at the Guangdong province microbial culture Collection (GDMCC) at 8/4 of 2021 and was deposited at the institute of microbiology (Ministry of Pionella furcijuga, Guangdong province, Guangzhou).

Example 4 optimization of enzyme-producing fermentation Process by CAP5 Strain

(1) Effect of pectin addition on pectinase Activity

Fermentation media of different pectin contents were prepared according to example 2, in which pectin was added in the proportions of 0.5%, 1%, 1.5%, 2%, 2.5% and 3% (w/v). The CAP5 strain is cultured in fermentation culture medium with different pectin contents at 28 deg.C under shaking at 150r/min for 48 hr, centrifuged at 4 deg.C at 8000r/min for 15min, and the supernatant is taken to measure the activity of pectinase. Test methods refer to example 2.

The result of the detection of the pectase activity of the CAP5 strain under different pectin addition levels is shown in FIG. 6, and it can be seen from FIG. 6 that the pectase activity of the CAP5 strain is the highest at 197.74U/mL when the pectin addition level is 1% (w/v).

(2) Effect of fermentation time on pectinase Activity

Preparing a fermentation medium with 1% (w/v) of pectin addition to ferment the CAP5 strain, taking a fermentation liquid once every 24 hours after fermentation, taking the fermentation liquid once every 6 hours, temporarily storing the fermentation liquid in a refrigerator at 4 ℃, centrifuging all the fermentation liquids respectively and taking supernatant liquid after the fermentation is stopped for 60 hours, and determining the activity of the pectinase.

The result of the detection of the pectase activity of the CAP5 strain at different fermentation times is shown in FIG. 7. it can be seen from FIG. 7 that the pectase activity of the CAP5 strain is the highest at 195.28U/mL when the fermentation time is 36 h.

(3) Effect of fermentation pH on pectinase Activity

Preparing fermentation culture medium with different pH (3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0) and 1% (w/v) pectin addition amount to ferment CAP5 strain at 28 deg.C for 36 hr, collecting supernatant of the fermentation liquid, and determining pectase activity.

The result of the detection of the pectase activity of the CAP5 strain at different fermentation pH values is shown in FIG. 8, and it can be seen from FIG. 8 that the pectase activity of the CAP5 strain is the highest at 218.01U/mL when the fermentation pH value is 6.0.

(4) Influence of Nitrogen Source on the Activity of pectinase

Preparing a fermentation culture medium with pH of 6.0 and 1% (w/v) of pectin addition, respectively selecting yeast powder, peptone, beef extract, ammonium sulfate and sodium nitrate as nitrogen sources to ferment the CAP5 strain, taking supernatant of fermentation liquor after fermenting for 36h at 28 ℃, and measuring the activity of the pectinase.

The result of the detection of the pectinase activity of the CAP5 strain under different nitrogen source conditions is shown in FIG. 9, and it can be seen from FIG. 9 that the pectinase activity of the CAP5 strain is the highest, 269.59U/mL, when peptone is used as the nitrogen source.

(5) Influence of nitrogen source addition on pectinase activity

Preparing a fermentation medium with pH of 6.0 and 1% (w/v) of pectin addition, wherein the addition of peptone is 0, 0.5%, 1%, 1.5%, 2%, 2.5% and 3% (w/v), respectively, fermenting the CAP5 strain at 28 ℃ for 36h, taking supernatant of the fermentation liquid, and determining the activity of the pectinase.

The result of the detection of the pectase activity of the CAP5 strain at different peptone concentrations is shown in FIG. 10. it can be seen from FIG. 10 that the pectase activity of the CAP5 strain is the highest at 288.63U/mL when the amount of peptone added is 2.5%.

(6) Effect of ions on pectinase Activity

Preparing fermentation medium with pH of 6.0, 1% (w/v) pectin addition amount, 2.5% (w/v) peptone addition amount, respectively addingZn²⁺、Al³⁺、Cu²⁺、Mn²⁺、Fe³⁺、Fe²⁺、Ba²⁺And (3) fermenting the CAP5 strain at 28 ℃ for 36 hours, taking the supernatant of the fermentation liquid, and determining the activity of the pectinase.

The result of detecting the pectase activity of the CAP5 strain under different ion conditions is shown in FIG. 11, and it can be seen from FIG. 11 that when Mn is added²⁺When the activity is higher, the pectase activity of the CAP5 strain is 303.42U/mL.

(7) Effect of ion addition on pectinase Activity

Preparing a fermentation medium with pH of 6.0, 1% (w/v) pectin addition amount and 2.5% (w/v) peptone addition amount, adding Mn with different concentrations²⁺Fermentation of CAP5 Strain Mn²⁺The concentration of the fermentation liquor is 0, 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0mM/L in sequence, after fermentation is carried out for 36 hours at the temperature of 28 ℃, the supernatant of the fermentation liquor is taken, and the activity of the pectinase is measured.

Different Mn²⁺The result of measuring the pectinase activity of the CAP5 strain at a concentration is shown in FIG. 12, and it can be seen from FIG. 12 that when Mn is added²⁺When the amount of the compound is 2mM/L, the pectase activity of the CAP5 strain is the highest and is 312.36U/mL.

On the basis of the experimental results, the invention optimizes the fermentation conditions of the CAP5 strain by a response surface method. The optimization result shows that the optimal fermentation scheme of CAP5 is as follows:

fermentation medium: MgSO (MgSO)₄ 0.3g/L，K₂HPO₄0.4g/L, KCl: 0.3g/L, peptone 21.6g/L, Mn²⁺1.5mmoL/L, carbon source: 1% (w/v) pectin;

fermentation conditions are as follows: the fermentation temperature is 28 ℃; the fermentation pH is 4.32; fermentation time: and (5) 30 h.

The CAP5 strain is fermented by adopting the optimal fermentation scheme, and the activity of the obtained pectinase is up to 411.45U/mL.

Example 5 cultivation of CAP5 Strain and determination of ethanol production

(1) Cultivation of the Strain

CAP5 strain was cultured using YPD medium and its ethanol production was determined. Inoculating CAP5 strain on YPD solid culture medium, culturing at 28 deg.C for 1-2 days until single colony grows out, picking single colony, placing in 50mL conical flask containing 25mLYPD liquid culture medium, and performing shake culture at 28 deg.C and 150r/min for 24h to obtain seed solution. Inoculating 100 μ L seed solution into 150mL YPD liquid culture medium, performing shaking culture at 28 deg.C and 150r/min for 48 hr, centrifuging at 4 deg.C and 8000r/min for 15min, and collecting supernatant.

(2) Ethanol gas phase standard curve

Ethanol gas phase standard curves are prepared, and ethanol standard solutions of 0, 0.5, 1, 2.5, 5, 10 and 20mg/mL are respectively prepared. Isopropanol is selected as an internal standard, and chromatographic grade isopropanol is used for preparing 10mg/mL internal standard solution.

500 mu L of each prepared ethanol standard solution and internal standard solution with each concentration are uniformly mixed in a 2mL centrifugal tube, filtered into a gas phase bottle through a 0.22 mu m needle filter membrane by using a 1mL syringe, sealed by a cover and placed into a gas chromatograph for measurement.

The ethanol concentration was analyzed and determined by gas chromatography. The injector temperature of the gas chromatograph was 250 ℃. The specification of the chromatographic column is as follows: 19091J-413(30 m.times.0.32 mm.times.0.25 μm). The column oven adopts programmed heating: the initial temperature is 40 ℃, and the temperature is kept for 3 min; heating to 140 deg.C at 10 deg.C/min; then heating to 230 ℃ at a speed of 50 ℃/min; finally, the temperature was maintained at 230 ℃ for 2 minutes. The temperature of the detector is controlled at 300 ℃, wherein the carrier gas is nitrogen, and the flow rate is 30 mL/min; the hydrogen flow rate is 40 mL/min; the air flow rate was 350 mL/min. The sample size was 1 μ L per run.

Taking the ethanol concentration as a horizontal coordinate, taking the ratio of the ethanol peak area to the internal standard peak area as a vertical coordinate, performing linear regression, and obtaining a result as shown in fig. 13, wherein the equation is as follows: y is 0.1215x-0.016 (R)²＝0.9919)。

(3) Sample ethanol yield determination

Fermenting the sample with YPD culture medium, and filtering the supernatant obtained by fermentation with 0.22 μm needle filter membrane to obtain sample solution; the method for measuring the ethanol concentration of the sample solution is the same as the method for measuring the standard solution.

The ethanol production of CAP5 strain was determined to be 98.76U/mL under this culture condition.

Example 6 optimization of ethanol production fermentation Process by CAP5 Strain

(1) Effect of carbon Source addition on ethanol production

YPD culture medium is used for ethanol fermentation culture of CAP5 strain, wherein the YPD culture medium contains 10g/L yeast powder and 20g/L peptone, glucose mother liquor with the concentration of 600g/L is prepared and added to the YPD culture medium according to the amount, the final glucose concentration is respectively 100g/L, 200g/L, 300g/L and 400g/L, and each concentration is repeated three times; after shaking culture at 28 ℃ and 150r/min for 84h, centrifugation is carried out at 4 ℃ and 8000r/min for 15min, and the supernatant is taken, diluted 5 times and mixed with 500. mu.L of each internal standard, and then filtered through a 0.22 μm needle filter for gas phase analysis, wherein the analysis method refers to example 5.

The ethanol production of CAP5 strain at different sugar (carbon source) concentrations is shown in FIG. 14. it can be seen from FIG. 14 that the ethanol production of CAP5 strain at 300g/L sugar concentration is the highest, 109.3 g/L. Because the glucose in the YPD medium is not completely utilized after the fermentation is finished, 250g/L glucose is changed during the subsequent ethanol fermentation culture in order to avoid carbon source waste.

(2) Effect of fermentation time on ethanol yield

Fermenting CAP5 strain with YPD medium with glucose concentration of 250g/L under the same conditions, storing 10mL of fermentation liquid in refrigerator at-18 deg.C every 12h, stopping fermentation until 84h, centrifuging all fermentation liquids, collecting supernatant, diluting by 5 times, mixing with internal standard 500uL, filtering with 0.22 μm needle filter membrane, and performing gas phase analysis.

The ethanol yield detection results of the CAP5 strain under different fermentation times are shown in FIG. 15, and it can be seen from FIG. 15 that the ethanol yield of the CAP5 strain is highest between 72h and 84h, and the ethanol yield reaches 106.43g/L at 72 h.

(3) Effect of fermentation temperature on ethanol yield

Fermenting CAP5 strain with YPD culture medium with glucose concentration of 250g/L, setting temperature gradient of 24, 28, 32, 36 deg.C, repeating at each temperature, culturing under the same conditions, fermenting for 84h, centrifuging the fermentation liquid, collecting supernatant, diluting 10 times, mixing with internal standard 500uL, filtering with 0.22 μm needle filter membrane, and performing gas phase analysis.

The ethanol yield detection results of the CAP5 strain at different fermentation temperatures are shown in FIG. 16, and it can be seen from FIG. 16 that the ethanol yield is higher at 28 ℃ and reaches 126.91 g/L.

(4) Influence of Nitrogen Source on ethanol production

Fermenting the CAP5 strain by using a culture medium with the glucose concentration of 250g/L, respectively selecting yeast powder, peptone and soybean powder as nitrogen sources, repeating the two nitrogen sources under the same culture conditions for 84h, centrifuging the fermentation liquor, taking the supernatant, diluting by 10 times, uniformly mixing the supernatant with an internal standard by 500uL, filtering by using a 0.22 mu m needle filter membrane, and performing gas phase analysis.

The ethanol yield test results of the CAP5 strain under different nitrogen source conditions are shown in FIG. 17, and it can be seen from FIG. 17 that the ethanol yield is the highest among 3 nitrogen sources when soybean is the nitrogen source, and reaches 127.23 g/L.

Example 7 acid and alkali resistance analysis of CAP5 Strain

pH tolerance test: 100mL of YPD liquid medium was put into a 250mL conical flask, sterilized and cooled, and then H was added thereto at different concentrations₂SO₄Solutions were made so that the pH of the media was 2.0, 3.0, 4.0, 5.0, 6.0, 7.0 and 8.0, three for each pH. After inoculating 5% (v/v) seed solution, culturing at 28 deg.C and 150rpm, sampling every 12h during culturing process, and determining ethanol concentration.

As shown in FIG. 18, it can be seen that the CAP5 strain still grew normally and produced ethanol under acidic conditions, and that the ethanol production of CAP5 reached the highest value of 96.01g/L at pH 6.0, while the ethanol production of CAP5 decreased under alkaline conditions, indicating that the CAP5 strain was an acid-resistant strain.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> university of Yunnan

<120> abnormal yeast Velcro CAP5 strain and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 565

<212> DNA

<213> Hanm yeast Ex Wei Ke (Wickerhamomyces anomalus)

<400> 1

tatggatcta ttgcagcgct tattgcgcgg cgataaacct tacacacatt gtctagtttt 60

tttgaacttt gctttgggtg catcagccta gctgcgtgcc caaaggtcta aacacatttt 120

ttttaatgtt aaaaccttta accaatagtc atgaaaattt ttaacaaaaa ttaaaatctt 180

caaaactttc aacaacggat ctcttggttc tcgcaacgat gaagaacgca gcgaaatgcg 240

atacgtattg tgaattgcag attttcgtga atcatcgaat ctttgaacgc acattgcacc 300

ctctggtatt ccagagggta tgcctgtttg agcgtcattt ctctctcaaa ccttcgggtt 360

tggtattgag tgatactctg tcaagggtta acttgaaata ttgacttagc aagagtgtac 420

taataagcag tctttctgaa ataatgtatt aggttcttcc aactcgttat atcagctagg 480

caggtttaga agtattttag gctcggctta acaacaataa actaaaagtt tgacctcaaa 540

tcaggtagga ctacccgctg aactt 565

Claims

1. An abnormal yeast strain of Wickerhamomyces anserina CAP5, which is deposited in Guangdong province microorganism strain collection center at 8/4/2021, and the strain preservation number is GDMCC No: 61857.

2. a microbial preparation comprising the abnormal yeast strain Haemophilus weckerensis CAP5 according to claim 1 or a fermentation liquid thereof.

3. Use of the CAP5 strain of claim 1 in bioscouring.

4. Use of the CAP5 strain of claim 1 for the preparation of pectinase.

5. Use of the CAP5 strain of claim 1 for the production of ethanol.

6. Use of a CAP5 strain according to claim 1 in the production of fruit wine.

7. The use according to claim 4, wherein the process for preparing pectinase comprises: the CAP5 strain is inoculated into a fermentation medium containing pectin for fermentation culture.

8. The use according to claim 5, wherein the method for preparing ethanol comprises: the CAP5 strain is inoculated in an ethanol fermentation medium for liquid fermentation culture.

9. The use according to claim 7, wherein the fermentation medium comprises the following components in percentage by weight: MgSO (MgSO)₄0.3g/L，K₂HPO₄0.4g/L, KCl: 0.3g/L, peptone 0.5% -2.5% (w/v), Mn²⁺1-2.5 mmoL/L, 1-1.5% (w/v) pectin; the fermentation culture temperature is 28 ℃, the culture time is 30-42 h, and the fermentation pH is 5-8.

10. The use of claim 8, wherein the ethanol fermentation medium comprises the following components in percentage by weight: 3% (w/v) soybean meal, 25% (v/v) glucose; the fermentation culture temperature is 28-32 ℃, and the culture time is 60-84 h.