CN114381547B

CN114381547B - Molecular marker closely linked with peanut ethylene insensitivity and salt tolerance related characters and application thereof

Info

Publication number: CN114381547B
Application number: CN202210077259.0A
Authority: CN
Inventors: 唐艳艳; 李鑫; 胡畅丽; 周文杰; 孙明明; 乔利仙; 朱虹; 隋炯明; 王晶珊; 刘文平
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2022-01-24
Filing date: 2022-01-24
Publication date: 2023-05-02
Anticipated expiration: 2042-01-24
Also published as: CN114381547A

Abstract

The invention discloses a molecular marker closely linked with peanut ethylene insensitivity and salt tolerance related characters and application thereof, belonging to the technical fields of plant molecular genetics and molecular breeding. The molecular markers closely linked with the characteristics of insensitivity to peanut ethylene and salt tolerance are InDel markers Arahy01063 and/or Arahy01102. The molecular marker can be used for realizing the quick detection of insensitivity and salt tolerance of peanut ethylene, and eliminating the influence of environment, and has important application value for molecular breeding of peanut and accelerating the cultivation process of peanut salt tolerance varieties.

Description

Molecular marker closely linked with peanut ethylene insensitivity and salt tolerance related characters and application thereof

Technical Field

The invention belongs to the technical fields of plant molecular genetics and molecular breeding, and particularly relates to a molecular marker closely linked with peanut ethylene insensitivity and salt tolerance related traits and application thereof.

Background

Peanuts (Arachis hypogaea l.) play an important role in combating malnutrition and ensuring grain safety as a world important oil crop and commercial crop. In recent years, students at home and abroad have made breakthrough progress in the aspects of cultivation of new peanut varieties, utilization of wild germplasm resources, molecular design breeding and the like, and have made great contribution to creating excellent new germplasm with high yield, high quality, stress resistance and the like and increasing income of peasants. And salt stress can inhibit the growth of peanuts, so that plants wilt and yield are reduced, pod quality is deteriorated, and commodity value is obviously reduced. Along with the increasing increase of soil salinization, new peanut salt-tolerant germplasm is created, salt-tolerant related genes are excavated, and the cultivation of the new salt-tolerant germplasm has important significance for peanut production and even effective development and utilization of saline-alkali soil.

Ethylene is an important plant hormone affecting seed germination, seedling morphology, leaf senescence, flower formation and opening, fruit ripening, organ senescence and abscission, and is resistant to biotic and abiotic stress, ultimately improving yield-related traits. Therefore, analysis of the ethylene related genes not only has important theoretical significance for revealing the ethylene signal transduction pathway, but also provides important gene resources and basis for the aspects of digging excellent genetic loci of peanuts, cultivating new varieties of peanuts and the like. To date, many genes related to ethylene response have been cloned, but map cloning of genes related to the peanut ethylene response pathway has not been reported. Along with development and perfection of peanut genome data platforms and high-throughput molecular marking technologies, especially the publication of AA and BB genome data of peanut diploid wild species, the whole genome data of tetraploid wild species and tetraploid cultivated peanuts can be obtained in a public way, so that fine positioning and map cloning of genes are possible.

In recent years, most of the studies on ethylene signal transduction pathways have been conducted using Arabidopsis thaliana and rice as materials, and using forward genetics to screen mutants having abnormal responses to ethylene. When arabidopsis thaliana yellowing seedlings are treated with ethylene, very typical "triple reactions" are exhibited: the root and hypocotyl become shorter, the hypocotyl becomes thicker, and hooks appear at the top end, so that a set of efficient ethylene response mutant screening system is established based on the root and hypocotyl. Whereas in rice, root and coleoptile growth exhibits two opposite phenotypes: root inhibition and coleoptile promotion indicate that the regulation of ethylene on rice growth and development can be different from that of arabidopsis thaliana, and a system for rice ethylene response phenotype identification and mutant screening is established based on the double response.

At present, the map cloning research of genes related to ethylene signal transduction pathways in peanuts is not reported, and only some ethylene response factors ERF are identified. Chen et al (2012) cloned 6 ERF family transcription factor genes (ahenf 1-6) and analyzed their expression levels during peanut abiotic stress. Wan et al (2014) screened 63 ERF genes from NCBI database, where overexpression of AhERF008 affected root weight of Arabidopsis, and overexpression of AhERF019 enhanced drought, high temperature and salt stress tolerance of Arabidopsis. Studies have shown that ethylene response factor ERF also affects ethylene release through direct regulation of the ethylene synthesis pathway, ultimately affecting peanut pod and seed development. Ethylene is involved in the plant salt stress response process to varying degrees from the receptor to a series of members that regulate transcription factors downstream, and the ethylene induced by salt stress in turn positively regulates the plant response to salt stress, but the signal transduction pathway and specific mechanisms by which ethylene increases salt tolerance in plants are not known (in the text et al, 2013). However, the research on the salt tolerance relation between ethylene and peanut has not been reported yet. Therefore, the peanut ethylene signal transduction pathway is clarified, the peanut pod development and the stress resistance of plants can be better understood, and gene resources and theoretical basis are provided for peanut high-yield breeding.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to provide a molecular marker closely linked with characteristics of insensitivity and salt tolerance of peanut ethylene and application thereof.

In order to achieve the above purpose, the invention adopts the following technical scheme:

a molecular marker closely linked to peanut ethylene insensitive and salt tolerance related traits, the molecular marker being the InDel marker Arahy01063 and/or Arahy01102;

wherein, the nucleotide sequence of Arahy01063 in the peanut which is sensitive to ethylene and not salt resistant is shown as SEQ ID NO. 1, and the nucleotide sequence of Arahy01063 in the peanut which is not sensitive to ethylene and salt resistant is shown as SEQ ID NO. 2;

SEQ ID NO:1：

AAGCACAGAATATGGGTGGAGAAGAAGTTAAAGATAACAACAGTTGCTATAGAGAGCGAGAGAGACTGACAGAGGTCGACAGCCACAAAGAGCGAGAGAGATCGACAGAGGCTGGTGGCTACAGAGACGAGAGAGATCGACAGAGAATGCAAAGGACGAAGTG

SEQ ID NO:2：

AAGCACAGAATATGGGTGGAGAAGAAGTTAAAGATAACAACAGTTGCTATAGAGAGCGAGAGAGAGAGATGGGGAGAGAGACTGACAGAGGTCGACAGCCACAAAGAGCGAGAGAGATCGACAGAGGCTGGTGGCTACAGAGACGAGAGAGATCGACAGAGAATGCAAAGGACGAAGTG

the nucleotide sequence of Arahy01102 in the peanut which is insensitive to ethylene and salt is shown as SEQ ID NO 3, and the nucleotide sequence of Arahy01102 in the peanut which is sensitive to ethylene and not salt is shown as SEQ ID NO 4;

SEQ ID NO:3：

GAGTGATGTAGGGATTGTTGAAGTGGGAGAGTGATGAGCGGATAATTTATACGCTTTTTGGCATTGTTTTTAGTATGTTTTAGTTAGTTTTTATTATATTTTTATTAGTTTCTATTTAAAATTCACTTTTCTGGACTTTACTATGAGTTTGTGTGTATTTCTGTGATTTCA

SEQ ID NO:4：

GAGTGATGTAGGGATTGTTGAAGTGGGAGAGTGATGAGCGGATAATTTATACGCTTTTTGGCATTGTTTTTAGTATGTTTTTAGTATGTTTTAGTTAGTTTTTATTATATTTTTATTAGTTTCTATTTAAAATTCACTTTTCTGGACTTTACTATGAGTTTGTGTGTATTTCTGTGATTTCA

the molecular marker is applied to the screening of insensitivity and salt resistance of peanut ethylene.

A method for screening insensitivity and salt tolerance of peanut ethylene comprises the following steps:

extracting genome DNA of peanuts to be screened as a template, adopting a primer pair for amplifying Arahy01063 and/or Arahy01102 molecular markers to carry out PCR amplification, and detecting an amplification product;

if the PCR amplification product marked by Arahy01063 has a single characteristic band with the size of 163bp, judging that the peanut material to be detected is ethylene-sensitive and salt-tolerant, and if one characteristic band with the size of 179bp or two characteristic bands with the sizes of 163bp and 179bp are present, judging that the peanut material to be detected is ethylene-insensitive and salt-tolerant;

if the PCR amplification product marked by Arahy01102 has a characteristic band with 182bp, judging that the peanut material to be detected is ethylene sensitive and salt intolerant; if one characteristic band with the size of 171bp or two characteristic bands with the sizes of 171bp and 182bp appear, the peanut material to be detected is judged to be insensitive to ethylene and salt-tolerant.

In a specific embodiment, the preferred primer sequences for amplifying the InDel marker Arahy01063 are:

Arahy01063-F:5’-AAGCACAGAATATGGGTGGA-3’；

Arahy01063-R:5’-CACTTCGTCCTTTGCATTCT-3’；

preferred primer sequences for amplifying the InDel marker Arahy01102 are:

Arahy01102-F:5’-GAGTGATGTAGGGATTGTTGAAG-3’；

Arahy01102-R:5’-TGAAATCACAGAAATACACACAAA-3’。

in a specific embodiment, the reaction system for PCR amplification is: the total volume of the PCR amplification was 25. Mu.L: 200-300 ng/. Mu.L of DNA template 1. Mu.L, 2X Taq Plus Master Mix II: 7. Mu.L, PCR Forward Primer. Mu.L, PCR Reverse Primer. Mu.L, and water to 15. Mu.L.

The PCR reaction program for amplifying Arahy01063 is as follows: pre-denaturation at 95℃for 4min;94℃30s,58℃30s,72℃25s,35 cycles; extending at 72℃for 5min.

The PCR reaction program for amplifying Arahy01102 is as follows: pre-denaturation at 95℃for 4min;94℃for 30s,57℃for 30s,72℃for 25s,35 cycles; extending at 72℃for 5min.

The method for screening the insensitivity and salt tolerance of the peanut ethylene is applied to the breeding of the variety which is insensitive to the peanut ethylene and resistant to the salt.

A method for breeding peanut varieties insensitive to ethylene and resistant to salt, in particular to a method for identifying true and false hybrid varieties or screening peanut varieties insensitive to ethylene and resistant to salt by adopting Arahy01063 and/or Arahy01102 molecular markers in the breeding process.

The specific steps are as follows,

hybridizing peanut varieties which are sensitive to ethylene and not resistant to salt and are insensitive to ethylene and resistant to salt are used as parents, and molecular markers of Arahy01063 and/or Arahy01102 are used for identifying true and false hybrid seeds; the screened true hybrid is continuously subjected to 4 times of backcrossing with ethylene-sensitive and salt-intolerant parents, after each backcrossing, arahy01063 and/or Arahy01102 molecular markers are adopted to screen offspring with ethylene-insensitive and salt-tolerant states, the finally obtained offspring are subjected to 4 times of selfing, after each selfing, single plants with good comprehensive properties are screened, and the Arahy01063 and/or Arahy01102 molecular markers are adopted to assist in screening offspring with ethylene-insensitive and salt-tolerant states; the resulting strain was used to further propagate the material.

When true and false hybrids are identified and peanut varieties insensitive to ethylene and resistant to salt are screened, if a single characteristic band with the size of 163bp appears in a PCR amplification product marked by Arahy01063, determining that the peanut material to be detected is sensitive to the homozygous ethylene and is not resistant to salt, and if a characteristic band with the size of 179bp appears, determining that the peanut material to be detected is sensitive to the homozygous ethylene and is resistant to salt; if two characteristic strips with the sizes of 163bp and 179bp appear, judging that the peanut material to be detected is insensitive to heterozygous ethylene and salt-tolerant;

if the PCR amplification product marked by Arahy01102 has a characteristic band with 182bp, judging that the peanut material to be detected is homozygous ethylene sensitive and salt intolerant; if a characteristic band with the size of 171bp appears, judging that the peanut material to be detected is homozygote ethylene insensitive and salt tolerant; if two characteristic bands with the sizes of 171bp and 182bp appear, the peanut material to be detected is judged to be insensitive to heterozygous ethylene and salt-tolerant.

The application of the molecular marker in preparing a reagent for detecting insensitivity and salt tolerance of peanut ethylene.

The InDel markers Arahy01063 and Arahy01102 are both positioned at the middle end of peanut chromosome 1; and are respectively positioned at two sides of the peanut ethylene insensitive gene, are tightly linked with the locus, and have a physical distance of 12.54Mb between the markers Arahy01063 and Arahy01102.

The technical scheme of the invention has the advantages that:

(1) The invention develops a relative locus of peanut ethylene insensitive genes and provides molecular markers Arahy01063 and Arahy01102 linked with the peanut ethylene insensitive genes.

(2) Peanut ethylene insensitive and salt tolerant phenotypes are susceptible to the environment, there is great blindness in screening and breeding ethylene insensitive peanut varieties by the naked eye, and it is necessary to observe the length of the hypocotyl after ethylene treatment of the peanut seeds. The molecular marker provided by the invention can be used for determining the phenotype of the plant in advance before sowing or in the seedling stage, so that the production cost is greatly saved and the selection efficiency is improved.

(2) The peanut ethylene insensitive gene identification method by the molecular marker positioning of the invention is quick, simple and convenient, has high selection efficiency, can be realized by directly carrying out PCR amplification and electrophoresis, and has simple technical requirements and can be operated by adopting a conventional instrument only by detecting the size of the amplified bands of the markers; has the characteristics of high speed, high efficiency and low cost. Thereby purposefully screening ethylene insensitive varieties or lines. On one hand, the method is favorable for fine positioning and cloning of genes, and on the other hand, the method has important application value for molecular breeding of peanuts and accelerating the cultivation process of salt-resistant varieties of peanuts.

(3) The auxiliary breeding selection target is clear, and the cost is saved. By marking and detecting peanut ethylene insensitive gene loci, single plants which are insensitive to ethylene and have better salt tolerance can be identified after seeds are harvested, selection and retention are carried out, other single plants are eliminated, the breeding scale can be effectively controlled, and the process and efficiency of salt tolerance variety selection breeding are improved.

Drawings

FIG. 1 is a phenotype of an ethylene-sensitive HY22 and an ethylene-insensitive mutant M29 mutant after water treatment;

FIG. 2 is a phenotype of ethylene-sensitive HY22 and ethylene-insensitive mutant M29 mutants after ACC treatment;

FIG. 3 is a phenotype of the ethylene-sensitive HY22 and the ethylene-insensitive mutant M29 mutant after salt treatment;

FIG. 4 is a map of the local linkage of the target region and ethylene insensitive localization map of chromosome 1 of peanut;

FIG. 5 is a verification of the molecular marker Arahy01063 in offspring material;

FIG. 6 is a molecular marker assisted recurrent selection breeding scheme for rapid breeding of new ethylene insensitive high yield salt tolerant varieties.

Detailed Description

The terms used in the present invention generally have meanings commonly understood by those of ordinary skill in the art unless otherwise indicated.

The invention will be described in further detail below in connection with specific embodiments and with reference to the data. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

Example 1 obtaining of molecular markers linked to ethylene insensitive and salt tolerant genes of peanut

The construction of a mutant library is completed by carrying out in-vitro mutagenesis on peanut cultivar HY22 by pingyangmycin, and an ethylene insensitive mutant M29 with uninhibited hypocotyl elongation and good salt tolerance is screened from the constructed mutant library by referring to the method described in application No. 201310045768.6 of the patent application of the invention, namely a method for screening salt tolerance by peanut in-vitro mutagenesis orientation. The mutant is hybridized with HY22, hybrid seeds are planted, F2 separation groups are obtained through selfing, and the mutant is used for detecting and positioning ethylene insensitive gene loci. Wherein the elongation of hypocotyl of mutant M29 and peanut seed of cultivar HY22 treated with water, 50. Mu. Mol/L ACC and 0.7% NaCl, respectively, is shown in FIGS. 1-3; under water treatment, mutant M29 was substantially identical to the hypocotyl elongation of cultivar HY22 (FIG. 1), whereas upon treatment with 50. Mu. Mol/L ACC or 0.7% NaCl, the hypocotyl elongation of HY22 was significantly inhibited, while mutant M29 was substantially identical to the hypocotyl elongation of the water-treated group, and was not affected by 50. Mu. Mol/L ACC and 0.7% NaCl (FIGS. 2 and 3).

And selecting 30 ethylene-sensitive and salt-intolerant families and 30 ethylene-insensitive and salt-tolerant families from the F2 population, extracting DNA from each family, and equally mixing the 30 ethylene-sensitive and salt-intolerant families and the 30 ethylene-insensitive and salt-tolerant families to form two extreme individual pools. The parents HY22 and M29, and two extreme pool companies were subjected to genome re-sequencing. The ethylene insensitive genes were finally initially mapped between chromosome 1 47,340,162bp to 59,879,325bp, with a total length of about 12.54Mb, by calculating the delta SNP-index values and ED values for both extreme pools of individuals, selecting the thresholds for which 95% and 99% confidence levels are the most screened.

And further developing molecular markers in the candidate interval according to the BSA-Seq initial positioning result. 53 InDel markers with polymorphism possibly existing between parents are developed according to genome re-sequencing results between the two parents, and 26 InDel markers with polymorphism are obtained through polymorphism analysis (table 1). Genotype detection is performed on the segregating population, and a candidate interval high-density genetic linkage map is constructed (see fig. 4). Combining the phenotype statistical result of each strain of ethylene sensitivity or not, finely positioning and locking the key gene insensitive to ethylene in the interval of No. 1 chromosomes 58,602,504bp to 59,879,325bp and the length of about 1.27 Mb. Obtaining the markers Arahy01063 and Arahy01102 which are closely linked with the ethylene insensitive and salt tolerant phenotype according to the one-to-one correspondence between the phenotype and genotype, wherein the result of amplifying the parent and F2 population by using the molecular marker Arahy01063 is shown in figure 5, the parent HY22 phenotype is ethylene sensitive and salt intolerant, the genotype is recessive, and the genotype is marked as A; the mutant M29 phenotype is insensitive to ethylene and salt tolerant, the genotype is dominant or heterozygous, if heterozygous band is H, the homozygous dominant is B.

Table 1 shows the primer sequences for 26 pairs of InDel markers

Wherein the specific nucleotide sequence of Arahy01063 in ethylene sensitive and salt intolerant individuals is as follows:

SEQ ID NO:1：

the specific nucleotide sequence of Arahy01063 in ethylene insensitive and salt tolerant individuals is as follows:

SEQ ID NO:2：

the specific nucleotide sequence of Arahy01102 in ethylene insensitive and salt tolerant individuals is as follows:

SEQ ID NO:3：

the specific nucleotide sequence of Arahy01102 in ethylene sensitive and salt intolerant individuals is as follows:

SEQ ID NO:4：

example 2

Method for rapidly cultivating new variety of ethylene-insensitive and salt-tolerant peanuts by using molecular markers Arahy01063 and/or Arahy01102

In practical application, peanut varieties which are sensitive to ethylene and not resistant to salt and are insensitive to ethylene and resistant to salt are adopted for hybridization, new peanut varieties which are insensitive to ethylene and resistant to salt are bred, in the embodiment, peanut HY22 which is sensitive to ethylene and not resistant to salt and ethylene M29 which is insensitive to ethylene and resistant to salt are used as parents for hybridization breeding, and the invention is only illustrated herein and is not limited in any way.

The specific steps of the quick improvement of the ethylene-insensitive salt-tolerant peanut HY22 serving as a recurrent parent and the ethylene-insensitive salt-tolerant M29 serving as a donor male parent are as follows:

1. hybridization

And selecting ethylene sensitive and ethylene insensitive varieties for hybridization. Taking HY22 as a female parent, removing flowers before 8 am every day after the plants bloom, taking pollen of male parent in the early morning of the next day, and carefully smearing the pollen on female parent column heads from the previous day; the newly grown needles were marked 7 days after pollination and pollination was continued for 15 days, with the non-pollinated flowers being removed prior to and after hybridization to ensure that the marked needles developed after hybridization.

2. Identification of hybrid F1

The molecular markers Arahy01063 and Arahy01102 are used to identify the harvested hybrid. The method comprises the following steps:

about 0.12g of cotyledon tissue slices (preferably without affecting seed germination) are cut off from the radicle portion of the peanut hybrid with a surgical blade, and the genomic DNA is extracted by CTAB method in a 1.5ml centrifuge tube, dissolved in 50. Mu.l of sterile water, and the concentration and quality of the DNA are detected by spectrophotometry and gel electrophoresis.

PCR reaction and electrophoresis detection: and (3) carrying out molecular marker detection on the parent and all F1 hybrid seeds thereof by utilizing a specific primer pair of InDel molecular markers Arahy01063 and Arahy01102. And identifying true and false hybrids according to the electrophoresis result.

Specific primer pairs for Arahy01063 and Arahy01102 are as follows:

Arahy01063-F:5’-AAGCACAGAATATGGGTGGA-3’(SEQ ID NO:5)；

Arahy01063-R:5’-CACTTCGTCCTTTGCATTCT-3’(SEQ ID NO:6)；

Arahy01102-F:5’-GAGTGATGTAGGGATTGTTGAAG-3’(SEQ ID NO:7)；

Arahy01102-R:5’-TGAAATCACAGAAATACACACAAA-3’(SEQ ID NO:8)；

PCR amplification reaction system: the PCR amplification reaction system is as follows: the total volume of the PCR amplification was 25. Mu.L: 200-300 ng/. Mu.L of DNA template 1. Mu.L, 2X Taq Plus Master Mix II: 7. Mu.L, PCR Forward Primer. Mu.L, PCR Reverse Primer. Mu.L, and water to 15. Mu.L.

PCR amplification product detection was performed using 8% non-denaturing polyacrylamide gel (Acr: bis=39:1) electrophoresis.

(1) Preparing 8% acrylamide glue solution: 10 XTBE 50mL,39:1 (40% specialty acrylamide mother liquor) 100mL, add distilled water make up 500mL.

(2) Electrophoresis glue solution:

preparation of bottom sealing glue solution, wherein the preparation of the bottom sealing glue solution comprises 150 mu L of 10% Ammonium Persulfate (APS), 15mL of 8% acrylamide glue solution and 15 mu L of tetramethyl ethylenediamine.

Preparing the large plate adhesive: 10% Ammonium Persulfate (APS) 350. Mu.L, 8% acrylamide solution 35mL, tetramethyl ethylenediamine (TEMED) 35. Mu.L.

(3) Silver staining: every two plate glues: silver nitrate 0.3g and distilled water 300mL, the proportion of which is 1:1000. Slowly shaking on a horizontal shaker for 15min.

(4) Color development: preparation of a color developing solution, 10g of sodium hydroxide (NaOH) particles, anhydrous sodium carbonate (Na ₂ CO ₃ ) 0.4g (0.3-0.5 g), 1mL of formaldehyde solution (CH 2O), 500mL of distilled water (note: distilled water is used for washing gel, and the electrophoresis time is 2.5 h).

(5) And finally, scanning and photographing.

3. Screening and breeding of backcross offspring

With molecular marker assisted recurrent selection breeding protocols, the entire cycle takes approximately 3 years for peninsula and three subtwo seasons each year (fig. 6). The method comprises the steps of firstly, using HY22 as recurrent parent (female parent), using the screened true hybrid as male parent to carry out hybridization, detecting the harvested BC1F1 again by using a molecular marker, reserving offspring with male parent specific bands, continuously carrying out 4 times of backcrossing and screening to obtain BC4F1, and continuously carrying out 4 times of selfing to form BC4F5. Starting from BC4F2 generation, selecting single plants with good comprehensive properties in the population, such as upright plant type, concentrated result, full pod, good fruit type and salt tolerance, continuing to carry out passage for screening, and assisting in genotype screening; and selecting the strain until the BC4F4 generation, and selecting the strain which is orderly and consistent, salt-tolerant and high in yield as a further propagation material.

By combining the results, the molecular markers which are linked or co-separated with the gene loci related to insensitivity and salt tolerance of the peanut ethylene can be detected, the distribution of insensitivity and salt tolerance allelic variation of the peanut ethylene in the breeding offspring can be determined and controlled, the auxiliary selection of the molecular markers of the offspring in the improvement of the peanut salt tolerance yield property is realized, and the purpose and accuracy are improved. In addition, peanut ethylene is insensitive and salt tolerance is a quantitative property, so that the peanut ethylene is easily influenced by the environment. Thus, there is great blindness in screening and cultivating creeping peanuts by naked eyes. By utilizing the method for selecting the marker combined with the backcross round, the breeding efficiency can be improved, and the breeding progress can be accelerated.

The above description is only a preferred embodiment of the present invention, and is not intended to limit the invention in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present invention still fall within the protection scope of the technical solution of the present invention.

Sequence listing

<110> Qingdao university of agriculture

<120> molecular marker closely linked with peanut ethylene insensitivity and salt tolerance related characters and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 163

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 1

aagcacagaa tatgggtgga gaagaagtta aagataacaa cagttgctat agagagcgag 60

agagactgac agaggtcgac agccacaaag agcgagagag atcgacagag gctggtggct 120

acagagacga gagagatcga cagagaatgc aaaggacgaa gtg 163

<210> 2

<211> 179

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 2

aagcacagaa tatgggtgga gaagaagtta aagataacaa cagttgctat agagagcgag 60

agagagagat ggggagagag actgacagag gtcgacagcc acaaagagcg agagagatcg 120

acagaggctg gtggctacag agacgagaga gatcgacaga gaatgcaaag gacgaagtg 179

<210> 3

<211> 171

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 3

gagtgatgta gggattgttg aagtgggaga gtgatgagcg gataatttat acgctttttg 60

gcattgtttt tagtatgttt tagttagttt ttattatatt tttattagtt tctatttaaa 120

attcactttt ctggacttta ctatgagttt gtgtgtattt ctgtgatttc a 171

<210> 4

<211> 182

<212> DNA

<213> peanut (Arachis hypogaea L.)

<400> 4

gagtgatgta gggattgttg aagtgggaga gtgatgagcg gataatttat acgctttttg 60

gcattgtttt tagtatgttt ttagtatgtt ttagttagtt tttattatat ttttattagt 120

ttctatttaa aattcacttt tctggacttt actatgagtt tgtgtgtatt tctgtgattt 180

ca 182

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

aagcacagaa tatgggtgga 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cacttcgtcc tttgcattct 20

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gagtgatgta gggattgttg aag 23

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tgaaatcaca gaaatacaca caaa 24

Claims

1. A molecular marker closely linked with peanut ethylene insensitivity and salt tolerance related traits, characterized in that the molecular marker is an InDel marker Arahy01063 and/or Arahy01102;

the nucleotide sequence of Arahy01102 in the ethylene insensitive salt tolerant peanut is shown as SEQ ID NO 3, and the nucleotide sequence of Arahy01102 in the ethylene insensitive salt tolerant peanut is shown as SEQ ID NO 4.

2. Use of the molecular marker of claim 1 in peanut ethylene insensitive and salt tolerant screening.

3. A method for screening peanut ethylene insensitivity and salt tolerance, which is characterized by comprising the following steps:

extracting genomic DNA of peanuts to be screened as a template, amplifying the Arahy01063 and/or Arahy01102 molecular markers in claim 1 by using a primer pair in a PCR (polymerase chain reaction), and detecting an amplified product; if the PCR amplification product marked by Arahy01063 has a single characteristic band with the size of 163bp, judging that the peanut material to be detected is ethylene-sensitive and salt-tolerant, and if one characteristic band with the size of 179bp or two characteristic bands with the sizes of 163bp and 179bp are present, judging that the peanut material to be detected is ethylene-insensitive and salt-tolerant;

4. The method for screening for insensitivity and salt tolerance of peanut ethylene according to claim 3, wherein the primer sequence for amplifying the InDel marker Arahy01063 is:

Arahy01063-F: 5’-AAGCACAGAATATGGGTGGA-3’；

Arahy01063-R: 5’-CACTTCGTCCTTTGCATTCT-3’；

the primer sequences for amplifying the InDel marker Arahy01102 are as follows:

Arahy01102-F: 5’-GAGTGATGTAGGGATTGTTGAAG-3’；

Arahy01102-R: 5’-TGAAATCACAGAAATACACACAAA-3’。

5. the method for screening for peanut ethylene insensitivity and salt tolerance according to claim 3,

the PCR reaction program for amplifying Arahy01063 is as follows: pre-denaturation at 95℃for 4min;94℃30s,58℃30s,72℃25s,35 cycles; extending at 72 ℃ for 5min;

6. Use of the method for screening peanut ethylene insensitive and salt tolerant varieties according to any one of claims 3-5 in the breeding of peanut ethylene insensitive and salt tolerant varieties.

7. A method for breeding peanut varieties which are insensitive to ethylene and resistant to salt, which is characterized in that the molecular markers of Arahy01063 and/or Arahy01102 in claim 1 are used in the breeding process to identify true and false hybrids or screen peanut varieties which are insensitive to ethylene and resistant to salt.

8. The method for breeding peanut ethylene insensitive and salt tolerant varieties according to claim 7, which is characterized by comprising the following specific steps of,

9. The method for breeding peanut ethylene insensitive and salt resistant variety according to claim 7, wherein the primer sequence for amplifying the InDel marker Arahy01063 is:

Arahy01063-F: 5’-AAGCACAGAATATGGGTGGA-3’；

Arahy01063-R: 5’-CACTTCGTCCTTTGCATTCT-3’；

the primer sequences for amplifying the InDel marker Arahy01102 are as follows:

Arahy01102-F: 5’-GAGTGATGTAGGGATTGTTGAAG-3’；

Arahy01102-R: 5’-TGAAATCACAGAAATACACACAAA-3’。

10. use of the molecular marker of claim 1 for preparing a reagent for detecting insensitivity and salt resistance of peanut ethylene.