CN114381547A

CN114381547A - Molecular marker closely linked with ethylene insensitivity and salt tolerance related characters of peanuts and application

Info

Publication number: CN114381547A
Application number: CN202210077259.0A
Authority: CN
Inventors: 唐艳艳; 李鑫; 胡畅丽; 周文杰; 孙明明; 乔利仙; 朱虹; 隋炯明; 王晶珊; 刘文平
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2022-01-24
Filing date: 2022-01-24
Publication date: 2022-04-22
Anticipated expiration: 2042-01-24
Also published as: CN114381547B

Abstract

The invention discloses a molecular marker closely linked with ethylene insensitivity and salt tolerance related characters of peanuts and application thereof, belonging to the technical field of plant molecular genetics and molecular breeding. The molecular marker closely linked with the ethylene insensitivity and salt tolerance related traits of the peanuts is InDel marker Arahy01063 and/or Arahy marker Arahy 01102. The molecular marker disclosed by the invention can realize the quick detection of peanut ethylene insensitivity and salt tolerance, eliminates the influence of the environment, and has important application values for peanut molecular breeding and acceleration of the cultivation process of peanut salt tolerance varieties.

Description

Molecular marker closely linked with ethylene insensitivity and salt tolerance related characters of peanuts and application

Technical Field

The invention belongs to the technical field of plant molecular genetics and molecular breeding, and particularly relates to a molecular marker closely linked with ethylene insensitivity and salt tolerance related characters of peanuts and application thereof.

Background

Peanuts (Arachis hypogaea L.) play an important role in combating malnutrition and ensuring food safety as important oil and commercial crops in the world. In recent years, scholars at home and abroad make breakthrough progress in the aspects of new peanut variety cultivation, wild germplasm resource utilization, molecular design breeding and the like, and make great contribution to creating excellent new germplasm with high yield, high quality, stress resistance and the like and increasing the income of farmers. The salt stress can inhibit the growth of the peanuts, so that the plants are wilted, the yield is reduced, the quality of the pod fruits is deteriorated, and the commodity value is obviously reduced. With the increasing of the soil salinization, new peanut salt-tolerant germplasm is created, salt-tolerant related genes are excavated, and the cultivation of new salt-tolerant varieties has important significance for the peanut production and the effective development and utilization of saline-alkali soil.

Ethylene is an important plant hormone affecting seed germination, seedling morphology, leaf senescence, flower formation and opening, fruit ripening, organ senescence and abscission, protection against biotic and abiotic stress, and ultimately to improve yield-related traits. Therefore, the analysis of the ethylene related gene not only has important theoretical significance for disclosing an ethylene signal transduction pathway, but also provides important gene resources and basis for the aspects of digging excellent genetic sites of peanuts, breeding new peanut varieties and the like. To date, many genes related to ethylene response have been cloned, but the map-based cloning of genes related to the peanut ethylene response pathway has not been reported. With the development and improvement of a peanut genome data platform and a high-throughput molecular marker technology, particularly the publication of AA and BB genome data of diploid peanut species, the whole genome data of tetraploid wild species and tetraploid cultivated peanuts can also be obtained in a public way, so that the fine positioning and map-based cloning of genes are possible.

In recent years, most studies on ethylene signal transduction pathways have been made using arabidopsis thaliana and rice as materials and using forward genetics to screen for mutants that respond to ethylene abnormalities. When arabidopsis thaliana etiolated seedlings were treated with ethylene, a very typical "triple response" was exhibited: the root and hypocotyl become short, the hypocotyl becomes thick, and the top end of the hypocotyl is hooked, so that a set of efficient ethylene reaction mutant screening system is established. In rice, however, root and coleoptile growth exhibits two opposite phenotypes: the root is inhibited, the coleoptile is promoted, the regulation and control of the growth and development of the rice by the ethylene are possibly different from those of arabidopsis thaliana, and a rice ethylene reaction phenotype identification and mutant screening system is established based on the 'double reaction'.

At present, map-based cloning research of ethylene signal transduction pathway related genes in peanuts is not reported, and only some ethylene response factors ERF are identified. Chen et al (2012) cloned 6 ERF family transcription factor genes (AhERF1-6) and analyzed their expression levels during abiotic stress in peanuts. Wan et al (2014) screened 63 ERF genes from NCBI database, where overexpression of AhERF008 affected the root weight of Arabidopsis and overexpression of AhERF019 enhanced the tolerance of Arabidopsis to drought, high temperature and salt stress. Research shows that the ethylene response factor ERF can also influence the release of ethylene through the direct regulation and control of an ethylene synthesis path, and finally influences the development of peanut pods and seeds. Ethylene from receptors to a series of members of downstream regulatory transcription factors are involved in salt stress response processes of plants to different degrees, and ethylene generated by salt stress induction in turn positively regulates the response of plants to salt stress, but signal transduction pathways and specific mechanisms of ethylene for improving the salt tolerance of plants are not clear (in Yan et al, 2013). However, the research on the salt tolerance relationship between ethylene and peanuts has not been reported. Therefore, the elucidation of the peanut ethylene signal transduction pathway is helpful for better understanding of peanut pod development and plant stress resistance, and provides gene resources and theoretical basis for peanut high-yield breeding.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to provide a molecular marker closely linked with ethylene insensitivity and salt tolerance related characters of peanut and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

a molecular marker closely linked with peanut ethylene insensitivity and salt tolerance related traits, wherein the molecular marker is InDel marker Arahy01063 and/or Arahy 01102;

wherein, the nucleotide sequence of Arahy01063 in the peanut sensitive to ethylene and not tolerant to salt is shown in SEQ ID NO. 1, and the nucleotide sequence of Arahy01063 in the peanut insensitive to ethylene and tolerant to salt is shown in SEQ ID NO. 2;

SEQ ID NO:1：

AAGCACAGAATATGGGTGGAGAAGAAGTTAAAGATAACAACAGTTGCTATAGAGAGCGAGAGAGACTGACAGAGGTCGACAGCCACAAAGAGCGAGAGAGATCGACAGAGGCTGGTGGCTACAGAGACGAGAGAGATCGACAGAGAATGCAAAGGACGAAGTG

SEQ ID NO:2：

AAGCACAGAATATGGGTGGAGAAGAAGTTAAAGATAACAACAGTTGCTATAGAGAGCGAGAGAGAGAGATGGGGAGAGAGACTGACAGAGGTCGACAGCCACAAAGAGCGAGAGAGATCGACAGAGGCTGGTGGCTACAGAGACGAGAGAGATCGACAGAGAATGCAAAGGACGAAGTG

the nucleotide sequence of Arahy01102 in the peanuts with ethylene insensitivity and salt tolerance is shown as SEQ ID NO. 3, and the nucleotide sequence of Arahy01102 in the peanuts with ethylene insensitivity and salt tolerance is shown as SEQ ID NO. 4;

SEQ ID NO:3：

GAGTGATGTAGGGATTGTTGAAGTGGGAGAGTGATGAGCGGATAATTTATACGCTTTTTGGCATTGTTTTTAGTATGTTTTAGTTAGTTTTTATTATATTTTTATTAGTTTCTATTTAAAATTCACTTTTCTGGACTTTACTATGAGTTTGTGTGTATTTCTGTGATTTCA

SEQ ID NO:4：

GAGTGATGTAGGGATTGTTGAAGTGGGAGAGTGATGAGCGGATAATTTATACGCTTTTTGGCATTGTTTTTAGTATGTTTTTAGTATGTTTTAGTTAGTTTTTATTATATTTTTATTAGTTTCTATTTAAAATTCACTTTTCTGGACTTTACTATGAGTTTGTGTGTATTTCTGTGATTTCA

the molecular marker is applied to screening of peanut ethylene insensitivity and salt tolerance.

A method for screening ethylene insensitivity and salt tolerance of peanuts comprises the following steps:

extracting the genomic DNA of the peanuts to be screened as a template, carrying out PCR amplification by adopting a primer pair for amplifying Arahy01063 and/or Arahy01102 molecular markers, and detecting an amplification product;

if the PCR amplification product marked by Arahy01063 has a single characteristic strip with 163bp size, determining that the peanut material to be detected is ethylene-sensitive and salt-tolerant, and if one characteristic strip with 179bp size or two characteristic strips with 163bp and 179bp sizes are generated, determining that the peanut material to be detected is ethylene-insensitive and salt-tolerant;

if the PCR amplification product marked by Arahy01102 has a characteristic band with the size of 182bp, determining that the peanut material to be detected is ethylene-sensitive and salt-intolerant; if a characteristic strip with the size of 171bp or two characteristic strips with the sizes of 171bp and 182bp appear, the peanut material to be detected is judged to be ethylene insensitive and salt-tolerant.

In a specific example, a preferred primer sequence for amplifying the InDel-labeled Arahy01063 is:

Arahy01063-F:5’-AAGCACAGAATATGGGTGGA-3’；

Arahy01063-R:5’-CACTTCGTCCTTTGCATTCT-3’；

preferred primer sequences for amplifying InDel-labeled Arahy01102 are:

Arahy01102-F:5’-GAGTGATGTAGGGATTGTTGAAG-3’；

Arahy01102-R:5’-TGAAATCACAGAAATACACACAAA-3’。

in one embodiment, the reaction system for PCR amplification is: the PCR amplification total volume is 25. mu.L: DNA template 200-300 ng/. mu.L 1. mu.L, 2 × Taq Plus Master Mix II: 7 μ L, PCR Forward Primer 1 μ L, PCR Reverse Primer 1 μ L, water to 15 μ L.

The reaction program of the PCR for amplifying Arahy01063 is as follows: pre-denaturation at 95 ℃ for 4 min; 30s at 94 ℃, 30s at 58 ℃, 25s at 72 ℃ and 35 cycles; extension at 72 ℃ for 5 min.

The reaction procedure of PCR when the Arahy01102 is amplified is as follows: pre-denaturation at 95 ℃ for 4 min; 30s at 94 ℃, 30s at 57 ℃, 25s at 72 ℃ and 35 cycles; extension at 72 ℃ for 5 min.

The method for screening the ethylene insensitivity and salt tolerance of the peanuts is applied to the ethylene insensitivity and salt tolerance variety breeding of the peanuts.

A method for breeding peanut ethylene insensitive and salt tolerant varieties, in particular to identifying true and false hybrid or screening ethylene insensitive and salt tolerant peanut varieties by adopting Arahy01063 and/or Arahy01102 molecular markers in the breeding process.

The specific steps are as follows,

performing hybridization by taking an ethylene-sensitive and salt-insensitive peanut variety as a parent, and identifying true and false hybrids by adopting Arahy01063 and/or Arahy01102 molecular markers; the screened true hybrid and ethylene sensitive and salt-tolerant parent are continuously backcrossed for 4 times, filial generations with ethylene insensitive and salt-tolerant properties are screened by adopting Arahy01063 and/or Arahy01102 molecular markers after each backcross, the finally obtained filial generations are selfed for 4 times, single plants with good comprehensive properties are screened after each selfing, and the Arahy01063 and/or Arahy01102 molecular markers are used for screening the filial generations with ethylene insensitive and salt-tolerant properties in an auxiliary mode; the finally obtained strain is used for further propagation of the material.

When true and false hybrid species are identified and peanut varieties which are insensitive to ethylene and are salt-tolerant are screened, if a single characteristic strip with the size of 163bp appears in a PCR amplification product marked by Arahy01063, the peanut material to be detected is determined to be homozygous ethylene-sensitive and salt-tolerant, and if a characteristic strip with the size of 179bp appears, the peanut material to be detected is determined to be homozygous ethylene-insensitive and salt-tolerant; if two characteristic strips with the sizes of 163bp and 179bp appear, the peanut material to be detected is judged to be heterozygous ethylene insensitive and salt-tolerant;

if the PCR amplification product marked by Arahy01102 has a characteristic strip with the size of 182bp, the peanut material to be detected is determined to be homozygous ethylene-sensitive and salt-tolerant-free; if a characteristic strip with the size of 171bp appears, the peanut material to be detected is judged to be homozygous ethylene insensitive and salt-tolerant; and if two characteristic bands with the sizes of 171bp and 182bp appear, judging that the peanut material to be detected is not sensitive to heterozygous ethylene and salt-tolerant.

The molecular marker is applied to the preparation of a reagent for detecting ethylene insensitivity and salt tolerance of peanuts.

The InDel markers Arahy01063 and Arahy01102 are both positioned at the middle end of the No. 1 peanut chromosome; and the markers are respectively positioned at two sides of the peanut ethylene insensitive gene and are closely linked with the locus, and the physical distance between the markers Arahy01063 and Arahy01102 is 12.54 Mb.

The technical scheme of the invention has the advantages that:

(1) the invention develops a peanut ethylene insensitive gene related locus and provides molecular markers Arahy01063 and Arahy01102 linked with the peanut ethylene insensitive gene.

(2) The ethylene insensitivity and salt-tolerant phenotype of the peanuts are easily influenced by the environment, the ethylene insensitivity peanut varieties are screened and cultivated by naked eyes, the blindness is high, and the length of hypocotyls can be determined only by observing the length of the hypocotyls after the peanut seeds are treated by ethylene. The molecular marker provided by the invention can be used for determining the phenotype of the plant in advance before sowing or in the seedling stage, thereby greatly saving the production cost and improving the selection efficiency.

(2) The molecular marker positioned peanut ethylene insensitive gene identification method is rapid, simple and convenient, has high selection efficiency, can be realized by PCR amplification and electrophoresis directly, only needs to detect the size of amplified bands of the markers, has simple technical requirement, and can be operated by a conventional instrument; has the characteristics of high speed, high efficiency and low cost. Thereby purposefully screening the breed or strain which is insensitive to the ethylene. On one hand, the method is beneficial to fine positioning and cloning of genes, and on the other hand, the method has important application value for peanut molecular breeding and acceleration of the cultivation process of peanut salt-tolerant varieties.

(3) The auxiliary breeding selection target is clear, and the cost is saved. The ethylene-insensitive gene locus of the peanut is detected by the marker, the individual plant which is ethylene-insensitive and has better salt tolerance can be identified after the seeds are harvested, other individual plants are selected and reserved and eliminated, the breeding scale can be effectively controlled, and the process and efficiency of selective breeding of salt-tolerant varieties are improved.

Drawings

FIG. 1 shows the phenotypes of the ethylene-sensitive HY22 and the ethylene-insensitive M29 mutant after water treatment;

FIG. 2 is the phenotype of the ethylene-sensitive HY22 and the ethylene-insensitive mutant M29 mutant after ACC treatment;

FIG. 3 shows the phenotype of the ethylene-sensitive HY22 and the ethylene-insensitive M29 mutant after salt treatment;

FIG. 4 is a map of the local linkage and ethylene insensitivity map of the target region of chromosome 1 of Arachis hypogaea;

FIG. 5 is a validation of the molecular marker Arahy01063 in progeny material;

FIG. 6 shows the breeding scheme of molecular marker assisted recurrent selection to quickly breed new ethylene insensitive high-yield salt-tolerant species.

Detailed Description

Terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.

The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

Example 1 obtaining molecular markers of peanut ethylene insensitivity and linkage of salt-tolerant genes

The construction of a mutant library is completed by in vitro mutagenesis of peanut cultivar HY22 by pingyangmycin, and an ethylene-insensitive mutant M29 which has uninhibited hypocotyl elongation and good salt tolerance is screened from the constructed mutant library by referring to the method described in the invention patent 'method for directionally screening salt-tolerant bodies by in vitro mutagenesis of peanuts' application No. 201310045768.6. The mutant is hybridized with HY22, hybrid seeds are planted, and an F2 segregation population is obtained by selfing and is used for detecting and positioning ethylene insensitive gene loci. Wherein the hypocotyl elongation of peanut seeds of mutant M29 and cultivar HY22 after treatment with water, 50. mu. mol/L ACC and 0.7% NaCl respectively is shown in FIGS. 1-3; the hypocotyl elongation of mutant M29 was substantially consistent with that of cultivar HY22 under water treatment (FIG. 1), whereas the hypocotyl elongation of HY22 was significantly inhibited when treated with 50. mu. mol/L ACC or 0.7% NaCl, whereas mutant M29 was substantially consistent with that of the water-treated group and was not affected by 50. mu. mol/L ACC and 0.7% NaCl (FIGS. 2 and 3).

Selecting 30 ethylene-sensitive salt-insensitive families and 30 ethylene-insensitive salt-tolerant families from a F2 colony, carrying out DNA extraction on each family, and mixing the 30 ethylene-sensitive salt-insensitive families and the 30 ethylene-insensitive salt-tolerant families in equal amount to form two extreme individual pools. Parents HY22 and M29 and two extreme pools were sent to the company for genome re-sequencing. By calculating the Delta SNP-index value and the ED value of the pool of two extreme individuals, the 95% and 99% confidence levels are selected as the most screening threshold values, and finally the ethylene-insensitive gene is initially positioned between 47,340,162bp and 59,879,325bp of the No. 1 chromosome, and the total length is about 12.54 Mb.

Based on the initial positioning result of BSA-Seq, molecular markers were further developed in the candidate regions. 53 InDel markers which are possibly polymorphic between parents are developed according to the result of genome re-sequencing between two parents, and 26 InDel markers with polymorphisms are obtained through polymorphism analysis (Table 1). Genotype detection was performed on the segregating population and a high density genetic linkage map of the candidate interval was constructed (see FIG. 4). Combining the phenotype statistics of whether each strain is sensitive to ethylene, the key gene which is not sensitive to ethylene is finely positioned and locked in the interval of 58,602,504bp to 59,879,325bp of chromosome 1 and the length of the key gene is about 1.27 Mb. According to the one-to-one corresponding relationship of phenotype and genotype, markers Arahy01063 and Arahy01102 are obtained to be closely linked with the ethylene insensitive and salt tolerant phenotype, wherein the results of amplifying parents and F2 population by adopting a molecular marker Arahy01063 are shown in figure 5, the phenotype of the parent HY22 is ethylene sensitive and salt tolerant, and the genotype is recessive and is marked as A; the phenotype of the mutant M29 is ethylene insensitivity and salt tolerance, the genotype is dominant or heterozygous, if the heterozygous band is H, the homozygous dominant is marked as B.

Table 1 shows the 26 pairs of InDel-labeled primer sequences

Wherein, the specific nucleotide sequence of Arahy01063 in the individual sensitive to ethylene and not tolerant to salt is as follows:

SEQ ID NO:1：

the specific nucleotide sequence of Arahy01063 in ethylene insensitive and salt tolerant individuals is as follows:

SEQ ID NO:2：

the specific nucleotide sequence of Arahy01102 in ethylene-insensitive and salt-tolerant individuals is as follows:

SEQ ID NO:3：

the specific nucleotide sequence of Arahy01102 in ethylene-sensitive and salt-intolerant individuals is as follows:

SEQ ID NO:4：

example 2

Method for rapidly cultivating new species of peanut with ethylene insensitivity and salt tolerance by utilizing molecular markers Arahy01063 and/or Arahy01102

In practical application, the ethylene-sensitive and salt-insensitive peanuts are adopted for hybridization, and new peanut ethylene-insensitive and salt-tolerant varieties are bred, in the embodiment, the ethylene-sensitive and salt-tolerant peanuts HY22 and the ethylene-insensitive and salt-tolerant M29 are used as parents for hybridization breeding, and the method is only used for illustrating the invention and is not used for limiting the scope of the invention in any way.

The method takes the ethylene-sensitive and salt-tolerant peanut HY22 as a recurrent parent, the ethylene-insensitive and salt-tolerant M29 as a donor male parent, and the specific steps of the ethylene-insensitive rapid improvement of the peanut are as follows:

1. hybridization of

And selecting ethylene-sensitive and ethylene-insensitive varieties for hybridization. Taking HY22 as female parent, removing flower before 8 am every day after the plant blooms, taking male parent pollen in the next morning, and carefully smearing the pollen on the castrated female parent stigmas in the previous day; marking newly grown fruit needles after pollination for 7 days, and continuing pollination for 15 days, wherein flowers without pollination need to be removed before and after hybridization to ensure that the marked fruit needles are developed after hybridization.

2. Hybrid F1 identification

The harvested hybrids were identified using the molecular markers Arahy01063 and Arahy 01102. The method comprises the following steps:

about 0.12g of cotyledon tissue slices (preferably without affecting seed germination) are cut from the peanut hybrid away from the radicle by a scalpel blade in a 1.5ml centrifuge tube, genomic DNA is extracted by the CTAB method, dissolved in 50. mu.l of sterile water, and the concentration and quality of the DNA are detected by a spectrophotometer and gel electrophoresis.

PCR reaction and electrophoresis detection: the specific primer pairs of InDel molecular markers Arahy01063 and Arahy01102 are used for carrying out molecular marker detection on the parent and all F1 hybrids thereof. And identifying true and false hybrid species according to the electrophoresis result.

The specific primer pairs of Arahy01063 and Arahy01102 are as follows:

Arahy01063-F:5’-AAGCACAGAATATGGGTGGA-3’(SEQ ID NO:5)；

Arahy01063-R:5’-CACTTCGTCCTTTGCATTCT-3’(SEQ ID NO:6)；

Arahy01102-F:5’-GAGTGATGTAGGGATTGTTGAAG-3’(SEQ ID NO:7)；

Arahy01102-R:5’-TGAAATCACAGAAATACACACAAA-3’(SEQ ID NO:8)；

PCR amplification reaction System: the reaction system of PCR amplification is as follows: the PCR amplification total volume is 25. mu.L: DNA template 200-300 ng/. mu.L 1. mu.L, 2 × Taq Plus Master Mix II: 7 μ L, PCR Forward Primer 1 μ L, PCR Reverse Primer 1 μ L, water to 15 μ L.

Detection of PCR amplification product was carried out by 8% native polyacrylamide gel electrophoresis (Acr: Bis 39: 1).

(1) Preparing an 8% acrylamide gel preparation liquid: 10 XTBE 50mL, 39:1 (40% tailor made acrylamide stock) 100mL, and distilled water to make up to 500 mL.

(2) Electrophoresis glue solution:

the preparation of the bottom sealing glue solution comprises 150 mu L of 10% Ammonium Persulfate (APS), 15mL of 8% acrylamide glue solution and 15 mu L of tetramethyl ethylenediamine.

Preparing a large board adhesive: 350 mu.L of 10% Ammonium Persulfate (APS), 35mL of 8% acrylamide solution, and 35 mu.L of Tetramethylethylenediamine (TEMED).

(3) Silver staining: gluing every two boards: 0.3g of silver nitrate and 300mL of distilled water, wherein the ratio of the silver nitrate to the distilled water is 1: 1000. Put on a horizontal shaker and shake slowly for 15 min.

(4) Color development: color developing solution preparation, sodium hydroxide (NaOH) particle 10g, anhydrous sodium carbonate (Na)₂CO₃)0.4g (0.3-0.5g), 1mL of formaldehyde solution (CH2O), 500mL of distilled water (note: and washing the gel with distilled water, wherein the electrophoresis time is 2.5 h).

(5) And finally, scanning and photographing.

3. Screening and breeding of backcross progeny

The breeding scheme using molecular marker assisted recurrent selection, Qingdao and three quarters annually, takes approximately 3 years for the entire cycle (FIG. 6). Firstly, HY22 is used as a recurrent parent (female parent), a screened true hybrid is used as a male parent for hybridization, the harvested BC1F1 is detected again by using a molecular marker, offspring with male parent specific bands are reserved, backcrossing and screening are continuously carried out for 4 times to obtain BC4F1, and then selfing is continuously carried out for 4 times to form BC4F 5. Selecting single plants with good comprehensive properties in the population from the BC4F2 generation, continuously carrying out passage screening and assisting in genotype screening if the plant type is upright, the result is concentrated, the pods are full, the fruit type is good and salt tolerance is achieved; until the BC4F4 generation, strain selection is carried out, and strains which are neat, consistent, salt-tolerant and high in yield are selected as materials for further propagation.

By combining the results, the distribution of the ethylene insensitivity and the salt tolerance allelic variation of the peanuts in breeding offspring can be determined and controlled by detecting the molecular markers linked with or coseparated from the ethylene insensitivity and salt tolerance related gene sites of the peanuts, the molecular marker-assisted selection of the offspring in the improvement of the salt tolerance yield of the peanuts is realized, and the purpose and the accuracy are improved. In addition, the peanut is not sensitive to ethylene and the salt-tolerant character belongs to quantitative character, so the peanut is easily influenced by environment. Therefore, there is great blindness in screening and cultivating creeping peanuts by naked eyes. By using the method for selecting by combining the marker and the backcross recurrent, the breeding efficiency can be improved, and the breeding progress can be accelerated.

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

Sequence listing

<110> Qingdao agricultural university

<120> molecular marker closely linked with ethylene insensitivity and salt tolerance related traits of peanut and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 163

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 1

aagcacagaa tatgggtgga gaagaagtta aagataacaa cagttgctat agagagcgag 60

agagactgac agaggtcgac agccacaaag agcgagagag atcgacagag gctggtggct 120

acagagacga gagagatcga cagagaatgc aaaggacgaa gtg 163

<210> 2

<211> 179

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 2

aagcacagaa tatgggtgga gaagaagtta aagataacaa cagttgctat agagagcgag 60

agagagagat ggggagagag actgacagag gtcgacagcc acaaagagcg agagagatcg 120

acagaggctg gtggctacag agacgagaga gatcgacaga gaatgcaaag gacgaagtg 179

<210> 3

<211> 171

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 3

gagtgatgta gggattgttg aagtgggaga gtgatgagcg gataatttat acgctttttg 60

gcattgtttt tagtatgttt tagttagttt ttattatatt tttattagtt tctatttaaa 120

attcactttt ctggacttta ctatgagttt gtgtgtattt ctgtgatttc a 171

<210> 4

<211> 182

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 4

gagtgatgta gggattgttg aagtgggaga gtgatgagcg gataatttat acgctttttg 60

gcattgtttt tagtatgttt ttagtatgtt ttagttagtt tttattatat ttttattagt 120

ttctatttaa aattcacttt tctggacttt actatgagtt tgtgtgtatt tctgtgattt 180

ca 182

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aagcacagaa tatgggtgga 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cacttcgtcc tttgcattct 20

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gagtgatgta gggattgttg aag 23

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgaaatcaca gaaatacaca caaa 24

Claims

1. A molecular marker closely linked with ethylene insensitivity and salt tolerance related traits of peanuts is characterized in that the molecular marker is InDel marker Arahy01063 and/or Arahy 01102;

the nucleotide sequence of Arahy01102 in the peanuts with ethylene insensitivity and salt tolerance is shown as SEQ ID NO. 3, and the nucleotide sequence of Arahy01102 in the peanuts with ethylene insensitivity and salt tolerance is shown as SEQ ID NO. 4.

2. The application of the molecular marker of claim 1 in screening peanut ethylene insensitivity and salt tolerance.

3. A method for screening ethylene insensitivity and salt tolerance of peanuts is characterized by comprising the following steps:

extracting the genomic DNA of the peanuts to be screened as a template, carrying out PCR amplification by adopting a primer pair for amplifying Arahy01063 and/or Arahy01102 molecular markers, and detecting an amplification product; if the PCR amplification product marked by Arahy01063 has a single characteristic strip with 163bp size, determining that the peanut material to be detected is ethylene-sensitive and salt-tolerant, and if one characteristic strip with 179bp size or two characteristic strips with 163bp and 179bp sizes are generated, determining that the peanut material to be detected is ethylene-insensitive and salt-tolerant;

4. The method for screening the ethylene insensitivity and salt tolerance traits of peanut as claimed in claim 3, wherein the primer sequence for amplifying the InDel marker Arahy01063 is as follows:

Arahy01063-F:5’-AAGCACAGAATATGGGTGGA-3’；

Arahy01063-R:5’-CACTTCGTCCTTTGCATTCT-3’；

the primer sequence for amplifying the InDel marked Arahy01102 is as follows:

Arahy01102-F:5’-GAGTGATGTAGGGATTGTTGAAG-3’；

Arahy01102-R:5’-TGAAATCACAGAAATACACACAAA-3’。

5. the method for screening peanut ethylene insensitivity and salt-tolerant traits as claimed in claim 3,

the reaction program of the PCR for amplifying Arahy01063 is as follows: pre-denaturation at 95 ℃ for 4 min; 30s at 94 ℃, 30s at 58 ℃, 25s at 72 ℃ and 35 cycles; extending for 5min at 72 ℃;

6. The method for screening peanut ethylene insensitivity and salt-tolerant traits as claimed in any one of claims 3-5, for use in breeding peanut ethylene insensitivity and salt-tolerant varieties.

7. A method for breeding peanut ethylene insensitive and salt tolerant varieties is characterized in that Arahy01063 and/or Arahy01102 molecular markers are adopted in the breeding process to identify true and false hybrid varieties or screen the peanut varieties which are ethylene insensitive and salt tolerant.

8. The method for breeding the peanut ethylene-insensitive and salt-tolerant variety according to claim 7, which comprises the following steps,

9. The method for breeding the peanut ethylene-insensitive and salt-tolerant variety according to claim 7, wherein the primer sequence for amplifying the InDel marker Arahy01063 is as follows:

Arahy01063-F:5’-AAGCACAGAATATGGGTGGA-3’；

Arahy01063-R:5’-CACTTCGTCCTTTGCATTCT-3’；

the primer sequence for amplifying the InDel marked Arahy01102 is as follows:

Arahy01102-F:5’-GAGTGATGTAGGGATTGTTGAAG-3’；

Arahy01102-R:5’-TGAAATCACAGAAATACACACAAA-3’。

10. the application of the molecular marker of claim 1 in preparing a reagent for detecting ethylene insensitivity and salt tolerance of peanut.