CN114409741A

CN114409741A - PCV2, PCV3 and PCV4 triplet subunit vaccine and preparation method and application thereof

Info

Publication number: CN114409741A
Application number: CN202111457334.8A
Authority: CN
Inventors: 任林柱; 吉卫龙; 牛谷雨; 欧阳红生; 逄大欣
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2021-12-02
Filing date: 2021-12-02
Publication date: 2022-04-29
Anticipated expiration: 2041-12-02
Also published as: CN114409741B

Abstract

The invention relates to a PCV2, PCV3 and PCV4 triplet subunit vaccine and a preparation method thereof, which comprises three recombinant proteins, namely PCV2 Cap protein, PCV3 Cap protein and PCV4Cap protein, wherein the PCV2 Cap protein is obtained by expressing a gene sequence shown as SEQ ID No.1 through escherichia coli, the PCV3 Cap protein is obtained by expressing a gene sequence shown as SEQ ID No.2 through escherichia coli, and the PCV4Cap protein is obtained by expressing a gene sequence shown as SEQ ID No.3 through escherichia coli. The vaccine can be used for preventing and treating PCV2, PCV3 and PCV4 infection at the same time, the immunogenicity against PCV2, PCV3 and PCV4 is remarkably improved, and the immunized animal can induce and generate high-titer antibodies.

Description

PCV2, PCV3 and PCV4 triplet subunit vaccine and preparation method and application thereof

Technical Field

The invention belongs to the field of virus molecular biology technology and genetic engineering, and particularly relates to a Porcine circovirus type 2 (Porcine circovirus 2, PCV2), Porcine circovirus type 3 (Porcine circovirus 3, PCV3) and Porcine circovirus type 4 (Porcine circovirus 4, PCV4) triple subunit vaccine and a preparation method thereof, wherein the artificially prepared Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 can be used for simultaneously preventing and treating infections of PCV2, PCV3 and PCV 4.

Background

Porcine Circovirus (PCV) belongs to the genus circovirus of the circovirus family taxonomically, is one of the smallest animal viruses discovered to date, and has a diameter of 12-23 nm. The virion has a diameter of 14-17nm, a 20-hedral symmetrical structure, no envelope, contains covalently closed single-stranded circular negative strand DNA, and has a genome size of about 1.7kb-2 kb. Based on differences in nucleotide sequence, pathogenicity and antigenicity of porcine circovirus, the three subtypes are classified, namely three genotypes of PCV1, PCV2 and PCV3, wherein PCV1 is considered to be nonpathogenic, and PCV2 and PCV3 are the main pathogens of Postweaning Multisystemic Wasting Syndrome (PMWS), PDNS (porcine dermatitis and nephropathy Syndrome), PNP (proliferative necrotizing pneumonia) and PRDC (porcine respiratory disease Syndrome). PMWS was first discovered in Canada (1991), and is rapidly established and prevalent in countries including China in Europe, America and Asia, and diseases such as reproductive disorders, congenital tremor, enteritis and the like are also significantly associated with PCV2 and PCV3 infections.

PCV2 and related swine diseases have the mortality rate of about 10-30%, and the death and washout rate of a pig farm with severe epidemic situation is sometimes as high as 40%, so that huge economic losses are caused to the pig raising industry. The PCV-2 infection can cause immunosuppression of pigs, thereby reducing the resistance of organisms to other various pathogens. Common mixed infection pathogens with PCV2 include PRRSV (porcine reproductive and respiratory syndrome virus), PRV (porcine pseudorabies virus), PPV (porcine parvovirus), mycoplasma hyopneumoniae and the like, wherein double infection or triple infection is common, and the fatality rate of sick pigs is greatly improved to about 25-40%. The positive rate of PCV3 found in 2016 and PCV4 found in 2019 in domestic pigs is also high, but the pathogenicity and host spectrum of the PCV are still to be further researched. Studies have reported that PCV3 and PCV4 may also be associated with respiratory diseases, diarrhea and dermatitis in pigs, nephrotic syndrome, etc. PCV4 virus has not been successfully isolated and no commercial vaccine was immunized, and there are few reports on PCV3 and PCV4 vaccines and a few vaccines are available.

Subunit vaccines (Subunit vaccine) are designed to introduce genes encoding protective antigens of pathogenic microorganisms into receptors such as bacteria, yeast or animal cells for efficient expression. After the protective antigen is separated and purified, the protective antigen is combined with an adjuvant to prepare a vaccine which can induce an organism to generate antibodies and immune protection, has high safety and good stability, does not need to be inactivated and does not contain nucleic acid. Although many different classes of proteins are successfully expressed in vitro by genetic engineering techniques, protein purification techniques in work downstream of subunit vaccine production are not yet sufficiently mature. According to statistics, the separation and purification cost of the subunit vaccine accounts for about 60-80% of the total cost. At present, the requirements for food safety are higher and higher, national policy and regulation are stricter and stricter, the industry faces integration and recombination, the market quality competitiveness needs to be improved, the requirement of precise immunity is met, the upstream development is rapid, and the factors show that the purification and the research and the development of veterinary vaccines are more and more important.

It is important to note that the gene homology of PCV2, PCV3 and PCV4 is low, but whether the related antibodies have cross-protection capability remains to be verified. In addition, no research report about PCV2, PCV3 and PCV4 triple subunit vaccines and preparation methods thereof exists at present.

Disclosure of Invention

The invention provides a PCV2, PCV3 and PCV4 triplet subunit vaccine and a preparation method thereof, which can be used for simultaneously preventing and treating PCV2, PCV3 and PCV4 infection, remarkably improve the immunogenicity against PCV2, PCV3 and PCV4, and an immunized animal can induce and generate high-titer antibodies.

The invention provides an immunogenic composition, which comprises three recombinant proteins, namely PCV2 Cap protein, PCV3 Cap protein and PCV4Cap protein, wherein the PCV2 Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.1 through escherichia coli, the PCV3 Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.2 through escherichia coli, and the PCV4Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.3 through escherichia coli.

As a more preferable technical scheme, the PCV2 Cap protein, the PCV3 Cap protein and the PCV4Cap protein in the immunogenic composition are mixed in equal proportion.

The invention also provides a PCV2, PCV3 and PCV4 triple subunit vaccine, which comprises the immunogenic composition and an adjuvant.

The invention also provides a preparation method of the triple subunit vaccine, which comprises the following steps:

constructing a nucleotide sequence shown as SEQ ID NO.1 on an expression vector, and converting the nucleotide sequence into escherichia coli to express to obtain PCV2 Cap protein;

constructing a nucleotide sequence shown as SEQ ID NO.2 on an expression vector, and converting the nucleotide sequence into escherichia coli to express to obtain PCV3 Cap protein;

constructing a nucleotide sequence shown as SEQ ID NO.3 on an expression vector, and converting the nucleotide sequence into escherichia coli to express to obtain PCV4Cap protein;

the mixed solution of PCV2 Cap protein, PCV3 Cap protein and PCV4Cap protein is matched with an adjuvant to prepare a triad subunit vaccine; the subunit vaccine has good immunogenicity, can induce and generate high-titer antibodies after immunizing animals, and is used for preventing and treating PCV2, PCV3 and PCV4 infection at the same time.

As a more preferable technical scheme of the invention, the mixed solution contains PCV2 Cap protein, PCV3 Cap protein and PCV4Cap protein in the same mass ratio.

As a more preferable technical scheme of the invention, the volume ratio of the mixed solution to the adjuvant is 1: 1.

the invention also provides the application of the immunogenic composition in preparing medicines for immunizing porcine circovirus types 2, 3 and 4.

The invention also provides a biological material, which comprises nucleic acids shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and the biological material is an expression vector or a recombinant protein positive expression bacterium.

As a more preferable technical scheme, the expression vector is formed by respectively inserting gene sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 into pET-28a (+) plasmid, and three prokaryotic expression plasmids are pET-28a (+) -PCV 2-delta 16-235Cap, pET-28a (+) -PCV 3-delta 23-214Cap and pET-28a (+) -PCV 4-delta 21-228 Cap.

As a more preferable technical scheme, the recombinant protein positive expression bacteria Rosetta-PCV2, Rosetta-PCV3 and Rosetta-PCV4 are obtained by respectively transferring the three prokaryotic expression plasmids into competent cells of Escherichia coli Rosetta (DE 3).

The PCV2 Cap protein, PCV3 Cap protein and PCV4Cap protein in the immunogenic composition provided by the invention are prepared by purifying proteins expressed by recombinant protein positive expression bacteria Rosetta-PCV2, Rosetta-PCV3 and Rosetta-PCV4 under IPTG induction based on Escherichia coli Rosetta (DE 3). The induced expression conditions are as follows: the recombinant protein positive strains Rosetta-PCV2, Rosetta-PCV3 and Rosetta-PCV4 are cultured to OD600 of 0.6-1.0, and then are respectively induced for 10h by 0.8mM IPTG, 8h by 0.8mM IPTG and 10h by 1.4mM IPTG, and then expressed protein products are recovered, and the three recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap are prepared through processes of ultrasonic treatment, purification and the like.

The invention also provides an antibody titer detection method (iELISA method) after PCV2, PCV3 and PCV4Cap protein triple subunit vaccine immunization animals, which comprises the following steps:

s1, mixing three recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap in equal proportion (mass ratio) with Freund' S complete adjuvant 1: 1 (volume ratio), fully emulsifying, taking the obtained solution as an immune reagent, and respectively diluting positive serum and negative serum collected after the fourth immunization in an equal ratio;

s2, adding the target protein, i.e., antigen, to the coating solution [0.05M Carbonate Buffer (CBS): NaCO₃Is 1.59 g, NaHCO₃2.93 g with distillationWater to 1000mL, pH 9.6]Diluting to 2 μ g/mL, each well is 0.1mL, and staying overnight at 4 deg.C for more than 12 h;

s3, washing three times with PBS-T (PBS, 0.05% Tween-20) for 5min each time, and then adding 0.1mL of blocking solution (PBS-T with 5% FBS) into each well to block for 2h at 37 ℃;

s4, and respectively carrying out the following steps on the negative serum and the positive serum according to the ratio of 1: 50. 1: 200. 1: 800. 1: 3200. 1: 12800. 1: 51200. 1: 204800 and 1: 819200, diluting with blocking solution, adding 0.1mL of blocking solution into each well, repeating three times, and incubating at 37 ℃ for 1.5 h;

s5, washing three times with PBS-T for 5min, then adding 0.1mL of blocking solution 1: 250 dilution of HPR-labeled goat anti-rabbit IgG (H + L) incubated at 37 ℃ for 1H;

s6, washing with PBS-T for three times, each time for 5min, adding 0.1mL of the solution into each well, reacting at 37 ℃ for about 10min in a dark place, and adding 2M H into each well₂SO₄Terminating the reaction;

s7, detecting the OD450 value of each hole on a microplate reader; when the value of the positive serum hole is more than 2.1 of the negative serum, the positive serum is positive, so as to obtain the serum titer.

The Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 provided by the invention is produced by taking artificially prepared PCV2, PCV3 and PCV4Cap proteins as antigens according to the production process of subunit vaccines, immune adjuvants, vaccine excipients and the like can be added into the triple subunit vaccine, and the triple subunit vaccine can be easily produced by a person skilled in the art.

The Cap protein triplet subunit vaccine of PCV2, PCV3 and PCV4 prepared by the invention has good immunogenicity, and the generated serum antibody has the characteristic of high titer, can be used for preventing and treating PCV2, PCV3 and PCV4 infection at the same time, and can achieve better immune protection effect.

The preparation method disclosed by the invention is suitable for artificially preparing the triple subunit vaccines of PCV2, PCV3 and PCV4, and the obtained triple subunit vaccines of PCV2, PCV3 and PCV4 can be used for preventing and controlling PCV2, PCV3 and PCV4 infection. In addition, the PCV2, PCV3 and PCV4Cap proteins prepared by the invention can also be used for preparing ELISA detection methods of PCV2, PCV3 and PCV4, and have wide application prospects in clinical and laboratory researches.

Drawings

FIG. 1 expression plasmid PCR identification. A: pET-28a (+) -PCV 2-delta 16-235Cap (2C); b: pGM-T-PCV3- Δ 23-214Cap (3C); c: pET-28a (+) -PCV 4-delta 21-228Cap (4C). M, DNA Marker D2000(2000bp, 1000bp, 750bp, 500bp, 250bp, 100 bp).

FIG. 2 SDS-PAGE and Western blot to identify purified recombinant proteins. A: PCV2 Cap; b: PCV3 Cap; c: PCV4 Cap. M: protein molecular weight standards (117 kDa, 90kDa, 49kDa, 35kDa, 26kDa and 19kDa in sequence from top to bottom); -I: bacterial liquid protein extract (-IPTG) which is not added with IPTG induction; + I: adding IPTG induced bacterial liquid protein extract (+ IPTG); i, S: adding IPTG induced Supernatant of the bacteria liquid after ultrasonic treatment (IPTG, Supernatant); i, P: adding IPTG induced bacterial liquid, precipitating (IPTG, pellet) after ultrasonic treatment; rp2C/Rp3C/Rp 3C: a Recombinant protein.

FIG. 3 shows the antibody titer induced by the three recombinant proteins after mixed immunization. Recombinant proteins PCV2 Cap (left panel), PCV3 Cap (middle panel) and PCV4Cap (right panel).

FIG. 4 shows Western blot detection results of induced antibodies after three recombinant proteins are mixed and immunized.

Detailed Description

In the invention, all parts and percentages are weight units, and all equipment, raw materials and the like can be purchased from the market or are commonly used in the industry. The methods in the following examples are conventional in the art unless otherwise specified.

Example 1, construction and identification of expression plasmids of PCV2 Cap protein, PCV3 Cap protein and PCV4Cap protein.

Plasmid: prokaryotic expression vector pET-28a (+).

1) Designing a primer:

primer sequences are designed according to sequences of Cap protein removal Nuclear Localization Signals (NLS) of PCV2(GenBank: JQ955679.1), PCV3(GenBank: MN431641.1) and PCV4(GenBank: MT311854.1) in GenBank respectively as shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO. 9.

2Cjd-F：5’-cgcagccatcttggccagatc-3’，(SEQ ID NO.4)

2Cjd-R：5’-tcattaagggttaagtggggggttttaag-3’，(SEQ ID NO.5)

3Chc-F：5’-ctagctagctatgtcagaagaaaactattcattaggaggccc，(SEQ ID NO.6)

3Chc-R：5’-ccgctcgaggagaacggacttgtaacgaatccaaac-3’，(SEQ ID NO.7)

4Cjd-F：5’-gggcagcagccatcatcatcatca-3’，(SEQ ID NO.8)

4Cjd-R：5’-gaccttgttaactaccccaaacaggga-3’。(SEQ ID NO.9)

2) Cloning and identifying genes:

sequences of Cap protein removal Nuclear Localization Signals (NLS) of PCV2(GenBank: JQ955679.1), PCV3(GenBank: MN431641.1) and PCV4(GenBank: MT311854.1) were synthesized by Jinwei corporation and ligated to pET-28a (+) plasmid (Novagen corporation) respectively, and the obtained three prokaryotic expression plasmids were named pET-28a (+) -PCV2- Δ 16-235Cap (abbreviated as 2C), pET-28a (+) -PCV3- Δ 23-214Cap (abbreviated as 3C) and pET-28a (+) -PCV4- Δ 21-228Cap (abbreviated as 4C), respectively.

The three recombinant plasmids constructed above are respectively transformed into escherichia coli Rosetta (DE3) competent cells, the obtained recombinant protein positive expression bacteria are respectively named Rosetta-PCV2, Rosetta-PCV3 and Rosetta-PCV4, and the strains are preserved at-80 ℃ for later use.

3) Identification of expression plasmids:

after three recombinant plasmids pET-28a (+) -PCV 2-delta 16-235Cap, pET-28a (+) -PCV 3-delta 23-214Cap and pET-28a (+) -PCV 4-delta 21-228Cap were transferred into E.coli Rosetta (DE3) cells, PCR identification was performed with primer pairs 2Cjd-F/2Cjd-R, 3Chc-F/3Chc-R and 4Cjd-F/4Cjd-R, respectively.

As shown in FIG. 1, the amplified fragments of Cap proteins of PCV2, PCV3 and PCV4 were 660bp, 594bp and 624bp, respectively, and the sizes of the fragments were consistent with those expected.

The invention successfully constructs the Cap protein prokaryotic expression plasmids pET-28a (+) -PCV 2-delta 16-235Cap, pET-28a (+) -PCV 3-delta 23-214Cap and pET-28a (+) -PCV 4-delta 21-228Cap of PCV2, PCV3 and PCV4, and prepares corresponding positive recombinant strains Rosetta-PCV2, Rosetta-PCV3 and Rosetta-PCV 4.

Example 2 expression purification and identification of PCV2, PCV3 and PCV4Cap proteins

Escherichia coli Rosetta (DE3) strains, namely Rosetta-PCV2, Rosetta-PCV3 and Rosetta-PCV4, which were transformed into pET-28a (+) -PCV2- Δ 16-235Cap, pET-28a (+) -PCV3- Δ 23-214Cap, pET-28a (+) -PCV4- Δ 21-228Cap, respectively, were prepared in example 1.

1) Induced expression of the protein:

(1) recombinant protein-positive strains Rosetta-PCV2, Rosetta-PCV3, and Rosetta-PCV4 prepared in Experimental example 1 were induced to express with IPTG when cultured to OD600 of 0.6-1.0. The induced expression conditions are respectively as follows: 0.8mM IPTG induction for 10h, 0.8mM IPTG induction for 8h, and 1.4mM IPTG induction for 10 h.

(2) The bacterial suspension after IPTG induction expression was centrifuged at 8000rpm for 30min at 4 ℃ to collect bacterial pellet, which was washed twice with PBS (pH 8.0).

(3) The pellet was resuspended in 20mL PBS (pH 8.0) and 1% Triton X-100 and PMSF at a final concentration of 1mM were added. Then, the cells were sonicated for 1.5h at 60W on ice, 3s with sonication, and 3s off.

(4) The sonicated sample was centrifuged at 4 ℃ and 10000rpm for 30min to remove the supernatant, and then washed twice with PBS (pH 8.0).

(5) Using 10mL of Binding Buffer (PBS, 8M urea, 100mM Na)₂HPO₄10mM imidazole, pH 8.0) and the pellet was resuspended and allowed to stand at room temperature for 2h for lysis. The protein solution was then added to PMSF at a final concentration of 1mM and the sample sonicated for 0.5h at 60W on ice for 3s and 3s off.

(6) Finally, the sample is centrifuged at 12000rpm for 30min at 4 ℃, and the collected supernatant is the protein stock solution which is respectively named as PCV2 Cap, PCV3 Cap and PCV4 Cap.

2) Protein purification:

(1) connecting the Ni-NTA purification resin pre-packed column with a constant flow pump, and discharging the storage buffer (20% ethanol) in the pre-packed column. Then, with ddH₂O-Wash twice and then Wash Buffer (PBS, 8M Urea, 100mM Na)₂HPO₄20mM imidazole, pH 80) washing twice.

(2) And (3) filling the protein stock solution into a column, repeatedly passing the column for three times, and collecting the flow-through solution by using a centrifugal tube. Wash the column for the contaminating proteins with two column volumes of Wash Buffer and collect the flow-through until the absorbance A280 of the flow-through was measured on the Nano Drop 1000 to be near baseline.

Elution Buffer (PBS, 8M Urea, 100mM Na) with two column volumes₂HPO₄500mM imidazole, pH 8.0) eluting the protein of interest on the column and collecting the eluate until the absorbance a280 of the eluate measured on Nano Drop 1000 approaches baseline.

(3) The Ni-NTA pre-packed column was washed with 5 column volumes of Elution Buffer. Washing the column material with 5 times of the volume of the column of Wash Buffer, and finally washing the column material with 5 times of the volume of the column of ddH₂Washing the column material with O, adding 20% ethanol storage solution, and storing at 4-8 deg.C.

(4) And selecting a protein stock solution, a flow-through solution and an eluent with the highest concentration, performing SDS-page electrophoresis, and identifying the size and the purity of the purified protein.

3) Protein identification:

SDS-PAGE electrophoresis is carried out on the same amount of a bacterial liquid protein extract (-IPTG) which is not induced by IPTG, a bacterial liquid protein extract induced by IPTG, a Supernatant (IPTG, Supernatant) obtained after the ultrasonic treatment of the bacterial liquid induced by IPTG and a precipitate (IPTG, pellet) obtained after the ultrasonic treatment of the bacterial liquid induced by IPTG, and the difference of protein expression amounts is detected. Meanwhile, Western blot detection was performed to purify the protein using mouse anti-His-tag (diluted with TBS-T1: 1000) as the primary antibody and HPR-labeled goat anti-mouse as the secondary antibody.

The recombinant protein expression bacteria Rosetta-PCV2, Rosetta-PCV3 and Rosetta-PCV4 are expressed by IPTG induction. The purified recombinant protein was identified by SDS-PAGE and Western blot. As a result, as shown in FIG. 2, the molecular weights of the purified PCV2 Cap, PCV3 Cap and PCV4Cap proteins were 28.3, 25.9 and 26.8kDa, respectively, in agreement with the expectation.

The above results indicate that the recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap were successfully obtained.

Example 3, preparation and identification of antibodies to PCV2, PCV3 and PCV4Cap proteins.

Animals: white rabbits (female) with big ear.

Immunogen (recombinant protein): example 2 the obtained recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap were purified.

1) Immunizing animals:

the three target proteins obtained by expression and purification in example 2 were mixed with Freund's complete adjuvant 1: 1 (volume ratio), fully emulsifying, and injecting multiple subcutaneous points on the back to immunize Japanese big ear white rabbits (female).

Blood was collected from the marginal vein of the ear before immunization of each rabbit. The separated blood was allowed to stand at 4 ℃ overnight, and then centrifuged at 3000rpm at 4 ℃ for 15min to separate the serum. The serum was then dispensed into 1.5mL centrifuge tubes and stored at-80 ℃. This serum served as a negative control.

Second, third and fourth immunizations were performed 14, 28 and 42 days after the first immunization, respectively. In the second and third immunizations, 200. mu.g of the target protein was mixed with Freund's incomplete adjuvant 1: 1 (volume ratio), mixing and emulsifying, and then immunizing the rabbit. Blood was collected from the marginal vein 5 days after the immunization, and the titer was measured by the iELISA method. In the fourth immunization, 300 mu g of each of the three proteins is taken, mixed uniformly and then injected into ear marginal vein for boosting.

And 3 days after the last immunization, collecting blood from the heart of the rabbit, and collecting the blood. The separated blood was allowed to stand at 4 ℃ overnight, and then centrifuged at 3000rpm at 4 ℃ for 15min to separate the serum. The serum was then dispensed into 1.5mL centrifuge tubes and stored at-80 ℃.

2) Antibody (positive serum) titer detection (elisa method):

(1) three recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap which are artificially expressed and purified are mixed in equal proportion (mass ratio) with Freund's complete adjuvant 1: 1 (volume ratio), fully emulsifying, taking the obtained solution as an immune reagent, and diluting positive serum and negative serum collected after the fourth immunization respectively in equal ratio.

(2) Adding target protein, i.e., antigen, to a coating solution (0.05M Carbonate Buffer Solution (CBS): NaCO₃1.59 g of NaHCO₃2.93 g distilled water to 1000mL pH 9.6) to 2 μ g/mL, 0.1mL per well, 4 ℃ overnight for 12h or more.

(3) Three washes with PBS-T (PBS, 0.05% Tween-20) for 5min each, followed by addition of 0.1mL of blocking solution (5% FBS in PBS-T) per well for 2h at 37 ℃.

(4) And (3) respectively carrying out the following steps on the negative serum and the positive serum according to the ratio of 1: 50. 1: 200. 1: 800. 1: 3200. 1: 12800. 1: 51200. 1: 204800 and 1: 819200 was diluted with blocking solution and 0.1mL was added to each well, three replicates each were incubated at 37 ℃ for 1.5 h.

(5) Three washes with PBS-T for 5min each, then 0.1mL of a 1: HPR-labeled goat anti-rabbit IgG (H + L) diluted 250 was incubated at 37 ℃ for 1H.

(6) Washing with PBS-T for 5min three times, adding 0.1mL per well, reacting at 37 deg.C in dark for 10min, and adding 2M H per well₂SO₄The reaction was terminated.

(7) The OD450 value of each well was measured on a microplate reader. When the value of the positive serum hole is more than 2.1 of the negative serum, the positive serum is positive, so as to obtain the serum titer.

3)Western blot：

(1) PK-15 cells were plated in 6-well plates and cultured for 12h until the cell monolayer was 70-80% confluent.

(2) The cells were inoculated with suitably diluted PCV2, PCV3 and PCV4(MOI of 10), respectively, and infected in a cell incubator for 1 h.

(3) The supernatant was discarded, washed three times with 500. mu.L/well PBS, and then cultured by adding 2mL of fresh medium (5% FBS) per well.

(4)72hpi, PCV-infected cells and control cells were washed twice by discarding supernatant and adding 500. mu.L/well PBS.

(5) mu.L of Western and IP cell lysate (containing 5mM PMSF) per well was used to lyse cells, the cells were collected in a 1.5mL centrifuge tube, centrifuged at 12000rpm for 10min at 4 ℃ and the supernatant was collected.

(6) Equal amounts of protein samples were run on SDS-PAGE followed by membrane transfer.

(7) After the membrane transfer is finished, the membrane is sealed for 2 hours at room temperature on a shaking table under the condition of 5 percent of sealing solution (skimmed milk powder + TBS-T).

(8) The cells were incubated overnight at 4 ℃ with primary antibodies (rabbit anti-Cap antibodies, i.e., positive serum, and mouse anti-beta-actin antibodies, respectively) on a shaker.

(9) TBS-T was washed three times, 5 min/time. The secondary antibodies were incubated at room temperature for 1H (the secondary antibodies were HRP-labeled goat anti-rabbit IgG (H + L) and HRP-labeled goat anti-mouse IgG (H + L)), respectively.

(10) TBS-T was washed three times, 5 min/time. And developing and storing the picture, and performing gray level analysis by using ImagePro software.

The collected sera were subjected to antibody titer analysis. The results are shown in fig. 3, the three recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap prepared by the invention have good immunogenicity after being uniformly mixed according to the technical steps of the invention, and the titers of serum antibodies generated after an immunized animal are respectively: 1: 204800, 1: 204800, 1: 819200.

western blot (shown in figure 4) experiments further prove that the antibody induced by the three protein mixture immune animals can simultaneously and effectively react with three viruses, namely PCV2, PCV3 and PCV4, has obvious cross reaction effect, and can be used for protecting animals infected by the three viruses.

The three recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap prepared by the invention are uniformly mixed according to the technical steps of the invention to immunize animals, have good immunogenicity, and the generated serum antibody has the characteristic of high titer, can be used as a triad subunit vaccine and is used for preventing and treating PCV2, PCV3 and PCV4 infection at the same time.

The results prove that the Cap protein triplet subunit vaccine of PCV2, PCV3 and PCV4 prepared by the invention has good immunogenicity, and the generated serum antibody has the characteristic of high titer, and can be used for preventing and treating PCV2, PCV3 and PCV4 infection at the same time.

The Cap protein triple subunit vaccine of PCV2, PCV3 and PCV4 is produced by taking artificially prepared Cap proteins of PCV2, PCV3 and PCV4 as immunogens and referring to the production process of subunit vaccine, and immunologic adjuvants, vaccine excipients and the like can be added into the triple subunit vaccine of the invention, so that the triple subunit vaccine can be easily produced by a person skilled in the art. Through verification, the artificially prepared Cap protein triad subunit vaccines of PCV2, PCV3 and PCV4 can achieve a better immune protection effect.

It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and are not to be construed as limiting, although the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above-mentioned embodiments are only for illustrating the present invention and are not to be construed as limiting the scope of the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the scope of the present invention.

SEQUENCE LISTING

<110> Jilin university

<120> porcine circovirus type 2, 3 and 4Cap protein triple subunit vaccine and preparation method thereof

<130> 2021

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 624

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

1 GGACTGTGGCCCCGGGCCAGTAGGCGGAGATACCGGTGGAGAAGGAAGAA

51 CGGAATTTTCCATGCGCGCTTCATGAGGGAGGTGACTCTCAGCGTGTCAA

101 GCTTTTCCACGCCCTCTTGGAACGTTGGACATTACGATTTCAAACTGAAG

151 GACTTTATCCCAAAAGGACCGGGAACGATCGTAAACCTTTACAGCCTCCC

201 ATTTGCATATTACCGGATCAGAAAGGTCAAAGTCGAATTTCTGCCACTAA

251 ATGGCATTAACAGTAATAGGACTTACTCTAGCACTGCTATACAACTGGAT

301 GGAGACTATGTGGGGGAAGGGAAAAACCAAACTTATGATGTCCTGGCAAA

351 CCACAGCAGCAGGCATGGTTTCACCAATATTGCTAGACACAGTCGCTATT

401 TCACTCCAAAACCCCAGGACCCCTCTGGGGAAACCCACACCCTCCACTTC

451 CAGCCTAACAACAAAAGAAACCAATGGTGGATCAGCATGGCGGACCAGGA

501 CCTAGTCCATCATGGCCTCCAATACAGTATACAAAATTCTAACTTTGTGC

551 AGGTGTGGACAGTGAGATTTACTCTGTATGTGCAATTCAGAGAATTTGAC

601 CTTGTTAACTACCCCAAACAGGGA

<210> 2

<211> 576

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

1 TATGTCAGAAGAAAACTATTCATTAGGAGGCCCACAGCTGGCACATACTA

51 CACAAAGAAATACTCCACCATGAACGTCATTTCCGTTGGAACCCCTCAGA

101 ATAACAAGCCCTGGCACGCCAACCACTTCATTACCCGCCTAAACGAATGG

151 GAAACTGCGATTAGCTTTGAATATTATAAGATACTAAAGATGAAAGTTAC

201 ACTCAGCCCTGTAATTTCTCCGGCTCAGCAAACAAAAACTATGTTCGGGC

251 ACACAGCCATAGATCTAGACGGCGCCTGGACCACAAACACTTGGCTCCAA

301 GACGACCCTTATGCGGAAAGTTCCACTCGTAAAGTTATGACTTCTAAAAA

351 AAAACACAGCCGTTACTTCACCCCCAAACCAATTCTGGCGGGAACTACCA

401 GCGCTCACCCAGGACAAAGCCTCTTCTTTTTCTCCAGACCCACCCCATGG

451 CTCAACACATATGACCCCACCGTTCAATGGGGAGCACTGCTTTGGAGCAT

501 TTATGTCCCGGAAAAAACTGGAATGACAGACTTCTACGGCACCAAAGAAG

550 TTTGGATTCGTTACAAGTCCGTTCTC

<210> 3

<211> 660

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

1 CGCAGCCATCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCGTCCACCC

51 CCGCCACCGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAACACCCGCC

101 TCTCCCGCACCTTCGGATATACTATCAAGAGAACCACAGTCAAAACGCCC

151 TCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCC

201 AGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAA

251 GAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGAC

301 AGGGGAGTGGGCTCCAGTGCTGTTATTCTAGATGATAACTTTGTAACAAA

351 GGCCACAGCCCTCACCTACGACCCCTATGTAAACTACTCCTCCCGCCATA

401 CCATAACCCAGCCCTTCTCCTACCACTCCCGCTACTTTACCCCCAAACCT

451 GTCCTAGATTCCACTATTGATTACTTCCAACCAAACAACAAAAGAAATCA

501 GCTGTGGCTGAGACTACAAACTGCTGGAAATGTAGACCACGTAGGCCTCG

551 GCACTGCGTTCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTA

601 ACCATGTATGTGCAATTCAGAGAATTTAATCTTAAAACCCCCCACTTAAC

650 CCTTAATGAA

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

cgcagccatcttggccagatc

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

tcattaagggttaagtggggggttttaag

<210> 6

<211> 42

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ctagctagctatgtcagaagaaaactattcattaggaggccc

<210> 7

<211> 36

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

ccgctcgaggagaacggacttgtaacgaatccaaac

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

gggcagcagccatcatcatcatca

<210> 9

<211> 27

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

gaccttgttaactaccccaaacaggga

Claims

1. An immunogenic composition, comprising: the PCV2 Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.1 through escherichia coli, the PCV3 Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.2 through escherichia coli, and the PCV4Cap protein is obtained by expressing a gene sequence shown as SEQ ID NO.3 through escherichia coli.

2. The immunogenic composition of claim 1, wherein: the PCV2 Cap protein, the PCV3 Cap protein and the PCV4Cap protein in the immunogenic composition are mixed in equal mass ratio.

3. A PCV2, PCV3 and PCV4 triplet subunit vaccine, characterized in that: comprising the immunogenic composition and an adjuvant.

4. The method of making a PCV2, PCV3, and PCV4 triple subunit vaccine according to claim 3, wherein: the method comprises the following steps:

5. The method of making a PCV2, PCV3, and PCV4 triple subunit vaccine according to claim 4, wherein: the volume ratio of the mixed solution to the adjuvant is 1: 1.

6. the immunogenic composition of claim 1, wherein: use of the immunogenic composition in the preparation of a vaccine for immunizing porcine circovirus types 2, 3 and 4.

7. A biomaterial, characterized by: the biological material comprises nucleic acids shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and is an expression vector or a recombinant protein positive expression bacterium.

8. The biomaterial of claim 7, wherein: the expression vector is formed by inserting gene sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 into pET-28a (+) plasmid respectively.

9. The biomaterial of claim 7, wherein: the recombinant protein positive expression strain is obtained by transferring the three expression vectors into escherichia coli Rosetta (DE3) competent cells respectively; the induced expression conditions are that when the recombinant protein positive bacteria are cultured until OD600 is 0.6-1.0, 0.8mM IPTG is used for inducing for 10h, 0.8mM IPTG is used for inducing for 8h, and 1.4mM IPTG is used for inducing for 10h, then expressed protein products are recovered, and three recombinant proteins PCV2 Cap, PCV3 Cap and PCV4Cap are prepared through processes of ultrasonic treatment, purification and the like.

10. An antibody titer detection method is characterized by comprising the following steps:

s1, mixing the immunogenic composition of claim 1 with an adjuvant, emulsifying sufficiently to obtain an immunoreagent, immunizing for four times with the immunoreagent, and collecting negative serum and positive serum for proportional dilution;

s2, adding the target protein, namely the antigen, into the coating solution to be diluted to 2 mu g/mL, wherein each hole is 0.1mL, and the temperature is 4 ℃ overnight for more than 12 h; the coating solution is 0.05M carbonate buffer solution: NaCO₃1.59 g of NaHCO₃2.93 g distilled water to 1000mL, pH 9.6;

s3, washing the mixture for three times by PBS-T, each time for 5min, then adding 0.1mL of blocking solution into each hole, and blocking the mixture for 2h at 37 ℃;

s7, detecting the OD450 value of each hole on a microplate reader, and obtaining the serum titer if the value of positive serum is more than 2.1 than that of negative serum.