CN116590164A - Kluyveromyces pichia pastoris FJY-4 strain and application thereof - Google Patents

Abstract

The invention discloses a Kluyveromyces pichia pastoris FJY-4 strain and application thereof. The Pichia kluyveri (Pichia kluyveri) FJY-4 strain has excellent pectase activity, has higher pectase activity under the low temperature condition than normal temperature, has strong temperature adaptability, can complete the decomposition of coffee bean gum under the normal temperature or low temperature condition, has high degumming efficiency, and greatly improves the purification rate of the coffee pectin. The FJY-4 strain is used for coffee fermentation, so that the production cost of raw coffee beans can be remarkably saved, and the water resource consumption and the wastewater discharge can be reduced. In addition, the FJY-4 strain can also be used for producing ethanol by fermenting coffee peel, and can be used for producing ethanol or developing coffee fruit wine. The FJY-4 strain provided by the invention is harmless to human body, is convenient to use, safe and environment-friendly, has good application prospect, and has obvious environmental benefit, economic benefit and social benefit.

Description

Kluyveromyces pichia pastoris FJY-4 strain and application thereof

Technical Field

The invention belongs to the technical field of microorganisms. More particularly, relates to a Kluyveromyces pichia FJY-4 strain and application thereof.

Background

The coffee fermentation process is the most important technical link in the wet processing of coffee, and the link can effectively remove the pectin layer of fresh coffee, improve the cleanliness of coffee beans and avoid microbial contamination. At present, natural fermentation and mechanical fermentation are mainly adopted for coffee fermentation. The natural fermentation is to soak the peeled coffee into water by taking water as a medium after the coffee is peeled, and to carry out fermentation degumming by virtue of enzymes contained in pectin. However, the traditional natural fermentation processing technology has large water consumption, the generated acid fermentation wastewater also causes serious environmental pollution, the natural fermentation period is long (generally 1-4 d), the influence factors are many, and the degumming process is not easy to control. The mechanical fermentation is to directly remove pectin on the peeled coffee beans by using machinery, but the mechanical degumming has high breakage rate and incomplete degumming, and the secondary fermentation of the coffee beans is easy to occur, thereby influencing the quality and the storage period of the commercial coffee beans. Therefore, development of a more stable and environment-friendly coffee fermentation technology is needed, and the bottleneck problems of low cleaning degree, long period, high labor intensity, water resource waste, high environmental pollution, unstable product quality and the like in wet processing of coffee are solved.

Bioscouring is one of the technologies of controlled fermentation of coffee that has been attracting attention in recent years, and this technology is to inoculate a microbial strain having a degumming function onto dehulled coffee beans for fermentation, thereby promoting the decomposition of the coffee cherry gelatin layer. Compared with natural fermentation, the fermentation conditions of biological degumming are easy to control, toxic substances are not generated in the fermentation process, the water consumption is low, and the method has the advantages of being green, environment-friendly, efficient and the like. However, the existing coffee biological degumming strains developed at home and abroad are fewer, and the key points of the existing coffee fermentation bacteria are to improve the fermentation flavor of coffee and have longer fermentation time. In addition, the fermentation conditions of different strains are different, the climatic conditions of different coffee producing regions are also obviously different, a large number of microbial strains which can be used for biological degumming of coffee are mined, and the fermentation conditions are clear, so that the method has important significance for promoting green development of the coffee industry.

Yunnan is the main coffee producing area in China, and the coffee yield accounts for about 90% of the whole country. Most of Yunnan coffee is planted in dry-hot valley areas with the altitude of about 1100 meters, the temperature difference between day and night is large, and the temperature at night is low. Aiming at local climate conditions, the development of the biological degumming microorganism strain with strong temperature adaptability, in particular to low temperature resistance has important application value.

Disclosure of Invention

The invention aims to provide a Kluyveromyces pichia pastoris FJY-4 strain and application thereof.

A first object of the present invention is to provide a strain of Kluyveromyces Pichia (Pichia kluyveri) FJY-4.

The second object of the present invention is to provide the application of the FJY-4 strain in preparing pectase.

A third object of the present invention is to provide the use of the FJY-4 strain in biological degumming of coffee.

A fourth object of the present invention is to provide the use of the FJY-4 strain in the preparation of a formulation for biological degumming of coffee.

The fifth object of the present invention is to provide the use of the FJY-4 strain in preparing ethanol by using coffee pericarp.

The sixth object of the present invention is to provide the application of the fJY-4 strain in preparing a preparation for preparing ethanol by fermenting coffee peel.

The seventh object of the present invention is to provide the application of the FJY-4 strain in preparing coffee fruit wine.

An eighth object of the present invention is to provide the use of the FJY-4 strain in the preparation of a formulation for making coffee fruit wine.

A ninth object of the present invention is to provide a method for biological degumming of coffee using the FJY-4 strain.

A tenth object of the present invention is to provide a method for preparing coffee fruit wine using the FJY-4 strain.

The above object of the present invention is achieved by the following technical scheme:

the invention separates a Pichia kurvata (Pichia kuluyveri) FJY-4 strain with excellent pectase activity under the condition of low temperature (4-6 ℃) from fresh fruits of Yunnan small-grain coffee (Coffea arabica L.). The FJY-4 strain not only can realize the rapid biological degumming of coffee, but also can utilize coffee peel to ferment to obtain ethanol, can be used for making and developing coffee fruit wine, and has a plurality of application prospects.

The invention provides a Kluyveromyces Pichia (Pichia kluyveri) FJY-4 strain which is deposited in the microorganism strain collection of Guangdong province at the month 13 of 2023, with the deposit number of GDMCC No:63349.

in view of the fact that the FJY-4 strain has excellent pectase activity and is little influenced by temperature, the pectase activity is higher under the low-temperature condition. Therefore, the application of the FJY-4 strain in preparing pectase is protected.

The FJY-4 strain can realize quick degumming of coffee under the low-temperature condition, and has strong temperature adaptability. Therefore, the invention also claims the application of the FJY-4 strain in biological degumming of coffee.

The invention also claims the application of the FJY-4 strain in preparing a preparation for biological degumming of coffee.

The FJY-4 strain can be used for producing ethanol by utilizing coffee peel, can be used for developing and producing coffee fruit wine, realizes recycling of the coffee peel, and avoids resource waste. Therefore, the invention also claims the application of the FJY-4 strain in preparing ethanol by using coffee pericarp.

The invention also claims the application of the FJY-4 strain in preparing a preparation for preparing ethanol by fermenting coffee peel.

The invention also claims the application of the FJY-4 strain in preparing coffee fruit wine.

The invention also claims the application of the FJY-4 strain in preparing a preparation for preparing coffee fruit wine.

The invention also provides a method for performing biological degumming on coffee by using the FJY-4 strain, which comprises the following steps: taking FJY-4 strain to culture to OD ₆₀₀ And (3) centrifuging to leave thalli when the thalli are 2.5-3.5, re-suspending the thalli by using sterile water, and adding the thalli into peeled coffee beans soaked by the sterile water.

Specifically, single colony of FJY-4 is selected and inoculated in YPD liquid culture medium, and shake culture is carried out until OD under the conditions of 26-28 ℃ and 160-200 r/min ₆₀₀ Centrifugation to obtain thalli, and resuspension with sterile water, =3.0; peeling off outer and middle pericarp of 200g fresh coffee fruit, placing into a clean keg, pouring 40mL1×10 ⁶ And (3) adding sterile distilled water into the bacterial suspension of the FJY-4 strain of cells/mL until coffee beans are immersed, uniformly stirring, and fermenting at 4-28 ℃.

The invention also provides a method for preparing coffee fruit wine by using the FJY-4 strain, which comprises the following steps:

s1, pretreatment of coffee peel: placing the sterilized coffee peel into a fermentation container, and soaking in water according to the mass-volume ratio of the coffee peel to the water of 1:2-3;

s2, fermenting coffee fruit wine: taking FJY-4 strain to culture to OD ₆₀₀ Centrifuging at 7.5-8.5, cleaning the thalli with sterile water, adding the thalli into a fermentation container, and standing and culturing at 26-30 ℃ for 68-76 hours.

Specifically, the pretreatment of the coffee pericarp is as follows: steaming dried coffee cherry husks in a steamer for 15 minutes to sterilize; then transferring the mixture to a fermentation bottle, adding water according to the ratio of 1:3 (w/v), and soaking for 5 hours at normal temperature.

Specifically, coffee fruit wine is fermented: FJY-4 was activated in YPD medium to reach its OD ₆₀₀ When the concentration reaches 8.0, 10mL of thalli are collected by centrifugation; after three times of cleaning with sterile water, the thalli are transferred into a fermentation bottle for static culture for 72 hours at 28 ℃.

The invention has the following beneficial effects:

the invention provides a Pichia pastoris (Pichia kluyveri) FJY-4 strain derived from small-grain coffee, which has excellent pectase activity, keeps high pectase activity under the condition of low temperature (6 ℃), is higher than normal temperature, and has strong temperature adaptability, thus being applicable to biological degumming of coffee. Proved by verification, the FJY-4 strain can complete the decomposition of the colloid of the coffee beans under the conditions of normal temperature (28 ℃) or low temperature (6 ℃), has high degumming efficiency, greatly improves the purification rate of the pectin of the coffee, has the potential of developing into a biological agent for coffee fermentation, can obviously save the production cost of the raw beans of the coffee when being used for coffee fermentation, and reduces the water resource consumption and the wastewater discharge.

In addition, the FJY-4 strain can also be used for producing ethanol by fermenting coffee peel, and can be developed into a coffee peel distilled liquor fermentation strain. The FJY-4 strain can also be used for producing ethanol by glucose fermentation, can also be developed into bioethanol starter and is applied to ethanol production. The FJY-4 strain is non-toxic to human body, convenient to use, safe and environment-friendly, has good application prospect and has remarkable environmental benefit, economic benefit and social benefit.

Drawings

FIG. 1 shows colony morphology of FJY-4 strain.

FIG. 2 shows the bacterial morphology of FJY-4 strain.

FIG. 3 is a tandem phylogenetic tree of FJY-4 strain based on ITS and 26S rDNA D1/D2 region sequences.

FIG. 4 is a graph showing the comparison of the degumming effect of FJY-4 strain on coffee beans.

FIG. 5 shows a BSA protein content standard curve.

FIG. 6 shows D-galacturonic acid standard curve.

FIG. 7 shows PG enzyme activities of FJY-4 strain under 28℃and 6℃coffee pectin fermentation conditions; ^* p<0.05。

FIG. 8 is a graph of ethanol vapor phase standard curve.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

The FJY-4 strain of the embodiment of the invention is Pichia kluyveri (Pichia kluyveri), which is deposited in the microorganism strain collection of Guangdong province at 2023, 4 and 13 days with the deposit number of GDMCC No:63349 the preservation address is building No. 100 and building No. 59 in the Mitsui of Guangzhou City of Guangdong.

PDA medium: 200g of potato, and adding a proper amount of ddH ₂ O, boiling for 20min, filtering with four layers of gauze, adding glucose 20g, agar 20g, ddH ₂ O is fixed to 1000mL, and the pH is natural; sterilizing at 121deg.C for 20min.

YPD medium: peptone 20g, yeast extract 10g, glucose 20g, agar 20g, ddH ₂ O is fixed to 1000mL, and the pH is natural; sterilizing at 121deg.C for 20min.

EXAMPLE 1 isolation and characterization of FJY-4 Strain

1. Isolation of FJY-4 Strain

The FJY-4 strain is separated from Yunnan small-grain coffee (Coffea arabica L.), and the specific separation process is as follows:

selecting undamaged fresh coffee fruits, washing surface impurities with soapy water and tap water, and sucking the surface water by filter paper. The fresh coffee fruit is divided into a whole fruit, pulp and a fruit pit 3 part material, and the materials are respectively sterilized. Sterilization procedure: (1) complete fresh fruit: soaking in 75% alcohol for 1min, rinsing with sterile water for 1 time, soaking in 2.5% sodium hypochlorite for 10min, and rinsing with sterile water for 4 times; (2) pulp: soaking in 75% alcohol for 1min, rinsing with sterile water for 1 time, soaking in 2.5% sodium hypochlorite for 5min, and rinsing with sterile water for 4 times; (3) fruit pits: soaking in 75% alcohol for 1min, rinsing with sterile water for 1 time, soaking in 2.5% sodium hypochlorite for 10min, and rinsing with sterile water for 4 times; the final rinsing liquid is respectively collected and coated on PDA and NA culture mediums, and is respectively cultured at 28 ℃ and 37 ℃ and aseptically grown after 1-2 d, thus indicating that the surface is thoroughly disinfected.

After the surface water was removed by suction with sterile filter paper, the different tissues were placed in a sterile mortar, a proper amount of sterile water was added, and the ground solution was diluted (10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 ) 100 mu L of the strain is sucked onto a PDA culture medium, the strain is uniformly coated by a sterile coater, the strain is placed in a dark incubator at 28 ℃ for culturing for 1-2 d until colonies grow out, the colony morphology is observed, single colonies with different morphologies are picked up and purified on a YPD plate, a glycerol preservation method is adopted after new strains grow out for numbering, and the strain is preserved at-80 ℃.

2. Morphological identification of FJY-4 Strain

The FJY-4 strain was streaked on YPD solid medium and cultured at 28℃for 48 hours to observe colony morphology. Single colonies were picked and placed in 50. Mu.L of sterile water, 5. Mu.L was pipetted onto a slide, and then observed for bacterial status under an optical microscope at 100-fold magnification. The colony morphology of the FJY-4 strain is shown in FIG. 1, and the cell morphology of the FJY-4 strain is shown in FIG. 2. As can be seen from FIGS. 1 and 2, the colony of FJY-4 strain is round, milky white, irregular in edge, wrinkled on the surface and opaque; the strain is single-cell fungus and takes the shape of an oval.

3. Molecular biological identification of FJY-4 Strain

(1) The FJY-4 strain is activated in YPD solid culture medium, cultured for 48h at 28 ℃, inoculated in YPD liquid culture medium and placed in a shaking table at 28 ℃ and 180r/min for 12h.

(2) PCR amplification

The extraction method of the FJY-4 strain genome DNA is carried out according to the OMEGA fungus DNA extraction kit method, the obtained genome DNA is used as a template, and the ITS rRNA primer and the 26S rDNA D1/D2 region sequence primer are respectively used for PCR amplification; the primer sequences are shown below:

ITS rRNA primer:

ITS3：5’-GATGAAGAACGYAGYRAA-3’；

ITS4：5’-TCCTCCGCTTATTGATATGC-3’；

26S rDNA D1/D2 region sequence primer:

NL-1：5’-GCATATCAATAAGCGGAGGAAAAG-3’；

NL-4：5’-GGTCCGTGTTTCAAGACGG-3’；

the PCR reaction system (25. Mu.L total) was: 2 XPCR Buffer 12.5. Mu.L, 2mM dNTPs 5. Mu.L, 10pmoL/mL upstream primer 0.75. Mu.L, 10pmoL/mL downstream primer 0.75. Mu.L, KOD FX (1.0U/. Mu.L) 0.5. Mu. L, DNA 1.0.0. Mu. L, ddH ₂ O4.5. Mu.L. The PCR amplification procedure was: pre-denaturation at 94℃for 5min, denaturation at 98℃for 10s, annealing at 58℃for 30s, extension at 68℃for 40s, total of 35 cycles, and extension at 68℃for 5min.

(3) Sequence determination and construction of phylogenetic tree

The PCR products were sent to Kunming engine technologies for sequencing, and the sequencing results were BLAST-aligned in NCBI database with ITS sequences and 26S rDNA D1/D2 region sequences of known strains.

The ITS sequence (5 '-3') of FJY-4 strain is shown as follows (SEQ ID NO. 1):

TGAGGGTGACTGCGGAGGTCATTACTGTGATTTATATCTTATACACATGCGTGAGCGCACCAAACACCTAAAATTGTAATAATACCAGTCACTAAGTTTTAACAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCATGGTATTCCATGGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGCGCAAGCAGAGTTGAGAACAGGCTATGCCTTTTTCGAAATGGAACGTCGTGGACGAAGTGAACTAAACTTTTAGCACGCTTTGGCCGCCGAACTTTTAACTAAGCTCGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCTAAAA

the sequence of the region 26S rDNA D1/D2 (5 '-3') of the FJY-4 strain is shown as follows (SEQ ID NO. 2):

AACCGGGTCTTGCCTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCTCACCTAGTGTGCGAGTTGTAAATTGCAGGTTGGAGTCTCGGGTTAGACGTGTGTGCAAGTCCCTTGGAACAGGGCGCCACTGAGGGTGAGAGCCCCGTAGCGTGCATGTCGACACCTGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCTCGACATGGGATTTACGCATCGTTGCCTCTCGTGGGCGGCGCTCTGGGTTTTTCCTGGGCCAGCATCGGTTTTCGTTGCAGGATAAGGACAATTGGAATGTGGCTCCTCGGAGTGTTATAGCCTTTTGTAGATGCTGCGTATGGGGACCGAGGGCTGCGGCGGACTCGTTTCGTCTCGGATGCTGGCACAACGGCGCAATACCGCCCGTCTAAAAACGCGGGGCCCCA

the comparison result shows that the similarity between the FJY-4 strain and ITS sequences and 26SrDNA D1/D2 region sequences of a plurality of Kluyveromyces pichia strains is more than 98%. Meanwhile, the invention constructs a phylogenetic tree by using MEGA 11 software and a neighbor-joining method, and a tandem evolutionary tree of the FJY-4 strain based on ITS and 26S rDNA D1/D2 region sequences is shown in figure 3. As can be seen from FIG. 3, the FJY-4 strain was closest to the reported affinity of Kluyveromyces pichia. Combining morphological and molecular identification results, the FJY-4 strain is identified as Pichia kluyveri (Pichia kluyveri) which is deposited at the microorganism strain collection in Guangdong province at 4.13 of 2023 with the deposit number of GDMCC No:63349 the preservation address is building No. 100 and building No. 59 in the Mitsui of Guangzhou City of Guangdong.

EXAMPLE 2 degumming Effect of FJY-4 Strain on coffee beans

Inoculating FJY-4 strain on YPD solid culture medium, culturing at 28deg.C for 1-2 d until single colony grows, picking single colony, placing into 250mL conical flask containing 100mL YPD liquid culture medium, shake culturing at 28deg.C under 180r/min to OD ₆₀₀ =3.0, centrifuged at 5000r/min for 15min, resuspended in 40mL sterile water. Peeling off outer and middle pericarp of 200g fresh coffee fruit, placing into a clean keg, pouring 40mL1×10 ⁶ Adding sterile distilled water into bacterial suspension of FJY-4 strain of cells/mL, immersing coffee bean, stirring, and placing in constant temperature boxes at 25deg.C and 4deg.C respectivelyFermenting and recording degumming time; coffee beans without FJY-4 strain were used as control.

The comparison of the degumming effect of FJY-4 strain on coffee beans is shown in FIG. 4. As can be seen from FIG. 4, the degradation of the pectin layer of the coffee beans can be completed by adding FJY-4 strain for fermentation for 3 hours at 25 ℃ or adding FJY-4 strain for fermentation for 5 hours at 4 ℃, the surface of the degummed coffee beans is clean, and the pectin layer under the natural fermentation condition (without the FJY-4 strain) is not remarkably reduced compared with the pectin layer of the coffee beans for 0h after normal fermentation. The results show that the FJY-4 strain can degrade coffee pectin, and the temperature application range is wide when the coffee pectin is degraded, and the degumming capability is strong.

EXAMPLE 3 determination of pectase Activity of FJY-4 Strain

50g of fresh coffee pericarp is taken and placed in 150mL of 0.5% hydrochloric acid, and heated and boiled for 15-20 min; filtering the pericarp with gauze while the pericarp is hot, and adjusting the pH of the filtrate to 3-4; 75mL of 95% ethanol is added, mixed with 50mL of filtrate and stirred slightly, the mixture is stood for precipitating floccule, the floccule is filtered and taken out, the water is squeezed out, and filter residues are the coffee pectin.

Preparing fermentation medium (coffee pectin 10g/L, KCl 0.3g/L, K) with coffee pectin as substrate ₂ HPO ₄ 0.4g/L, yeast powder 10g/L, ddH ₂ O constant volume to 1000mL, sterilizing at 121deg.C for 20 min), inoculating FJY-4 strain, fermenting at 6deg.C and 28deg.C respectively, fermenting coffee pectin, collecting fermentation broth supernatant after 48 hr, and measuring pectase activity. The measurement method is as follows:

(1) Crude protein concentration determination

(1) BSA standard curve formulation: BSA standard solution was prepared according to Table 1

Table 1BSA standard solution formulation

100 mu L of the uniformly mixed solution is respectively sucked from a No. 1-6 tube, and 5mL of Bradford color development liquid is added; fully and uniformly mixing, standing for 5min, taking a tube 1 as a blank control, and measuring the light absorption value at 595 nm; to be used forBSA standard concentration is X-axis, OD _{595 nm} And the absorbance value is the Y axis to make a standard curve.

Bradford color development solution: 35mg of Coomassie brilliant blue G-250 was weighed and dissolved in 25mL of a mixture of 95% ethanol and 50mL of 88% phosphoric acid, and ddH was added ₂ O is fixed to 500mL, and the qualitative filter paper is stored in a brown bottle for standby after being filtered.

(2) Sample protein concentration determination: inoculating FJY-4 strain on YPD culture medium, culturing at 28 ℃ for 1-2 d until single colony grows, picking single colony, placing the single colony into a 250mL conical flask containing 100mL YPD liquid culture medium, and shake culturing at 28 ℃ under 180r/min for 24h to obtain seed liquid; 1mL of seed solution is inoculated into 25mL of fermentation medium for fermentation culture, after 48h of shaking culture at 28 ℃ and 6 ℃ and 180r/min respectively, centrifugation is carried out at 4 ℃ and 8000r/min for 15min, and the obtained supernatant is crude enzyme solution.

100 mu L of crude enzyme liquid sample is taken respectively, 5mL of Bradford chromogenic liquid is added, the mixture is fully and uniformly mixed, and then the mixture is stood for 5min, the light absorption value of the sample is measured at 595nm by taking a tube No.1 in Table 1 as a blank control, and the protein concentration of the measured sample is calculated by using a standard curve.

(2) Determination of Polygalacturonase (PG) Activity

(1) Formulation of D-galacturonic acid standard curve: preparing 1mg/mL D-galacturonic acid standard solution, taking 9 test tubes, adding 0, 20, 40, 60, 80, 100, 120, 140 and 160 μL standard solution respectively, adding 0.5mL DNS reagent, mixing thoroughly, boiling water bath for 5min, taking out, cooling to room temperature with cold water, and adding ddH ₂ O, the volume of each tube is fixed to 4mL, the tubes are uniformly mixed, a test tube No.1 without the D-galacturonic acid standard solution is used as a blank control, and the light absorption value is measured at 520 nm; the content of D-galacturonic acid (μg) is taken as X axis, OD _{520 nm} And the absorbance value is the Y axis to make a standard curve.

(2) PG Activity assay: mixing 400 μl crude enzyme solution, 400 μl 1% PGA solution (prepared from 0.05mol/L acetic acid-sodium acetate buffer, pH 5.0) and 400 μl 50mmol/L acetic acid-sodium acetate buffer, respectively, thoroughly, heating in 45deg.C water bath for 30min, adding 0.6mL DNS reagent to terminate the reaction, boiling for 5min, immediately cooling to room temperature with cold water, adding 2.2 to each tubemL ddH ₂ O, shake well, measure its OD _{520 nm} Numerical values, blank control was added with an equal amount of inactivated crude enzyme solution. After the measurement, the corresponding D-galacturonic acid content was found on the standard curve. The enzyme activity units of PG are defined as: at 45℃1mg of crude protein was used to decompose pectin to 1mg of D-galacturonic acid in 1min with an enzyme amount of 1 enzyme activity unit (U.mg ^-1 ·min ^-1 )。

PG enzyme activity (U mg) ^-1 min ^-1 )＝(A ₁ ×N×K ₂ )/(A ₂ ×0.4×K ₁ ×T)

A ₁ : OD of experimental group ₅₂₀ A value; a is that ₂ : OD of experimental group ₅₉₅ A value; 0.4: volume of enzyme solution (mL) used in enzyme activity measurement; k (K) ₁ : slope of D-galacturonic acid standard curve; k (K) ₂ : slope of BSA standard curve; t: the reaction time (min) was 30min; n: supernatant dilution fold.

The BSA protein content standard curve is shown in FIG. 5. And (3) carrying out linear regression by taking the concentration of the BSA standard solution as an abscissa and the light absorption value at 595nm as an ordinate to obtain a BSA protein content standard curve equation: y=0.8123x+0.0169 (R ² =0.9965). When the coffee pectin is used as a substrate, the protein concentration of the FJY-4 fermentation liquor at 28 ℃ is 0.203+/-0.007 mg/mL, and the protein concentration of the FJY-4 fermentation liquor at 6 ℃ is 0.013+/-0.004 mg/mL.

The D-galacturonic acid standard curve is shown in FIG. 6. And (3) carrying out linear regression by taking the D-galacturonic acid sugar content as an abscissa and the light absorption value at 520nm as an ordinate to obtain a D-galacturonic acid standard curve equation: y=0.0044 x-0.0116 (R ² =0.9900). PG enzyme activities of FJY-4 strain under 28 ℃ and 6 ℃ coffee pectin fermentation conditions are shown in FIG. 7. As can be seen from FIG. 7, when coffee pectin is used as a substrate, the PG enzyme activity of FJY-4 strain is 106.36 U.mg at 28 ℃ and 6 DEG C ^-1 ·min ^-1 And 151.58 U.mg ^-1 ·min ^-1 The method comprises the steps of carrying out a first treatment on the surface of the The FJY-4 strain has higher PG enzyme activity under the condition of 6 ℃ and has obvious difference (in the figure ^* Indicating significant differences (p<0.05))。

Example 4 determination of ethanol fermentation Performance of FJY-4 Strain

The nitrogen source required for the ethanol fermentation culture is added according to the components of YPD culture medium, and the culture medium used for fermentation contains 10g/L yeast powder, 20g/L peptone and 180g/L glucose. Inoculating FJY-4 strain on YPD culture medium, culturing at 28 ℃ for 1-2 d until single colony grows, picking single colony, placing the single colony into a 250mL conical flask containing 100mL YPD liquid culture medium, and shake culturing at 28 ℃ under 180r/min for 24h to obtain seed liquid; inoculating 5mL of seed solution into 100mL of fermentation medium for fermentation culture, shaking culture at 28 ℃ for 54h at 150r/min, and centrifuging at 4 ℃ for 15min at 8000r/min to obtain supernatant. The supernatant obtained by fermentation is filtered by a needle filter membrane with the diameter of 0.22 mu m to obtain a sample liquid. The method for measuring the ethanol concentration of the sample liquid is the same as that of the standard liquid.

Drawing an ethanol gas phase standard curve:

ethanol standard solutions of 0, 0.5, 1, 2.5, 5, 10 and 20mg/mL were prepared respectively. N-propanol is selected as an internal standard, and chromatographic grade n-propanol is used for preparing 10mg/mL internal standard solution.

500. Mu.L of each prepared ethanol standard solution and each prepared internal standard solution were mixed in a 2mL centrifuge tube, filtered through a 0.22 μm needle filter membrane into a gas phase bottle using a 1mL syringe, and the gas phase bottle was sealed with a cap and placed into a gas chromatograph for measurement.

The ethanol concentration was analyzed and detected by gas chromatography. The temperature of the sample injector of the gas chromatograph is 300 ℃; the chromatographic column has the specification that: TG-WAXMX (30 m. Times.0.25 mm. Times.0.50 μm); the column temperature box adopts the programming temperature: the initial temperature is 33 ℃, and the temperature is kept for 5min; heating to 100 ℃ at 10 ℃/min; then heating to 250 ℃ at 50 ℃/min; finally, keeping the temperature at 250 ℃ for 5min; the temperature of the detector is controlled at 250 ℃, wherein the carrier gas is nitrogen, and the flow rate is 30mL/min; the flow rate of hydrogen is 40mL/min; the air flow rate is 350mL/min; the sample injection amount of each operation is 0.5 mu L.

The ethanol gas phase standard curve is shown in figure 8. Taking the ethanol concentration as an abscissa and the ratio of the ethanol peak area to the internal standard peak area as an ordinate, and performing linear regression to obtain the equation: y= 0.0905x-0.023 (R ² =0.9990). Performing fermentation culture on FJY-4 by taking 180g/L glucose as a carbon source, stopping fermentation after 54 hours, centrifuging the fermentation liquidAnd taking supernatant, diluting for 2 times, mixing with 500 mu L of each internal standard, filtering with a 0.22 mu m needle filter membrane, and performing gas phase analysis. According to analysis, the concentration of the ethanol of FJY-4 reaches 50.46g/L.

Example 5 fermentation of FJY-4 Strain to produce coffee fruit wine

The FJY-4 strain can also be used for preparing ethanol by using coffee peel, and can be used for developing coffee fruit wine. The method for preparing the coffee fruit wine by using the FJY-4 strain comprises the following steps:

(1) Pretreatment of coffee pericarp

Taking 0.5kg of dried coffee peel, placing the dried coffee peel in a steamer for steaming for 15 minutes to sterilize; subsequently, it was transferred to a 5L fermenter, and water was added at a ratio of 1:3 (w/v), and immersed for 5 hours at room temperature.

(2) Coffee fruit wine fermentation

FJY-4 was activated in YPD medium to reach its OD ₆₀₀ When the concentration reaches 8.0, 10mL of thalli are collected by centrifugation; cleaning with sterile water for three times, transferring the thalli into the fermentation bottle containing coffee pericarp, and standing and culturing for 72h at 28 ℃; after the fermentation is finished, 5mL of the fruit wine is used for headspace solid phase microextraction (HS-SPME) combined with gas chromatography-mass spectrometry (GC-MS).

The FJY-4 strain has excellent pectase activity and is beneficial to the dissolution of soluble sugar in coffee peel. After the coffee pericarp is fermented, the content of soluble sugar in the pericarp is reduced by at least 90% compared with the untreated pericarp, which indicates that FJY-4 can effectively utilize the soluble sugar in the coffee pericarp. HS-SPME-GC-MS analysis results show that more than 30 volatile components are detected in the coffee fruit wine, mainly alcohols, esters and acids, and the alcohol concentration of the coffee fruit wine is 19.8g/L, so that the coffee fruit wine has certain bouquet and rich coffee aroma, lays a foundation for the next preparation of the coffee peel distilled wine, and can be used for making and developing the coffee fruit wine.

EXAMPLE 6 food safety test of FJY-4 Strain

ICR mice with the weight range of 18-22 g are selected to be bred in 8 cages, wherein each cage is 5 female mice or 5 male mice. Gastric lavage test is carried out after 2 days of adaptation in the animal center ABSL-2 raising area (20-26 ℃ C., relative humidity 40-70%) of Yunnan university.

According to GB 15193.3-2014 national food safety Standard acute oral toxicity test, mice are fasted for 4 hours before the test, and the mice need to continue to fasted for 1 hour after being given with FJY-4 bacterial suspension, and drinking water is free during the fasted period. FJY-4 bacterial liquid OD ₆₀₀ =3.0, resuspended for use after rinsing twice with sterile water. The stomach-filling doses of the mice are respectively 0, 5, 10 and 15g/kg, and the stomach-filling volume is 30mL/kg. All mice were observed continuously for 7 days after gavage and the death number of the mice was recorded.

The results of the food safety test of the FJY-4 strain are shown in Table 2. As can be seen from Table 2, the mice did not die or become toxic after 7 days of gastric lavage, and the test period was active, indicating that the FJY-4 strain was safe and nontoxic.

TABLE 2 death of mice at different lavage doses

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims (10)

1. A strain of Pichia kluyveri (Pichia kluyveri) FJY-4, wherein said strain was deposited at the collection of microorganism strains in the cantonese province at month 13 of 2023 under accession number GDMCCNo:63349.

2. use of the FJY-4 strain of claim 1 in the preparation of pectase.

3. Use of the FJY-4 strain of claim 1 in biological degumming of coffee.

4. Use of the FJY-4 strain of claim 1 for the preparation of a formulation for biological degumming of coffee.

5. Use of the FJY-4 strain of claim 1 for the preparation of ethanol from coffee cherry husks.

6. Use of the FJY-4 strain of claim 1 for preparing a preparation for preparing ethanol by fermenting coffee cherry husks.

7. Use of the FJY-4 strain of claim 1 in the manufacture of coffee fruit wine.

8. Use of the FJY-4 strain of claim 1 in the preparation of a formulation for making coffee fruit wine.

9. A method for biological degumming of coffee using the FJY-4 strain of claim 1, comprising: taking FJY-4 strain to culture to OD ₆₀₀ And (3) centrifuging to leave thalli when the thalli are 2.5-3.5, re-suspending the thalli by using sterile water, and adding the thalli into peeled coffee beans soaked by the sterile water.

10. A method for preparing coffee fruit wine using the FJY-4 strain of claim 1, comprising the steps of:

s1, pretreatment of coffee peel: placing the sterilized coffee peel into a fermentation container, and soaking in water according to the mass-volume ratio of the coffee peel to the water of 1:2-3;

s2, fermenting coffee fruit wine: taking FJY-4 strain to culture to OD ₆₀₀ Centrifuging at 7.5-8.5, cleaning the thalli with sterile water, adding the thalli into a fermentation container, and standing and culturing at 26-30 ℃ for 68-76 hours.