CN114409741B

CN114409741B - PCV2, PCV3 and PCV4 triple subunit vaccine, and preparation method and application thereof

Info

Publication number: CN114409741B
Application number: CN202111457334.8A
Authority: CN
Inventors: 任林柱; 吉卫龙; 牛谷雨; 欧阳红生; 逄大欣
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2021-12-02
Filing date: 2021-12-02
Publication date: 2023-04-21
Anticipated expiration: 2041-12-02
Also published as: CN114409741A

Abstract

The invention relates to a PCV2, PCV3 and PCV4 triple subunit vaccine and a preparation method thereof, wherein the triple subunit vaccine comprises three recombinant proteins, namely PCV2Cap protein, PCV3Cap protein and PCV4Cap protein, wherein the PCV2Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.1 and shown by escherichia coli, the PCV3Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.2 and shown by escherichia coli, and the PCV4Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.3 and shown by escherichia coli. Can be used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection, obviously improves the immunogenicity of the PCV2, PCV3 and PCV4, and can induce the animals to produce high-titer antibodies after immunization.

Description

PCV2, PCV3 and PCV4 triple subunit vaccine, and preparation method and application thereof

Technical Field

The invention belongs to the field of virus molecular biology technology and genetic engineering, and in particular relates to a porcine circovirus type 2 (Porcine circovirus, PCV 2), a porcine circovirus type 3 (Porcine circovirus, PCV 3) and a porcine circovirus type 4 (Porcine circovirus, PCV 4) triple subunit vaccine and a preparation method thereof, wherein the Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 prepared artificially can be used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection.

Background

Porcine circovirus (Porcine circovirus, PCV) belongs to the genus circovirus of the family circoviridae in taxonomlogy, and is one of the smallest animal viruses found so far, with a diameter of 12-23nm. The virus particles have a diameter of 14-17nm, are of a 20-plane symmetrical structure, have no envelope, contain covalently closed single-stranded circular negative strand DNA, and have a genome size of about 1.7kb-2kb. Based on the differences in nucleotide sequence, pathogenicity and antigenicity of porcine circovirus, three subtypes, PCV1, PCV2 and PCV3, respectively, wherein PCV1 is considered nonpathogenic, PCV2 and PCV3 are major pathogens of weaned pig multisystemic wasting syndrome (Postweaning Multisystemic Wasting Syndrome, PMWS), PDNS (pigskin inflammation and nephrotic syndrome), PNP (hyperplastic necrotizing pneumonia) and PRDC (porcine respiratory disease syndrome). PMWS was first found in Canada (1991) and soon occurred and became popular in Europe and America and Asia in some countries including China, and in addition, diseases such as reproductive disorders, congenital tremors, enteritis and the like were also associated with PCV2 and PCV3 infections.

PCV2 and related swine diseases have mortality rate of about 10% -30%, and the death rate of swine farms with severe epidemic situations is sometimes up to 40%, which causes huge economic loss to the pig industry. The reason for this is that PCV-2 infection can cause immunosuppression of pigs, thereby reducing the resistance of organisms to other various pathogens. Common mixed infectious pathogens with PCV2 include PRRSV (porcine reproductive and respiratory syndrome virus), PRV (porcine pseudorabies virus), PPV (porcine parvovirus), mycoplasma hyopneumoniae and other diseases, wherein double infection or triple infection is common, and the death rate of sick pigs is greatly improved to about 25% -40%. PCV3 found in 2016 and PCV4 found in 2019 were also high in positive rate in pigs at home, but their pathogenicity and host profile were still to be studied further. Studies have reported that PCV3 and PCV4 may also be associated with respiratory diseases, diarrhea and dermatitis in pigs, nephrotic syndrome, etc. PCV4 virus has not been successfully isolated and no commercial vaccine was used for immunization, but few studies on PCV3 and PCV4 vaccines have been reported, and few more vaccines are available.

Subunit vaccines (subnit vaccinees) are produced by introducing a protective antigen gene encoding a pathogenic microorganism into a recipient such as a bacterial, yeast or animal cell for efficient expression. After the protective antigen is separated and purified, the vaccine which can induce the organism to produce antibody and immune protection, has high safety and good stability, does not need to be inactivated and does not contain nucleic acid is prepared by combining the protective antigen with an adjuvant. Although many different classes of proteins are successfully expressed in vitro by genetic engineering techniques, protein purification techniques in downstream work of subunit vaccine production are not yet mature enough. The subunit vaccine separation and purification costs are counted to be about 60% -80% of the total cost. At present, the food safety requirements are higher and higher, the national policies and regulations are stricter, the industry faces integration and recombination, the market quality competitiveness needs to be improved, the requirements of accurate immunity are met, the upstream development is rapid, and the factors indicate that the purification and research and development of veterinary vaccines are more and more important.

It is important to note that the gene homology of PCV2, PCV3 and PCV4 is low, but whether the cross-protective ability between the related antibodies is provided has yet to be verified. In addition, there are no reports of research on triple subunit vaccines of PCV2, PCV3 and PCV4 and methods for preparing the same.

Disclosure of Invention

The invention provides a PCV2, PCV3 and PCV4 triple subunit vaccine and a preparation method thereof, which can be used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection, obviously improves immunogenicity of the PCV2, PCV3 and PCV4, and can induce animals to generate high-titer antibodies after immunization.

The invention provides an immunogenic composition, which comprises three recombinant proteins, namely PCV2Cap protein, PCV3Cap protein and PCV4Cap protein, wherein the PCV2Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.1 and shown by escherichia coli, the PCV3Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.2 and shown by escherichia coli, and the PCV4Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.3 and shown by escherichia coli.

As a more preferable technical scheme of the invention, PCV2Cap protein, PCV3Cap protein and PCV4Cap protein in the immunogenic composition are mixed in equal proportion.

The invention also provides a PCV2, PCV3 and PCV4 triple subunit vaccine comprising the immunogenic composition and an adjuvant.

The invention also provides a preparation method of the triple subunit vaccine, which comprises the following steps:

constructing a nucleotide sequence shown as SEQ ID NO.1 on an expression vector, and converting the expression vector into escherichia coli to express to obtain PCV2Cap protein;

constructing a nucleotide sequence shown as SEQ ID NO.2 on an expression vector, and converting the expression vector into escherichia coli to express to obtain PCV3Cap protein;

constructing a nucleotide sequence shown as SEQ ID NO.3 on an expression vector, and converting the expression vector into escherichia coli to express to obtain PCV4Cap protein;

preparing a triple subunit vaccine by mixing PCV2Cap protein, PCV3Cap protein and PCV4Cap protein mixed solution with an adjuvant; the subunit vaccine has good immunogenicity, and can induce high-titer antibodies after being immunized on animals, so as to simultaneously prevent and treat PCV2, PCV3 and PCV4 infection.

As a better technical scheme of the invention, the mixed solution contains PCV2Cap protein, PCV3Cap protein, PCV4Cap protein and other mass ratios.

As a better technical scheme of the invention, the volume ratio of the mixed solution to the adjuvant is 1:1.

the invention also provides application of the immunogenic composition in preparation of medicines for immunizing porcine circovirus types 2, 3 and 4.

The invention also provides a biological material, which comprises nucleic acid shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and is an expression vector or recombinant protein positive expression bacterium.

As a better technical scheme of the invention, the expression vector is formed by respectively inserting gene sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 into pET-28a (+) plasmids, and three prokaryotic expression plasmids are pET-28a (+) -PCV 2-delta 16-235Cap, pET-28a (+) -PCV 3-delta 23-214Cap and pET-28a (+) -PCV 4-delta 21-228Cap.

As a better technical scheme of the invention, the recombinant protein positive expression bacteria Rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4 are obtained by respectively transferring the three prokaryotic expression plasmids into competent cells of escherichia coli Rosetta (DE 3).

The PCV2Cap protein, PCV3Cap protein and PCV4Cap protein in the immunogenic composition provided by the invention are prepared by purifying recombinant protein positive expression bacteria Rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4 based on escherichia coli Rosetta (DE 3) under the induction of IPTG. The induction expression conditions are as follows: the recombinant protein positive strains Rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4 were cultured to OD600 of 0.6-1.0, induced with 0.8mM IPTG for 10 hours, 0.8mM IPTG for 8 hours, 1.4mM IPTG for 10 hours, respectively, and then the expressed protein products were recovered, and three recombinant proteins PCV2Cap, PCV3Cap and PCV4Cap were prepared by the processes of ultrasonic treatment and purification, etc.

The invention also provides an antibody titer detection method (iELISA method) after animals are immunized by PCV2, PCV3 and PCV4Cap protein triple subunit vaccine, which comprises the following steps:

s1, mixing three recombinant proteins PCV2Cap, PCV3Cap and PCV4Cap in equal proportion (mass ratio) with Freund' S complete adjuvant 1:1 (volume ratio) uniformly mixing and fully emulsifying, wherein the obtained solution is used as an immunoreagent, and positive serum and negative serum collected after the fourth immunization are respectively subjected to equal-ratio dilution;

s2, adding the target protein, namely the antigen, into a coating solution [0.05M Carbonate Buffer (CBS): naCO ₃ 1.59 g of NaHCO ₃ Distilled water was added to 2.93 grams to 1000ml, ph=9.6]Medium diluted to 2 mug/mL, 0.1mL per well, overnight at 4 ℃ for more than 12 hours;

s3, washing with PBS-T (PBS, 0.05% Tween-20) three times for 5min each time, and then adding 0.1mL of blocking solution (PBS-T of 5% FBS) into each hole to block for 2h at 37 ℃;

s4, respectively mixing the negative serum and the positive serum according to the following ratio of 1: 50. 1: 200. 1: 800. 1: 3200. 1: 12800. 1: 51200. 1:204800 and 1:819200 ratio was diluted with blocking solution and then 0.1mL was added per well, three replicates per group, incubated at 37 ℃ for 1.5h;

s5, washing with PBS-T three times for 5min each time, and then adding 0.1mL of blocking solution 1:250 dilution of HPR-labeled goat anti-rabbit IgG (H+L), incubation at 37℃for 1H;

s6, washing with PBS-T three times for 5min each time, adding 0.1mL into each hole, reacting at 37 ℃ in dark place for about 10min, and adding 2M H into each hole ₂ SO ₄ Terminating the reaction;

s7, detecting an OD450 value of each hole on an enzyme label instrument; when the value of the positive serum hole is more than 2.1 of the negative serum, the positive serum hole is positive, so that the serum titer is obtained.

The Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 provided by the invention is produced by taking the artificially prepared PCV2, PCV3 and PCV4Cap proteins as antigens and referring to the production process of subunit vaccine, and immune adjuvant, vaccine excipient and the like can be added into the triple subunit vaccine, so that the triple subunit vaccine can be easily produced by a person skilled in the art.

The Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 prepared by the invention has good immunogenicity, and the generated serum antibody has high titer, can be used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection, and can achieve better immune protection effect.

The preparation method disclosed by the invention is suitable for artificially preparing the triple subunit vaccine of PCV2, PCV3 and PCV4, and the obtained triple subunit vaccine of PCV2, PCV3 and PCV4 can be used for preventing and controlling PCV2, PCV3 and PCV4 infection. In addition, the PCV2, PCV3 and PCV4Cap proteins prepared by the method can also be used for preparing ELISA detection methods of PCV2, PCV3 and PCV4, and have wide application prospects in clinical and laboratory researches.

Drawings

FIG. 1 expression plasmid PCR identification. A: pET-28a (+) -PCV2- Δ16-235Cap (2C); b: pGM-T-PCV 3-Delta23-214 Cap (3C); c: pET-28a (+) -PCV 4-Delta21-228 Cap (4C). M, DNA Marker D2000 (2000 bp,1000bp,750bp,500bp,250bp,100 bp).

FIG. 2 SDS-PAGE and Western blot identification of purified recombinant proteins. A: PCV2 Cap; b: PCV3 Cap; c: PCV4 Cap. M: protein molecular weight standards (117 kDa, 90kDa, 49kDa, 35kDa, 26kDa, 19kDa in order from top to bottom); -I: protein extract of bacteria liquid without IPTG induction (-IPTG); +i: adding IPTG-induced protein extract (+IPTG); i, S: adding IPTG-induced bacterial liquid into the Supernatant after ultrasonic treatment (IPTG, supernatant); i, P: adding IPTG induced bacterial liquid, and performing precipitation (IPTG) after ultrasonic treatment; rp2C/Rp 3C: recombinant protein.

Figure 3 titers of the induced antibodies after mixed immunization of the three recombinant proteins. Recombinant proteins PCV2Cap (left panel), PCV3Cap (middle panel) and PCV4Cap (right panel).

FIG. 4 shows the Western blot detection results of the induced antibodies after mixed immunization of three recombinant proteins.

Detailed Description

All parts and percentages are by weight unless otherwise indicated in this invention, and all equipment, materials, etc. are commercially available or are customary in the industry. The methods in the following examples are conventional in the art unless otherwise specified.

Example 1 construction and identification of PCV2Cap protein, PCV3Cap protein and PCV4Cap protein expression plasmids.

Plasmid: prokaryotic expression vector pET-28a (+).

1) Primer design:

primer sequences were designed based on the sequences of Cap protein removal Nuclear Localization Signal (NLS) of PCV2 (GenBank: JQ 955679.1), PCV3 (GenBank: MN 431641.1) and PCV4 (GenBank: MT 311854.1) in GenBank, respectively, as shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, respectively.

2Cjd-F：5’-cgcagccatcttggccagatc-3’，(SEQ ID NO.4)

2Cjd-R：5’-tcattaagggttaagtggggggttttaag-3’，(SEQ ID NO.5)

3Chc-F：5’-ctagctagctatgtcagaagaaaactattcattaggaggccc，(SEQ ID NO.6)

3Chc-R：5’-ccgctcgaggagaacggacttgtaacgaatccaaac-3’，(SEQ ID NO.7)

4Cjd-F：5’-gggcagcagccatcatcatcatca-3’，(SEQ ID NO.8)

4Cjd-R：5’-gaccttgttaactaccccaaacaggga-3’。(SEQ ID NO.9)

2) Cloning and identifying genes:

the sequences of the Cap protein removal Nuclear Localization Signal (NLS) of PCV2 (GenBank: JQ 955679.1), PCV3 (GenBank: MN 431641.1) and PCV4 (GenBank: MT 311854.1) were synthesized by Jin Wei Intelligence company and ligated into pET-28a (+) plasmids (Novagen company product), respectively, and the three obtained prokaryotic expression plasmids were named pET-28a (+) -PCV 2-. DELTA.16-235 Cap (abbreviated as 2C), pET-28a (+) -PCV 3-. DELTA.23-214 Cap (abbreviated as 3C), pET-28a (+) -4-. DELTA.21-228 Cap (abbreviated as 4C), respectively.

The three recombinant plasmids constructed above are respectively transformed into competent cells of escherichia coli Rosetta (DE 3), and the obtained recombinant protein positive expression bacteria are respectively named Rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4, and the strains are stored at the temperature of-80 ℃ for standby.

3) Identification of expression plasmids:

after the three recombinant plasmids pET-28a (+) -PCV 2-delta 16-235Cap, pET-28a (+) -PCV 3-delta 23-214Cap and pET-28a (+) -PCV 4-delta 21-228Cap are transferred into E.coli Rosetta (DE 3) cells, PCR identification is carried out by using primer pairs 2Cjd-F/2Cjd-R, 3Chc-F/3Chc-R and 4Cjd-F/4Cjd-R respectively.

As a result, as shown in FIG. 1, amplified fragments of Cap proteins of PCV2, PCV3 and PCV4 were 660bp, 594bp and 624bp, respectively, and the fragment sizes were all in accordance with expectations.

The invention successfully constructs Cap protein prokaryotic expression plasmids pET-28a (+) -PCV 2-delta 16-235Cap, pET-28a (+) -PCV 3-delta 23-214Cap and pET-28a (+) -PCV 4-delta 21-228Cap of PCV2, PCV3 and PCV4, and prepares and obtains corresponding positive recombinant strains Rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4.

EXAMPLE 2 expression purification and identification of PCV2, PCV3 and PCV4Cap proteins

Coli Rosetta (DE 3) strains, i.e., rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4, which were respectively transformed into pET-28a (+) -PCV 2-. DELTA.16-235 Cap, pET-28a (+) -PCV 3-. DELTA.23-214 Cap, pET-28a (+) -PCV 4-. DELTA.21-228 Cap prepared in example 1.

1) Induction expression of proteins:

(1) Recombinant protein positive strains Rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4 prepared in Experimental example 1 were cultured to OD600 of 0.6-1.0 and induced to express with IPTG. The induction expression conditions are respectively as follows: 0.8mM IPTG induction for 10h, 0.8mM IPTG induction for 8h, 1.4mM IPTG induction for 10h.

(2) The bacterial solution after IPTG induction expression was centrifuged at 4℃and 8000rpm for 30min to collect bacterial pellet, which was washed twice with PBS (pH=8.0).

(3) The pellet was resuspended in 20mL PBS (ph=8.0) and 1% Triton X-100 and PMSF was added to a final concentration of 1 mM. Then, the cells were sonicated on ice for 1.5h at 60W, sonicated for 3s, and stopped for 3 s.

(4) After centrifugation of the sonicated samples at 4℃and 10000rpm for 30min, the supernatant was washed twice with PBS (pH=8.0).

(5) With 10mL Binding Buffer (PBS, 8M urea, 100mM Na ₂ HPO ₄ 10mM imidazole, ph=8.0) and the pellet was resuspended and allowed to stand at room temperature for 2h for lysis. The protein solution was then added to a final concentration of 1mM PMSF and the sample sonicated on ice for 0.5h at 60W, sonicated for 3s, and stopped for 3 s.

(6) Finally, the sample was centrifuged at 12000rpm for 30min at 4℃to collect the supernatant as a protein stock solution, which was designated PCV2Cap, PCV3Cap and PCV4Cap, respectively.

2) Protein purification:

(1) The Ni-NTA purification resin pre-packed column is connected with a constant flow pump, and the storage buffer solution (20% ethanol) in the pre-packed column is discharged. Then, using ddH ₂ O-washing twice, and washing with Wash Buffer (PBS, 8M urea, 100mM Na ₂ HPO ₄ 20mM imidazole, ph=8.0) was washed twice.

(2) And (3) filling the protein stock solution into a column, repeatedly passing the column for three times, and collecting the flow through liquid by using a centrifuge tube. The column was washed with twice the column volume Wash Buffer and the flow-through was collected until absorbance A280 of the flow-through was measured on Nano Drop 1000 to approach baseline.

With twice the column volume of the Elutation Buffer (PBS, 8M urea, 100mM Na) ₂ HPO ₄ 500mM imidazole, ph=8.0) elutes the protein of interest on the column and collects the eluate until absorbance a280 of the eluate measured on Nano Drop 1000 approaches baseline.

(3) The Ni-NTA pre-packed column was washed with 5 column volumes of Elution Buffer. Washing the column material with 5 times of Wash Buffer, and finally with 5 times of ddH ₂ The column material is washed by O, and is added with 20 percent ethanol storage solution to be stored at 4-8 ℃.

(4) Selecting protein stock solution, flow-through solution and eluent with highest concentration, performing SDS-page electrophoresis, and identifying the size and purity of the purified protein.

3) Protein identification:

SDS-PAGE electrophoresis is carried out by using equal amounts of a bacterial liquid protein extract (-IPTG) without being added with IPTG induction, a bacterial liquid protein extract with being added with IPTG induction, a Supernatant (IPTG) after being added with IPTG induction bacterial liquid ultrasound, and precipitation (IPTG, pellet) after being added with IPTG induction bacterial liquid ultrasound, and the difference of protein expression amounts is detected. Meanwhile, the mouse anti-His-tag (diluted by TBS-T1:1000) is used as a primary antibody, and the HPR marked goat anti-mouse is used as a secondary antibody to carry out Western blot detection and purification on the protein.

Recombinant protein expression bacteria Rosetta-PCV2, rosetta-PCV3 and Rosetta-PCV4 are subjected to IPTG induction expression. Purified recombinant proteins were identified by SDS-PAGE and Western blot. As a result, as shown in FIG. 2, the purified PCV2Cap, PCV3Cap and PCV4Cap proteins had molecular weights of 28.3, 25.9 and 26.8kDa, respectively, in agreement with expectations.

The above results indicate that the recombinant proteins PCV2Cap, PCV3Cap and PCV4Cap were successfully obtained.

Example 3, preparation of antibodies to PCV2, PCV3 and PCV4Cap proteins and identification.

Animals: white rabbits (females).

Immunogen (recombinant protein): example 2 the obtained recombinant proteins PCV2Cap, PCV3Cap and PCV4Cap were purified.

1) Immunization of animals:

300. Mu.g of each of the three target proteins obtained by expression and purification in example 2 was taken together with Freund's complete adjuvant 1:1 (volume ratio) and fully emulsified back multipoint subcutaneous injection to immunize Japanese white rabbits (females).

The limbal vein was sampled before immunization of each rabbit. After the separated blood was allowed to stand at 4℃overnight, the blood was centrifuged at 3000rpm at 4℃for 15 minutes to separate serum. The serum was then dispensed into 1.5mL centrifuge tubes and stored at-80 ℃. This serum served as a negative control.

Second, third and fourth immunizations were performed 14, 28 and 42 days after the first immunization, respectively. In the second and third immunization, 200 mug of target protein and Freund's incomplete adjuvant 1:1 (volume ratio) and then immunizing the rabbits after being uniformly mixed and emulsified. The ear margin vein was collected 5 days after immunization and titers were determined by the iELISA method. For the fourth immunization, 300 μg of each of the three proteins was taken and mixed evenly for the subsequent ear-border intravenous injection for booster immunization.

3 days after the last immunization, the rabbit heart was sampled and blood was collected. After the separated blood was allowed to stand at 4℃overnight, the blood was centrifuged at 3000rpm at 4℃for 15 minutes to separate serum. The serum was then dispensed into 1.5mL centrifuge tubes and stored at-80 ℃.

2) Antibody (positive serum) titer detection (iesa method):

(1) Three recombinant proteins PCV2Cap, PCV3Cap and PCV4Cap purified by artificial expression were mixed in equal proportions (mass ratio) with freund's complete adjuvant 1:1 (volume ratio) and fully emulsifying, wherein the obtained solution is used as an immunoreagent, and positive serum and negative serum collected after the fourth immunization are respectively subjected to equal-ratio dilution.

(2) Adding target protein (antigen) to coating solution (0.05M Carbonate Buffer (CBS): naCO ₃ 1.59 g NaHCO ₃ 2.93 grams distilled water to 1000mL, ph=9.6) to 2 μg/mL, 0.1mL per well, overnight at 4 ℃ for more than 12 h.

(3) Washed three times with PBS-T (PBS, 0.05% Tween-20) for 5min each, then blocked with 0.1mL of blocking solution (PBS-T of 5% FBS) at 37℃for 2h.

(4) The negative serum and the positive serum were respectively prepared according to 1: 50. 1: 200. 1: 800. 1: 3200. 1: 12800. 1: 51200. 1:204800 and 1:819200 ratio was diluted with blocking solution and then 0.1mL was added to each well and each set was replicated three times and incubated for 1.5h at 37 ℃.

(5) Wash three times with PBS-T for 5min each, then add 0.1mL per well with blocking solution 1: the 250 diluted HPR-labeled goat anti-rabbit IgG (H+L) was incubated at 37℃for 1H.

(6) Washing with PBS-T three times for 5min each time, adding 0.1mL into each well, reacting at 37deg.C in the dark for about 10min, and adding 2M H into each well ₂ SO ₄ The reaction was terminated.

(7) The OD450 values per well were measured on a microplate reader. When the value of the positive serum hole is more than 2.1 of the negative serum, the positive serum hole is positive, so that the serum titer is obtained.

3)Western blot：

(1) PK-15 cells were plated in 6-well plates and cultured for 12h until the cell monolayer was 70-80% confluent.

(2) Appropriate amounts of diluted PCV2, PCV3 and PCV4 (MOI 10) were inoculated with cells, respectively, and infected in a cell incubator for 1 hour.

(3) After washing three times with 500. Mu.L/well PBS, 2mL of fresh medium (5% FBS) was added to each well to continue the culture.

(4) 72hpi, PCV infected cells and control cells were discarded supernatant, added 500. Mu.L/well PBS, and washed twice.

(5) mu.L of Western and IP cell lysate (containing 5mM PMSF) per well lyses cells, and the cells were collected into a 1.5mL centrifuge tube, centrifuged at 12000rpm for 10min at 4℃and the supernatant was collected.

(6) An equal amount of protein sample was subjected to SDS-PAGE and then to transfer.

(7) After the transfer, the membrane is closed for 2 hours at room temperature on a shaker under the condition of 5% of sealing liquid (skimmed milk powder+TBS-T).

(8) The mixture is placed on a shaking table, and primary antibodies (namely, positive serum and mouse anti-beta-actin antibodies, respectively) are incubated at 4 ℃ overnight.

(9) TBS-T was washed three times, 5 min/time. The secondary antibodies were incubated at room temperature for 1H (secondary antibodies were HRP-labeled goat anti-rabbit IgG (h+l), HRP-labeled goat anti-mouse IgG (h+l), respectively).

(10) TBS-T was washed three times, 5 min/time. The pictures were then developed and saved and greyscale analysis was performed using ImagePro software.

Antibody titer analysis was performed on the collected serum. As shown in FIG. 3, the three recombinant proteins PCV2Cap, PCV3Cap and PCV4Cap prepared by the invention have good immunogenicity after being uniformly mixed according to the technical steps of the invention, and the serum antibody titers generated after immunization of animals are respectively as follows: 1:204800, 1:204800, 1:819200.

western blot (shown in figure 4) experiments further prove that the antibody induced by immunization of animals by the three protein mixtures can effectively react with three viruses of PCV2, PCV3 and PCV4 at the same time, has obvious cross reaction effect, and can be used for protecting animals infected by the three viruses.

The three recombinant proteins PCV2Cap, PCV3Cap and PCV4Cap prepared by the invention are uniformly mixed according to the technical steps of the invention, so that the animal is immunized, the immunogenicity is good, and the generated serum antibody has the characteristic of high titer, can be used as a triple subunit vaccine, and is used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection.

The results prove that the Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 prepared by the invention has good immunogenicity, and the generated serum antibody has high-titer property and can be used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection.

The Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 of the invention is produced by taking the artificially prepared Cap proteins of PCV2, PCV3 and PCV4 as immunogens and referring to the production process of subunit vaccine, and an immunological adjuvant, a vaccine excipient and the like can be added into the triple subunit vaccine of the invention, so that the production can be easily carried out by a person skilled in the art. Proved by verification, the Cap protein triple subunit vaccine of the artificially prepared PCV2, PCV3 and PCV4 can achieve a better immune protection effect.

It should be understood that the foregoing embodiments are merely illustrative of the present invention and not limiting, and that the present invention has been described in detail with reference to preferred embodiments, but it should be understood that the invention is not limited to the specific embodiments of the present invention, but is intended to cover all modifications, equivalents, improvements and modifications falling within the spirit and principles of the invention.

SEQUENCE LISTING

<110> Jilin university

<120> a porcine circovirus 2, 3 and 4Cap protein triple subunit vaccine and preparation method thereof

<130> 2021

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 624

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

1 GGACTGTGGCCCCGGGCCAGTAGGCGGAGATACCGGTGGAGAAGGAAGAA

51 CGGAATTTTCCATGCGCGCTTCATGAGGGAGGTGACTCTCAGCGTGTCAA

101 GCTTTTCCACGCCCTCTTGGAACGTTGGACATTACGATTTCAAACTGAAG

151 GACTTTATCCCAAAAGGACCGGGAACGATCGTAAACCTTTACAGCCTCCC

201 ATTTGCATATTACCGGATCAGAAAGGTCAAAGTCGAATTTCTGCCACTAA

251 ATGGCATTAACAGTAATAGGACTTACTCTAGCACTGCTATACAACTGGAT

301 GGAGACTATGTGGGGGAAGGGAAAAACCAAACTTATGATGTCCTGGCAAA

351 CCACAGCAGCAGGCATGGTTTCACCAATATTGCTAGACACAGTCGCTATT

401 TCACTCCAAAACCCCAGGACCCCTCTGGGGAAACCCACACCCTCCACTTC

451 CAGCCTAACAACAAAAGAAACCAATGGTGGATCAGCATGGCGGACCAGGA

501 CCTAGTCCATCATGGCCTCCAATACAGTATACAAAATTCTAACTTTGTGC

551 AGGTGTGGACAGTGAGATTTACTCTGTATGTGCAATTCAGAGAATTTGAC

601 CTTGTTAACTACCCCAAACAGGGA

<210> 2

<211> 576

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

1 TATGTCAGAAGAAAACTATTCATTAGGAGGCCCACAGCTGGCACATACTA

51 CACAAAGAAATACTCCACCATGAACGTCATTTCCGTTGGAACCCCTCAGA

101 ATAACAAGCCCTGGCACGCCAACCACTTCATTACCCGCCTAAACGAATGG

151 GAAACTGCGATTAGCTTTGAATATTATAAGATACTAAAGATGAAAGTTAC

201 ACTCAGCCCTGTAATTTCTCCGGCTCAGCAAACAAAAACTATGTTCGGGC

251 ACACAGCCATAGATCTAGACGGCGCCTGGACCACAAACACTTGGCTCCAA

301 GACGACCCTTATGCGGAAAGTTCCACTCGTAAAGTTATGACTTCTAAAAA

351 AAAACACAGCCGTTACTTCACCCCCAAACCAATTCTGGCGGGAACTACCA

401 GCGCTCACCCAGGACAAAGCCTCTTCTTTTTCTCCAGACCCACCCCATGG

451 CTCAACACATATGACCCCACCGTTCAATGGGGAGCACTGCTTTGGAGCAT

501 TTATGTCCCGGAAAAAACTGGAATGACAGACTTCTACGGCACCAAAGAAG

550 TTTGGATTCGTTACAAGTCCGTTCTC

<210> 3

<211> 660

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

1 CGCAGCCATCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCGTCCACCC

51 CCGCCACCGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAACACCCGCC

101 TCTCCCGCACCTTCGGATATACTATCAAGAGAACCACAGTCAAAACGCCC

151 TCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCC

201 AGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAA

251 GAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGAC

301 AGGGGAGTGGGCTCCAGTGCTGTTATTCTAGATGATAACTTTGTAACAAA

351 GGCCACAGCCCTCACCTACGACCCCTATGTAAACTACTCCTCCCGCCATA

401 CCATAACCCAGCCCTTCTCCTACCACTCCCGCTACTTTACCCCCAAACCT

451 GTCCTAGATTCCACTATTGATTACTTCCAACCAAACAACAAAAGAAATCA

501 GCTGTGGCTGAGACTACAAACTGCTGGAAATGTAGACCACGTAGGCCTCG

551 GCACTGCGTTCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTA

601 ACCATGTATGTGCAATTCAGAGAATTTAATCTTAAAACCCCCCACTTAAC

650 CCTTAATGAA

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

cgcagccatcttggccagatc

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

tcattaagggttaagtggggggttttaag

<210> 6

<211> 42

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ctagctagctatgtcagaagaaaactattcattaggaggccc

<210> 7

<211> 36

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

ccgctcgaggagaacggacttgtaacgaatccaaac

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

gggcagcagccatcatcatcatca

<210> 9

<211> 27

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

gaccttgttaactaccccaaacaggga

Claims

1. An immunogenic composition for the preparation of a triple subunit vaccine of PCV2, PCV3 and PCV4, characterized in that: the PCV3Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.3 through escherichia coli, the PCV3Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.2 through escherichia coli, and the PCV4Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.1 through escherichia coli.

2. The immunogenic composition of claim 1, wherein: the PCV2Cap protein, PCV3Cap protein and PCV4Cap protein in the immunogenic composition are mixed in equal mass ratio.

3. A PCV2, PCV3 and PCV4 triple subunit vaccine, characterized in that: comprising the immunogenic composition of claim 1 and an adjuvant.

4. The method for preparing a triple subunit vaccine of PCV2, PCV3 and PCV4 according to claim 3, wherein: comprising the following steps:

constructing a nucleotide sequence shown as SEQ ID NO.3 on an expression vector, and converting the expression vector into escherichia coli to express to obtain PCV2Cap protein;

constructing a nucleotide sequence shown as SEQ ID NO.1 on an expression vector, and converting the expression vector into escherichia coli to express to obtain PCV4Cap protein;

preparing a triple subunit vaccine by mixing PCV2Cap protein, PCV3Cap protein and PCV4Cap protein mixed solution with an adjuvant; the subunit vaccine has good immunogenicity, can induce high-titer antibodies after being immunized, has a cross protection effect, and can be used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection.

5. The method for preparing a triple subunit vaccine of PCV2, PCV3 and PCV4 according to claim 4, wherein: the mixed solution contains PCV2Cap protein, PCV3Cap protein, PCV4Cap protein and other mass ratios.

6. The method for preparing a triple subunit vaccine of PCV2, PCV3 and PCV4 according to claim 4, wherein: the volume ratio of the mixed solution to the adjuvant is 1:1.

7. use of an immunogenic composition according to claim 1 in the manufacture of a medicament for immunizing porcine circovirus types 2, 3 and 4.

8. A biomaterial characterized in that: the biological material comprises nucleic acid shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and is an expression vector or recombinant protein positive expression bacterium.

9. The biomaterial of claim 8, wherein: the expression vector is formed by respectively inserting gene sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 into pET-28a (+) plasmid.

10. The biomaterial of claim 8, wherein: the recombinant protein positive expression bacteria are obtained by respectively transferring three expression vectors into competent cells of escherichia coli Rosetta (DE 3).