CN114381466A

CN114381466A - Coding gene GbC4H of cinnamic acid-4-hydroxylase from cotton and application

Info

Publication number: CN114381466A
Application number: CN202210036361.6A
Authority: CN
Inventors: 陈全家; 祖倩丽; 曲延英; 陈琴; 郑凯; 邓晓娟
Original assignee: Xinjiang Agricultural University
Current assignee: Xinjiang Agricultural University
Priority date: 2022-01-13
Filing date: 2022-01-13
Publication date: 2022-04-22

Abstract

The invention provides a coding gene GbC4H of cinnamic acid-4-hydroxylase from cotton and application thereof, belonging to the technical field of genetic engineering; the nucleotide sequence of the coding gene GbC4H is shown in SEQ ID NO. 2. The coding gene GbC4H of the cinnamic acid-4-hydroxylase can regulate and control the blight resistance of cotton and can also regulate and control the accumulation of flavonoids in the cotton. The invention uses gene silencing technology to promote the expression silencing of the coding gene GbC4H, which can cause the content of flavonoids to be reduced, so that the silenced cotton is more likely to be infected by fusarium oxysporum and is easy to catch diseases.

Description

Coding gene GbC4H of cinnamic acid-4-hydroxylase from cotton and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a coding gene GbC4H of cinnamic acid-4-hydroxylase from cotton and application thereof.

Background

Monooxygenase enzymes are enzymes that directly activate molecular oxygen, adding an oxygen atom to the substrate molecule. In plants, monooxygenases affect the biosynthesis of various metabolites such as fatty acids, phenylpropanoids, alkaloids and terpenoids. Cinnamate-4-hydroxylase (C4H) is the monooxygenase of the first phenylpropanoid pathway identified from Arabidopsis thaliana. At present, the sequence and expression pattern of C4H have been reported in various plants such as poplar, tea, rape, garlic, scutellaria, tetrastigma, Ottelia diffusa, sweet potato and angelica. For example, patent CN112410354A discloses a cinnamic acid-4-hydroxylase gene ThC4H derived from radix tetrastigme and application thereof, wherein the gene is used as one of key enzymes in a phenylpropane metabolic pathway and can be used for producing resveratrol. In addition, CN102220353B discloses a novel coding sequence for coding cinnamic acid-4-hydroxylase (C4H) protein expressed in sweet potato, the gene is expressed in sweet potato, and the content of anthocyanin and precursor compound of the obtained transgenic sweet potato is improved. These reports provide important information for further investigation of C4H in the phenylpropane synthesis pathway.

At present, no report about the correlation between the coding gene of cinnamic acid-4-hydroxylase and flavonoid accumulation exists.

Disclosure of Invention

In view of the above, the invention aims to provide a coding gene GbC4H of cinnamic acid-4-hydroxylase derived from cotton and application thereof, and the cinnamic acid-4-hydroxylase coded by the coding gene GbC4H can regulate and control the fusarium wilt resistance of cotton and can also regulate and control the accumulation of flavonoids in the cotton.

The invention provides a coding gene GbC4H of cinnamic acid-4-hydroxylase derived from cotton, and the nucleotide sequence is shown in SEQ ID NO. 2.

The invention also provides a recombinant vector, into which the coding gene GbC4H is inserted.

The invention also provides a recombinant bacterium which comprises the recombinant vector in the scheme.

The invention also provides the application of the coding gene GbC4H or the recombinant vector or the recombinant bacterium in the scheme; the application comprises any one or more of the following applications:

1) regulating and controlling the blight resistance of cotton;

2) regulating and controlling a flavonoid pathway of cotton;

3) regulating and controlling the accumulation of flavonoids in cotton;

4) breeding cotton with blight resistance;

5) constructing transgenic cotton plants with reduced blight resistance.

Preferably, the flavonoid comprises flavonoid antibacterial substances.

The invention also provides a method for improving the blight resistance of cotton and/or promoting accumulation of flavonoids in cotton, which comprises the following steps: the encoding gene GbC4H of the scheme is over-expressed in cotton.

The invention also provides application of a reagent for silencing the cinnamic acid-4-hydroxylase or the coding gene GbC4H in the scheme in constructing a transgenic cotton plant with reduced blight resistance and/or reduced flavonoid accumulation.

Preferably, the agent comprises recombinant agrobacterium; the recombinant agrobacterium comprises a VIGS silencing vector for encoding a specific fragment of gene GbC 4H; the nucleotide sequence of the specific fragment of the coding gene GbC4H is shown in SEQ ID NO. 35.

Preferably, the original vector of the VIGS silencing vector is pTRV2 vector.

The invention provides a coding gene GbC4H of cinnamic acid-4-hydroxylase derived from cotton, and the nucleotide sequence is shown in SEQ ID NO. 2. The coding gene GbC4H of the cinnamic acid-4-hydroxylase can regulate and control the accumulation of flavonoids in cotton, and further regulate and control the blight resistance of cotton. The embodiment of the invention utilizes a gene silencing technology to promote the expression silencing of the coding gene GbC4H, which can cause the content of flavonoids to be reduced, so that the silenced cotton is more likely to be infected by fusarium oxysporum and is easy to attack.

Drawings

FIG. 1 is a clone of GbC4H gene;

FIG. 2 is an expression pattern of GbC4H gene in 06-146 and New sea 14 under hormone (MeJA and SA) treatment;

FIG. 3 shows the results of gene silencing efficiency detection and identification of resistance to Fusarium oxysporum of GbC4H, wherein A: a positive control silent phenotype, in which silent CLA1 (cloroplasts alterados 1) is used as a positive control, and a positive control (pTRV2:: CLA1) cotton plant presents a albino phenotype; b: the gene silencing efficiency of GbC4H is detected, when fusarium wilt is not infected at 0h, the expression level is reduced by 86.6%, and the gene silencing success of GbC4H is shown; c: the blight resistant phenotype of the no-load control plant and the silent GbC4H gene plant, the phenotype of the plant with the silent GbC4H gene (pTRV2:: GbC4H) and the plant with the silent GbC4H gene (pTRV2::00) infected by fusarium wilt are more serious than the morbidity of the no-load control plant;

FIG. 4 is the detection of downstream genes of flavonoid metabolic pathway and cotton wilt-related genes in GbC4H gene-silenced plants;

FIG. 5 shows the establishment of rutin standard curve in cotton and the content and bacteriostasis of flavonoids in plants silenced by GbC4H gene; wherein, A: establishing a rutin standard curve in cotton, wherein a linear regression equation y is 0.1322x +0.0968, and R²0.9925, namely the content of flavonoid is (A508-0.0968)/0.1322 x 100; b: the content of flavonoids before and after infecting blight bacteria by no-load control plants and silent GbC4H gene plants is as follows, pTRV2 is as follows: flavonoid content in empty-load control plants; pTRV2: 00 b: after the no-load control plant is infected with fusarium wilt bacteria, the flavonoid content in the plant body is increased; pTRV2 GbC4Ha: the flavonoid content in plants with GbC4H gene silencing; pTRV2: GbC4 Hb: after the plant silencing GbC4H gene is infected with fusarium wilt, the flavonoid content in the plant body is increased; c: bacteriostatic condition of flavonoid, a: sterile water and the same amount of fusarium oxysporum are mixed according to the proportion of 1:1 as a control group; b: mixing the extracted flavonoids with the same amount of fusarium oxysporum according to the ratio of 1:1, mixing the materials to form a test group, and standing the test group at normal temperature for 24 hours.

Detailed Description

The invention provides a coding gene GbC4H of cinnamic acid-4-hydroxylase from cotton, the nucleotide sequence is shown as SEQ ID NO.2, and the coding gene specifically comprises the following components:

atggatctcctcttcttggagaaggccctcctgggccttttcgtggcggtggtactagccatcaccatctctaagcttcgtggcaagcggttcaagctccctcctggaccattacccgtgccggtgttcggcaactggctccaagtgggtgatgacttgaaccaccgcaacttgacagatttggccaagaaatacggtgacatatttttacttcgaatgggacagcgtaatctagtggtggtgtcttcacctgagctagccaaagaggtgctccactcgcagggagtggagttcggctcaagaactaggaacgtagtgtttgatatattcacgggtaagggtcaagacatggttttcacggtgtacggagagcattggaggaaaatgaggcggatcatgacggtaccattttttaccaacaaggttgtgcaacagtacaggtttggatgggaggacgaggctgctcgtgtagtggaggacgtgaggaaaaatcccgaggcagccaccaacggaatcgttttgaggaggagattgcagctgatgatgtacaacaacatgtacagaatcatgttcgacacaagattcgagagtgaggatgatcctttgtttgttaggctcaaggctttgaacggggagaggagccggttgactcagagttttgaatacaattacggggattttattccaatcttaaggcccttcctcagaggatacttgaagatctgtaaggaggttaaggacaggaggttgcagctcttcaaggaccatttcgtcgaagagaggaagaaacttggaagcacaaaaagcatgaacaacgatggattgaaatgtgccatagatcatattttcgatgctcaacagaagggggaaatcaatgaggacaacgttctctatattgtcgagaatatcaatgttgccgcaattgagacgacactatggtcgatcgagtggggcattgcggagctggtgaaccaccctgaaatccagaagaagctgcggcatgaacttgacactgttctaggacctggtaaccagatcactgaacctgacacccacaaacttccctaccttcaggctgtgatcaaggagactttgaggttacgaatggcaattcctctactcgtgccccacatgaacctgcatgatgcgaaattgggtggctatgatatccctgctgagagcaaaatcttggtaaatgcatggtggcttgccaacaaccctgctaactggaaaaatcccgaagaatttaggcctgaaaggttcttcgaagaggaagccaaggttgaggccaacggcaatgatttccgctacctcccctttggcgtggggagaagaagttgcccaggaattattcttgcattgcccatccttggtattactttgggtcgtttggtacagaattttgagctcttgcctccccctgggcaatctcaaattgataccacggagaaaggtggacagttcagtcttcatattttgaagcattccaccattgttgctaagccaaggcaattttaa are provided. In the invention, the length of the reading frame of the coding gene GbC4H is 1518 bp.

The amino acid sequence of the cinnamic acid-4-hydroxylase coded by the coding gene GbC4H is shown as SEQ ID NO.1, and specifically comprises the following steps:

in the present invention, the cinnamic acid-4-hydroxylase contains an intact P450(PF00067) domain.

The invention also provides a recombinant vector, into which the coding gene GbC4H is inserted. In the present invention, the recombinant vector includes an overexpression vector, a knockout vector, or a silencing vector encoding gene GbC 4H.

The invention can obtain plants which can produce a large amount of flavonoid substances by transferring the overexpression vector into crops by a genetic engineering means, and the new variety of the transgenic plants can resist fusarium wilt.

In the present invention, the silencing vector is preferably a VIGS silencing vector; the original vector of the VIGS silencing vector is pTRV2 vector.

The invention also provides a recombinant bacterium which comprises the recombinant vector in the scheme. In the present invention, the original strain of the recombinant strain is preferably agrobacterium, and more preferably agrobacterium GV 3101.

1) regulating and controlling the blight resistance of cotton;

2) regulating and controlling a flavonoid pathway of cotton;

3) regulating and controlling the accumulation of flavonoids in cotton;

4) breeding cotton with blight resistance;

5) constructing transgenic cotton plants with reduced blight resistance.

In the present invention, the flavonoid includes flavonoid antibacterial substances; the flavonoid antibacterial substance has a structure of C6-C3-C6.

The invention also provides a method for improving the blight resistance of cotton and/or promoting accumulation of flavonoids in cotton, which comprises the following steps: the cinnamic acid-4-hydroxylase or the coding gene GbC4H in the scheme is over-expressed in cotton.

The invention also provides application of a reagent for silencing the cinnamic acid-4-hydroxylase or the coding gene in the scheme in constructing a transgenic cotton plant with reduced blight resistance and/or reduced accumulation of flavonoids.

In the present invention, the reagent comprises recombinant agrobacterium; the recombinant agrobacterium comprises a VIGS silencing vector for encoding a specific fragment of gene GbC 4H; the nucleotide sequence of the specific fragment of the coding gene GbC4H is shown as SEQ ID NO.35, and specifically comprises the following steps:

atggatctcctcttcttggagaaggccctcctgggccttttcgtggcggtggtactagccatcaccatctctaagcttcgtggcaagcggttcaagctccctcctggaccattacccgtgccggtgttcggcaactggctccaagtgggtgatgacttgaaccaccgcaacttgacagatttggccaagaaatacggtgacatatttttacttcgaatgggacagcgtaatctagtggtggtgtcttcacctgagctagccaaagaggtgctccactcgcagggagtggagttcggctcaagaactaggaacgtagtgtttgatatattcacgggtaagggtcaaga。

in the invention, the original vector of the VIGS silencing vector is a pTRV2 vector. The construction method of the silencing vector is not particularly limited in the invention, and the method can be a conventional method in the field.

In one embodiment of the invention, the construction method of the VIGS silencing vector comprises the following steps:

1) performing first PCR amplification by using cDNA of cotton as a template and GbC4H-F and GbC4H-R as primers to obtain a gene GbC 4H;

the nucleotide sequence of GbC4H-F is shown in SEQ ID NO. 3; the nucleotide sequence of GbC4H-R is shown in SEQ ID NO. 4;

2) inserting the GbC4H gene into a pLB-Simple Vector to obtain a first recombinant Vector;

3) performing second PCR amplification by using the first recombinant vector as a template and pTRV2-GbC4H-F and pTRV2-GbC4H-R as primers to obtain a specific fragment of the GbC4H gene; the nucleotide sequence of the pTRV2-GbC4H-F is shown as SEQ ID NO. 5; the nucleotide sequence of the pTRV2-GbC4H-R is shown in SEQ ID NO. 6;

4) inserting the specific fragment of the GbC4H gene into a pTRV2 vector to obtain a second recombinant vector;

5) and transferring the second recombinant vector into agrobacterium.

In the present invention, the cotton is preferably sea island cotton.

The method comprises the steps of firstly, carrying out first PCR amplification by using cDNA of cotton as a template and GbC4H-F and GbC4H-R as primers to obtain a GbC4H gene. In the present invention, the procedure of the first PCR amplification is 98 ℃ for 5 min; at 98 deg.C, 30s, 57 deg.C, 30s, 72 deg.C, 1min, 40s, 35 cycles; 72 ℃ for 10 min; the first PCR amplification system is as follows: PrimeSTAR Max Premix (2X): 25 mul, 2 mul of cotton cDNA, 1 mul of GbC4H-F, 1 mul of GbC4H-R and H₂O:21μl。

After the gene GbC4H is obtained, the gene GbC4H is inserted into a pLB-Simple Vector to obtain a first recombinant Vector. In the present invention, it is preferable to insert the GbC4H gene into the pLB-Simple Vector using the Lethal Based Simple Fast Cloning Kit.

After the first recombinant vector is obtained, performing second PCR amplification by using the first recombinant vector as a template and pTRV2-GbC4H-F and pTRV2-GbC4H-R as primers to obtain a specific fragment of a GbC4H gene; the nucleotide sequence of the pTRV2-GbC4H-F is shown as SEQ ID NO. 5; the nucleotide sequence of the pTRV2-GbC4H-R is shown in SEQ ID NO. 6. In the present invention, the system for the second PCR amplification is preferably: PrimeSTAR Max Premix (2X): 25 μ l, 2 μ l of the first recombinant vector template, 1 μ l of pTRV2-GbC4H-F, 1 μ l of pTRV2-GbC4H-R and H₂O:21μl。

After obtaining a specific fragment of a GbC4H gene, inserting the specific fragment of the GbC4H gene into a pTRV2 vector to obtain a second recombinant vector; the insertion site is preferably EcoRI.

After the second recombinant vector is obtained, the second recombinant vector is transferred into agrobacterium; the transfer method is preferably a freeze-thaw method.

The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention.

The materials used in the test are Gossypium barbadense L (Gossypium barbadense L.) resource materials 06-146 (anti-blight) and New Hai No. 14 (susceptible blight). 06-146 the breed characteristics of the excellent strain cultivated by the composite hybridization technology applied by Xinjiang agricultural science institute are as follows: zero type branching, high clothes division and high resistance to type II blight, which can be seen concretely in ([1] Chaiyoujun. island cotton F _ (2:5) population yield, genetic analysis of blight resistance and QTL location [ D ]. Sinkiang agricultural university, 2013.). The new sea 14 is a preferred line of new sea No. 10X army sea No.1 utilized by the agricultural scientist, and has the characteristics of zero-type branching, compact plant type and S resistance reaction to blight.

Seeds of No. 06-146 and Xinhai No. 14 are provided by Xinjiang crop genetic improvement and germplasm innovation key laboratories, and are planted in a cotton culture room with 16h (light) and 8h (dark) photoperiod, 25 ℃ of temperature and 60% -70% of relative humidity. The fusarium oxysporum strain used in the test is fusarium oxysporum f.sp.gossypii, physiological race No. 7. Seeds and blight strains of these materials were provided by cotton focus laboratory, university of agriculture, Xinjiang. The gene silencing vectors pTRV1, pTRV2 and silencing control vector pTRV2 induced by the cotton tobacco mosaic virus used in the test are provided by CLA1 and GV3101 agrobacterium strains provided by cotton key laboratory of agriculture university in Xinjiang.

The plant polysaccharide polyphenol RNA extraction kit, the pLB zero background rapid cloning kit, the Escherichia coli strain DH5a, the agarose gel DNA recovery kit, the plasmid miniextraction kit and the DNAmak are purchased from Beijing Tiangen Biotechnology Co. High fidelity DNA polymerase (

DNAMax Polymer ase) from Bao bioengineering GmbH, restriction enzymes fromSammer Feishel technologies, Inc. The reverse transcription kit, the fluorescent quantitative PCR Mix, the homologous recombinase and the common PCR Mix are purchased from Zhenjiang Aibiemeng Biotechnology limited. The primer synthesis and gene sequencing are both completed by Shanghai Bioengineering Co., Ltd.

Example 1 cloning of Cotton GbC4H Gene

Extracting total RNA of cotton by using a plant polysaccharide polyphenol RNA extraction kit, and synthesizing cotton cDNA by using a reverse transcription kit. Based on the gene sequence of GbC4H (GB _ D13G2721) (from the website of Cotton Functional Genomics Database (https:// cottonfgd. org)), Primer Premier 5 software was used to design specific amplification primers GbC4H-F (5'-cctcgaagccaaatggatc-3', SEQ ID NO.3) and GbC4H-R (5'-agagaacaagttaaaattgccttg-3', SEQ ID NO.4) of GbC4H gene. The amplification procedure is 98 ℃ for 5 min; at 98 deg.C, 30s, 57 deg.C, 30s, 72 deg.C, 1min, 40s, 35 cycles; 72 deg.C, 10 min. Sea island cotton GbC4H fragment was amplified from cDNA of resource material 06-146 cotton, constructed on pLB-Simple Vector according to the instructions of pLB zero background rapid cloning kit. Positive clones were sequenced by Shanghai Biotech Co., Ltd.

Extracting total RNA of the fusarium wilt resistant material 06-146, and performing reverse transcription to obtain cDNA. The primers GbC4H-F and GbC4H-R are used for amplification, and the amplification product is 1518bp (figure 1). After the gel is recovered and connected to a cloning vector, the sequenced gene fragment is 1518bp long, has 99.87% sequence similarity with the reference genome Hai 7124 with the number GB _ D13G2721, and the analysis of the amino acid sequence of GbC4H shows that the gossypium barbadense GbC4H protein contains a complete P450(PF00067) structural domain.

Example 2 construction of VIGS silencing vector for GbC4H Gene

Seamless cloning technology is utilized to design and construct pTRV2, namely primer pTRV2-GbC4H-F (5' -tgagtaaggttacc) of GbC4H vectorgaattcatggatctcctcttcttggaga-3 ', SEQ ID NO.5) and pTRV2-GbC4H-R (5' -ggaggccttctaga)gaattctcttgacccttacccgtgaa-3', SEQ ID NO.6), the EcoRI cleavage site is underlined. A specific fragment 347bp of the GbC4H gene was amplified by PCR and constructed on a pTRV2 vector. The constructed pTRV2 vector GbC4H is transferred into agrobacterium GV3101 by a freeze-thaw method.

Example 3 Cotton RNA extraction and analysis of expression Pattern of GbC4H Gene

Cotton seedlings of 06-146 and Xinhai 14, which were cultured for 3 weeks, were subjected to cotton wilt infection treatment, MeJA (100. mu. mol/L) and SA (100. mu. mol/L) induction treatment, respectively, with the MeJA and SA solutions sprayed with a sprayer, and the control group was sprayed with distilled water as a control, and covered with a transparent cover for moisture retention. Under the three treatment conditions, samples were taken at 0, 4, 8, 12, 24, and 48h, respectively, and were rapidly frozen with liquid nitrogen and stored in a freezer at-80 ℃ for future use. Extracting total RNA of cotton by using a plant polysaccharide polyphenol RNA extraction kit, and synthesizing cotton cDNA by using a reverse transcription kit. The real-time PCR was performed by SYBR Green dye method using the three types of cDNA treated as templates. The reaction condition is 95 ℃ for 3 min; 95 ℃ for 15s, 60 ℃ for 1min, 40 cycles. The PCR primer sequence is RTGbC 4H-F: 5'-aacctgacacccacaaacttcc-3' (SEQ ID NO.7) and RTGbC 4H-R: 5'-caaccttggcttcctcttcg-3' (SEQ ID NO. 8). The sequence of the primer is as follows by taking cotton UBQ7 as an internal reference: f: 5'-gacctacaccaagcccaagaag-3' (SEQ ID NO.9) and R: 5'-tgagcccacacttaccacaatagt-3' (SEQ ID NO. 10). Biological repetition 3 times, using

The calculation method is used for analyzing the relative expression amount of the gene.

The expression level of GbC4H gene of 06-146 and New sea 14 material is increased under the condition of MeJA and SA spraying, and the expression level of GbC4H gene is increased to 3.3 times at most after the materials are treated for 8h by 06-146 under the condition of MeJA spraying. After the new sea 14 is treated for 48 hours, the expression level of the GbC4H gene is increased to 1.5 times at most (FIG. 2). 06-146 and New sea 14 under SA treatment, the expression levels of the two materials respectively increase to the maximum in 4h and 24h, and are respectively about 2.8 times and 1.7 times.

Example 4 wilt infection treatment of plants with GbC4H Gene silencing

Selecting cotton seedlings (06-146) planted in a cotton culture chamber with a photoperiod of 16h (light)/8 h (dark) and a temperature of 25 ℃ and a relative humidity of 60% -70% for 8 days, injecting the cotton seedlings with fully expanded cotyledons according to methods such as GAO and the like, and then culturing the injected cotton seedlings in the cotton culture chamber in the dark for 24 h. After the dark culture is completed, the culture is continued under appropriate conditions. After the cotton seedlings whiten, sampling single plants of the test group and the control group, and carrying out silencing efficiency detection. In the three-leaf period of the cotton seedlings, the test group and the control group are respectively subjected to wilt infection treatment. Repeat 3 times, each injection and count at least 30 strains. The disease condition is counted according to 5-grade standard, and the disease condition index is calculated.

The GbC4H gene of Gossypium barbadense 06-146 was silenced by VIGS technology, and CLA1(cloroplastos alterados 1) was silenced as a positive control. Positive control (pTRV:: CLA1) cotton plants exhibited a albino phenotype 15 days after injection. Silencing efficiency detection finds that the expression level of the GbC4H gene is remarkably reduced, and the expression level is reduced by 86.6%, which indicates that the GbC4H gene is successfully silenced. After infecting blight bacteria, plants (pTRV2:: GbC4H) silencing GbC4H genes and unloaded control plants (pTRV2::00) are observed after 28 days, the plants silencing GbC4H genes and the unloaded control plants have yellowing, wilting and fallen leaves of leaves, the plants silencing GbC4H genes have more serious yellowing and wilting degrees than the unloaded control plants (figure 3), and disease index statistical analysis shows that the disease index (33.9) of a test group silencing GbC4H genes is obviously higher than that of the unloaded control group (28.6). In conclusion, the silencing of GbC4H gene in the sea island cotton 06-146 shows that the resistance of cotton seedlings to fusarium oxysporum is obviously reduced.

Example 5 detection of downstream genes of Metabolic pathway and genes related to Cotton wilt

In the trefoil period of cotton seedlings with GbC4H gene silencing, after blight infection treatment is carried out on a test group and a control group respectively, samples are taken at 0, 4, 8, 12, 24 and 48H respectively, and expression quantity detection is carried out on downstream genes of metabolic pathways (GbCHS, GbCHI01, GbCHI05, GbCHI06, GbCHI09, GbDFR, GbF 3' H, GbANR, GbFLS and GbANS) and cotton wilt-related genes (GbERF-like and Gbar _ D03G 002290). The assay was performed and analyzed according to the method in example 3 above, and the quantitative primers are shown in Table 1.

TABLE 1 quantitative primers

In order to research the influence of silencing of GbC4H gene on downstream genes of flavonoid pathway metabolic pathway and detect expression quantity of synthetic genes downstream of metabolic pathway, the research shows that the expression quantity of downstream genes of metabolic pathway (GbCHS, GbCHI01, GbCHI05, GbCHI06, GbCHI09, GbDFR, GbF 3' H, GbANR, GbFLS and ANS) is reduced to different degrees under the condition that cotton seedlings silencing GbC4H gene are infected by cotton wilt (figure 4), and the result shows that accumulation of flavonoids synthesized by flavonoid pathway starts from GbC4H gene. The reduction of the expression level of the GbC4H gene can influence the downstream gene to synthesize flavonoid antibacterial substances to inhibit cotton wilt. In order to research the influence of silencing of GbC4H gene on cotton wilt-related genes, expression amount detection analysis was performed on GbERF-like and Gbar _ D03G002290 reported by the former people. The GbERF-like gene is a gene participating in resisting the fusarium wilt of island cotton under the SA mediation, the expression quantity of the GbERF-like gene is up-regulated to different degrees under the condition that cotton seedlings silencing the GbC4H gene are infected by the fusarium wilt of cotton (figure 4), and researches show that the silencing of the GbC4H gene can reduce antibacterial substances, so that the disease resistance path of the GbERF-like gene under the SA mediation is activated. Gbar _ D03G002290(Gh _ D03G0209) is a key gene for resisting wilt of upland cotton, and the expression level of homologous gene Gbar _ D03G002290 in island cotton is down-regulated under the condition that island cotton 06-146 is infected by wilt (figure 4). Under the condition that cotton seedlings silencing GbC4H genes are infected by fusarium wilt, the expression level of Gbar _ D03G002290 genes is reduced firstly when no fusarium wilt is infected and is increased after the fusarium wilt is infected. The results indicate that silencing of GbC4H gene may affect a decrease in expression level of Gbar _ D03G002290 gene, but an increase in expression level of Gbar _ D03G002290 gene after stress may be associated with other pathways resistant to fusarium wilt.

Example 6 extraction of flavonoids and bacteriostatic Properties

In the three-leaf period of GbC4H gene silencing cotton seedlings, after blight infection treatment is respectively carried out on a test group and a control group, sampling is respectively carried out for 0h and 96h, stems and leaves above cotyledon base parts of the GbC4H gene silencing cotton seedlings are respectively cut to be used as test materials, drying is carried out in a constant-temperature electric heating box at 60 ℃ for 2h, crushing is carried out through a mortar, a 40-mesh sample separation sieve is carried out, powder is collected in a sampling self-sealing bag, and the powder is marked and placed in a dryer for later use. A total of 3 biological replicates were collected for each treatment. According to the extraction characteristic that the flavonoid compound is easily dissolved in ethanol and hot water, the extract is prepared by adopting a 60% ethanol water bath heating method. Accurately weighing 0.05g of prepared cotton sample in a 10mL centrifuge tube, adding 60% ethanol, marking the centrifuge tube, heating in a constant temperature water bath at 70 ℃ for 4h, fully extracting flavonoid compounds in the sample, centrifuging, taking supernate in a 10mL volumetric flask, and diluting to the constant volume with 60% ethanol for later use. And (3) putting 2mL of the prepared sample extracting solution into a 10mL volumetric flask, adding 0.5mL of 5% sodium nitrite solution, uniformly mixing, standing for 6min, adding 0.5mL of 10% aluminum nitrate solution, uniformly mixing, standing for 6min, finally adding 5mL of 4% sodium hydroxide solution, fixing the volume by using 60% ethanol solution, uniformly mixing, and standing for 15min to obtain the sample reaction mixed solution. Mixing the extracted flavonoids with the same amount of Fusarium oxysporum at a ratio of 1:1 to obtain a test group, mixing sterile water with the same amount of Fusarium oxysporum at a ratio of 1:1 to obtain a control group, standing the two treatments at normal temperature for 24h, dripping 20 μ l of the mixed solution into the center of a PDA solid culture medium, culturing in an inverted 28 deg.C incubator for 3 days, and observing. The results of the bacteriostasis test are shown in figure 5, and the results show that the flavonoids can inhibit the growth of cotton fusarium wilt.

Example 7 establishment of rutin Standard Curve and determination of Total Flavonoids content

Weighing a proper amount of rutin standard substance, dissolving with 60% ethanol to a constant volume to obtain rutin standard solution (0.2 mg/mL). Respectively sucking 0.0 mL, 0.5mL, 1.0 mL, 1.5 mL, 2.0 mL, 2.5 mL and 3.0mL of rutin standard solution (0.2mg/mL) into a 10mL volumetric flask, preparing a rutin standard reaction mixed solution according to a method of 2.8, performing spectral scanning by using an ultraviolet-visible spectrophotometer, and selecting a peak position (the position of an absorption peak in the test is 508 nm). And (3) drawing a standard curve by taking the concentration (mg/mL) of rutin as an abscissa and the absorbance at 508nm as an ordinate, and solving a linear regression equation y as ax + b. And (3) measuring the light absorption value of the reaction mixed liquid of the prepared samples at 508nm, and calculating the total flavone content of the unit sample according to a linear regression equation.

According to the rutin standard curve, a linear regression equation (figure 5) y is 0.1322x +0.0968, R²0.9925, i.e. the content of flavonoids (a508-0.0968)/0.1322 x 100. And (3) counting the content data of the flavonoids, finding that the content of the flavonoids in the control plants without inoculated bacteria is higher than that of the flavonoids in the plants without inoculated bacteria silencing GbC4H gene, and finding that the content of the flavonoids in the control plants with inoculated bacteria is lower than that of the flavonoids in the plants inoculated with bacteria silencing GbC4H gene (figure 5). Experimental results show that the GbC4H gene participates in the synthesis of flavonoids, but is not the only gene for controlling the synthesis of flavonoids, and the synthesis of flavonoids is controlled by a plurality of genes together. The flavonoids can inhibit bacteria and are related to other various biological processes, the research of main synthetase in the metabolic pathway of the flavonoids is clear, but the regulation network of the metabolic pathway of the flavonoids has certain complexity. Plays an important role in various processes of organisms, and the research on the regulation network has important significance for clarifying the role of metabolites in the biological processes.

According to the invention, the GbC4H gene is cloned, the GbC4H gene in the tobacco mosaic virus silencing and disease-resistant material 06-146 is used, the content of flavonoids is detected, the function of the GbC4H gene is explored, the reaction mechanism of regulating and controlling accumulation of flavonoids and anti-fusarium wilt of the GbC4H gene in the gossypium barbadense flavonoid channel is further discussed, and theoretical basis and gene resources are provided for the anti-fusarium wilt of gossypium barbadense. The research shows that after GbC4H is silenced in the island cotton 06-146, the resistance of cotton seedlings to fusarium oxysporum is obviously reduced. Meanwhile, the expression levels of downstream genes of the metabolic pathways are reduced to different degrees under the condition that cotton seedlings silencing GbC4H genes are infected by cotton wilt. The expression level of GbERF-like gene in SA signal transduction pathway is up-regulated, while the expression level of homologous gene Gbar _ D03G002290 in sea island cotton is down-regulated. Experiments show that the accumulation of flavonoids synthesized by the flavonoid pathway probably starts from GbC4H gene, and the synthesis of flavonoid antibacterial substances can inhibit cotton wilt under the condition of simultaneous action of downstream genes. In the research of the regulation network, the SA signal conduction pathway is found to participate in the anti-fusarium wilt mechanism of cotton, and the regulation networks of the anti-fusarium wilt of upland cotton and island cotton may be different.

Therefore, the cinnamic acid-4-hydroxylase GbC4H gene for regulating and controlling the content of flavonoids can be transferred into crops by a genetic engineering means in the future, plants producing a large amount of flavonoids can be obtained, and the new variety of the transgenic plants can resist fusarium wilt.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> Sinkiang university

<120> coding gene GbC4H of cinnamic acid-4-hydroxylase derived from cotton and application

<141> 2022-01-13

<160> 35

<170> SIPOSequenceListing 1.0

<210> 1

<211> 505

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Asp Leu Leu Phe Leu Glu Lys Ala Leu Leu Gly Leu Phe Val Ala

1 5 10 15

Val Val Leu Ala Ile Thr Ile Ser Lys Leu Arg Gly Lys Arg Phe Lys

20 25 30

Leu Pro Pro Gly Pro Leu Pro Val Pro Val Phe Gly Asn Trp Leu Gln

35 40 45

Val Gly Asp Asp Leu Asn His Arg Asn Leu Thr Asp Leu Ala Lys Lys

50 55 60

Tyr Gly Asp Ile Phe Leu Leu Arg Met Gly Gln Arg Asn Leu Val Val

65 70 75 80

Val Ser Ser Pro Glu Leu Ala Lys Glu Val Leu His Ser Gln Gly Val

85 90 95

Glu Phe Gly Ser Arg Thr Arg Asn Val Val Phe Asp Ile Phe Thr Gly

100 105 110

Lys Gly Gln Asp Met Val Phe Thr Val Tyr Gly Glu His Trp Arg Lys

115 120 125

Met Arg Arg Ile Met Thr Val Pro Phe Phe Thr Asn Lys Val Val Gln

130 135 140

Gln Tyr Arg Phe Gly Trp Glu Asp Glu Ala Ala Arg Val Val Glu Asp

145 150 155 160

Val Arg Lys Asn Pro Glu Ala Ala Thr Asn Gly Ile Val Leu Arg Arg

165 170 175

Arg Leu Gln Leu Met Met Tyr Asn Asn Met Tyr Arg Ile Met Phe Asp

180 185 190

Thr Arg Phe Glu Ser Glu Asp Asp Pro Leu Phe Val Arg Leu Lys Ala

195 200 205

Leu Asn Gly Glu Arg Ser Arg Leu Thr Gln Ser Phe Glu Tyr Asn Tyr

210 215 220

Gly Asp Phe Ile Pro Ile Leu Arg Pro Phe Leu Arg Gly Tyr Leu Lys

225 230 235 240

Ile Cys Lys Glu Val Lys Asp Arg Arg Leu Gln Leu Phe Lys Asp His

245 250 255

Phe Val Glu Glu Arg Lys Lys Leu Gly Ser Thr Lys Ser Met Asn Asn

260 265 270

Asp Gly Leu Lys Cys Ala Ile Asp His Ile Phe Asp Ala Gln Gln Lys

275 280 285

Gly Glu Ile Asn Glu Asp Asn Val Leu Tyr Ile Val Glu Asn Ile Asn

290 295 300

Val Ala Ala Ile Glu Thr Thr Leu Trp Ser Ile Glu Trp Gly Ile Ala

305 310 315 320

Glu Leu Val Asn His Pro Glu Ile Gln Lys Lys Leu Arg His Glu Leu

325 330 335

Asp Thr Val Leu Gly Pro Gly Asn Gln Ile Thr Glu Pro Asp Thr His

340 345 350

Lys Leu Pro Tyr Leu Gln Ala Val Ile Lys Glu Thr Leu Arg Leu Arg

355 360 365

Met Ala Ile Pro Leu Leu Val Pro His Met Asn Leu His Asp Ala Lys

370 375 380

Leu Gly Gly Tyr Asp Ile Pro Ala Glu Ser Lys Ile Leu Val Asn Ala

385 390 395 400

Trp Trp Leu Ala Asn Asn Pro Ala Asn Trp Lys Asn Pro Glu Glu Phe

405 410 415

Arg Pro Glu Arg Phe Phe Glu Glu Glu Ala Lys Val Glu Ala Asn Gly

420 425 430

Asn Asp Phe Arg Tyr Leu Pro Phe Gly Val Gly Arg Arg Ser Cys Pro

435 440 445

Gly Ile Ile Leu Ala Leu Pro Ile Leu Gly Ile Thr Leu Gly Arg Leu

450 455 460

Val Gln Asn Phe Glu Leu Leu Pro Pro Pro Gly Gln Ser Gln Ile Asp

465 470 475 480

Thr Thr Glu Lys Gly Gly Gln Phe Ser Leu His Ile Leu Lys His Ser

485 490 495

Thr Ile Val Ala Lys Pro Arg Gln Phe

500 505

<210> 2

<211> 1518

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggatctcc tcttcttgga gaaggccctc ctgggccttt tcgtggcggt ggtactagcc 60

atcaccatct ctaagcttcg tggcaagcgg ttcaagctcc ctcctggacc attacccgtg 120

ccggtgttcg gcaactggct ccaagtgggt gatgacttga accaccgcaa cttgacagat 180

ttggccaaga aatacggtga catattttta cttcgaatgg gacagcgtaa tctagtggtg 240

gtgtcttcac ctgagctagc caaagaggtg ctccactcgc agggagtgga gttcggctca 300

agaactagga acgtagtgtt tgatatattc acgggtaagg gtcaagacat ggttttcacg 360

gtgtacggag agcattggag gaaaatgagg cggatcatga cggtaccatt ttttaccaac 420

aaggttgtgc aacagtacag gtttggatgg gaggacgagg ctgctcgtgt agtggaggac 480

gtgaggaaaa atcccgaggc agccaccaac ggaatcgttt tgaggaggag attgcagctg 540

atgatgtaca acaacatgta cagaatcatg ttcgacacaa gattcgagag tgaggatgat 600

cctttgtttg ttaggctcaa ggctttgaac ggggagagga gccggttgac tcagagtttt 660

gaatacaatt acggggattt tattccaatc ttaaggccct tcctcagagg atacttgaag 720

atctgtaagg aggttaagga caggaggttg cagctcttca aggaccattt cgtcgaagag 780

aggaagaaac ttggaagcac aaaaagcatg aacaacgatg gattgaaatg tgccatagat 840

catattttcg atgctcaaca gaagggggaa atcaatgagg acaacgttct ctatattgtc 900

gagaatatca atgttgccgc aattgagacg acactatggt cgatcgagtg gggcattgcg 960

gagctggtga accaccctga aatccagaag aagctgcggc atgaacttga cactgttcta 1020

ggacctggta accagatcac tgaacctgac acccacaaac ttccctacct tcaggctgtg 1080

atcaaggaga ctttgaggtt acgaatggca attcctctac tcgtgcccca catgaacctg 1140

catgatgcga aattgggtgg ctatgatatc cctgctgaga gcaaaatctt ggtaaatgca 1200

tggtggcttg ccaacaaccc tgctaactgg aaaaatcccg aagaatttag gcctgaaagg 1260

ttcttcgaag aggaagccaa ggttgaggcc aacggcaatg atttccgcta cctccccttt 1320

ggcgtgggga gaagaagttg cccaggaatt attcttgcat tgcccatcct tggtattact 1380

ttgggtcgtt tggtacagaa ttttgagctc ttgcctcccc ctgggcaatc tcaaattgat 1440

accacggaga aaggtggaca gttcagtctt catattttga agcattccac cattgttgct 1500

aagccaaggc aattttaa 1518

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cctcgaagcc aaatggatc 19

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agagaacaag ttaaaattgc cttg 24

<210> 5

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgagtaaggt taccgaattc atggatctcc tcttcttgga ga 42

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggaggccttc tagagaattc tcttgaccct tacccgtgaa 40

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aacctgacac ccacaaactt cc 22

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caaccttggc ttcctcttcg 20

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gacctacacc aagcccaaga ag 22

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgagcccaca cttaccacaa tagt 24

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tctcttttgg gtcatggaat tac 23

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cttcgtattt gtcgtcagct gcc 23

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggttacaggt gattttgaga 20

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ccttggcctg aaatagtga 19

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tgaacctgaa gttgtagggc attta 25

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ctgccaatcg gtccctca 18

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cgttacaggt gattttgaga 20

<210> 18

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccttggcctg aaatagtga 19

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tgggtatggc gtattatttg tct 23

<210> 20

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ttgccttctt ctgttgacct tt 22

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cagcaatgac gcaacgaatc 20

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

agtgtttctt cgtcggagtc g 21

<210> 23

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ctccactgtt ccctcctcgt a 21

<210> 24

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

aaataaaaca ggtaaagggg agc 23

<210> 25

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gaggaaggtg gtggataaac tgt 23

<210> 26

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tcgccaatgt gaataataag gg 22

<210> 27

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

agcaaaggct aaacaggaaa catc 24

<210> 28

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cttttctttc gtcgggcttt c 21

<210> 29

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

accgtcacaa gttatgaaac cgct 24

<210> 30

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

ctatcagatt cctcgtaaac agtcgtc 27

<210> 31

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

cggctctggg ttcattggt 19

<210> 32

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

ctcagggtcc tcggactcg 19

<210> 33

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tcggcgagta ttcgtgacc 19

<210> 34

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

caggcttccc cttgcgtt 18

<210> 35

<211> 347

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

atggatctcc tcttcttgga gaaggccctc ctgggccttt tcgtggcggt ggtactagcc 60

atcaccatct ctaagcttcg tggcaagcgg ttcaagctcc ctcctggacc attacccgtg 120

ccggtgttcg gcaactggct ccaagtgggt gatgacttga accaccgcaa cttgacagat 180

ttggccaaga aatacggtga catattttta cttcgaatgg gacagcgtaa tctagtggtg 240

gtgtcttcac ctgagctagc caaagaggtg ctccactcgc agggagtgga gttcggctca 300

agaactagga acgtagtgtt tgatatattc acgggtaagg gtcaaga 347

Claims

1. A coding gene GbC4H of cinnamic acid-4-hydroxylase from cotton has a nucleotide sequence shown in SEQ ID No. 2.

2. A recombinant vector into which the coding gene GbC4H according to claim 1 is inserted.

3. A recombinant bacterium comprising the recombinant vector according to claim 2.

4. The use of the coding gene GbC4H of claim 1 or the recombinant vector of claim 2 or the recombinant bacterium of claim 3; the application comprises any one or more of the following applications:

1) regulating and controlling the blight resistance of cotton;

2) regulating and controlling a flavonoid pathway of cotton;

3) regulating and controlling the accumulation of flavonoids in cotton;

4) breeding cotton with blight resistance;

5) constructing transgenic cotton plants with reduced blight resistance.

5. The use according to claim 4, wherein the flavonoids comprise flavonoid antibacterial substances.

6. A method for improving the fusarium wilt resistance of cotton and/or promoting accumulation of flavonoids in cotton comprises the following steps: over-expressing the coding gene GbC4H of claim 1 in cotton.

7. Use of an agent that silences the coding gene of claim 1, GbC4H, in the construction of a transgenic cotton plant with reduced wilt resistance and/or reduced accumulation of flavonoids.

8. The use of claim 7, wherein the agent comprises recombinant Agrobacterium; the recombinant agrobacterium comprises a VIGS silencing vector for encoding a specific fragment of gene GbC 4H; the nucleotide sequence of the specific fragment of the coding gene GbC4H is shown in SEQ ID NO. 35.

9. The use of claim 8, wherein the vector of origin of the VIGS silencing vector is pTRV2 vector.