CN114381457A - DNA molecule, oligonucleotide and kit for detecting c.1026+32T > G site mutation of human PTEN gene - Google Patents

DNA molecule, oligonucleotide and kit for detecting c.1026+32T > G site mutation of human PTEN gene Download PDF

Info

Publication number
CN114381457A
CN114381457A CN202210002016.0A CN202210002016A CN114381457A CN 114381457 A CN114381457 A CN 114381457A CN 202210002016 A CN202210002016 A CN 202210002016A CN 114381457 A CN114381457 A CN 114381457A
Authority
CN
China
Prior art keywords
detecting
mutation
kit
pten gene
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210002016.0A
Other languages
Chinese (zh)
Inventor
董春燕
王淑一
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Adicon Clinical Laboratories Center Inc
Original Assignee
Adicon Clinical Laboratories Center Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Adicon Clinical Laboratories Center Inc filed Critical Adicon Clinical Laboratories Center Inc
Priority to CN202210002016.0A priority Critical patent/CN114381457A/en
Publication of CN114381457A publication Critical patent/CN114381457A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a DNA molecule, a primer for detecting mutation of c.1026+32T > G locus of a human PTEN gene, a kit and a using method thereof, wherein the kit comprises a primer for amplifying c.1026+32T > G locus of the PTEN gene; PCR reaction solution; the invention also provides a use method of the kit for detecting the mutation of the c.1026+32T > G locus of the human PTEN gene, can be used for quickly detecting the mutation of the c.1026+32T > G locus of the gene PTEN, can be helpful for screening molecular markers of AD susceptible people, and has important practical significance for early prevention, early diagnosis and early treatment of diseases of susceptible individuals and family members thereof.

Description

DNA molecule, oligonucleotide and kit for detecting c.1026+32T & gtG site mutation of human PTEN gene
Technical Field
The invention belongs to the technical field of gene detection, and particularly relates to a primer and a kit for detecting c.1026+32T > G site mutation of a human PTEN gene and a using method thereof.
Background
The Phosphatase (PTEN) gene whose tensin is homologously deleted on chromosome 10, also known as MMACI/TEP1, is located on human chromosome 10q23.3 at about 218kb, and comprises 9 exons and 8 introns, and its cDNA sequence contains 1 open reading frame consisting of 1209 nucleotides, and encodes a protein consisting of 403 amino acids, which is the only gene with dual specific phosphatase functions of lipid and protein found so far. Previous studies have shown that PTEN has functions of regulating cell cycle, inhibiting tumor cell growth, inhibiting angiogenesis, etc., and in addition, PTEN plays an important role in various physiological functions of embryo growth, development, cell differentiation, aging, etc. In recent years, data indicate that PTEN can specifically cleave D3 phosphate of phosphatidylinositol-3, 4, 5-triphosphate (PIP3) and antagonize PI3K/Akt mediated signal transduction pathway, thereby inhibiting proliferation, growth and survival of cells. In addition, in studying the role of PTEN in neuronal function regulation and the development of neurological diseases, PTEN was found to modulate hippocampal neuronal Akt activity and NMDA receptor function.
Alzheimer' S disease (AD) is a chronic, neurodegenerative disease, with increasing incidence of disease with age, often occurring in older people over 65 years. The main disease parts of AD are hippocampus, cerebral cortex and the like, the pathological features of AD are senile plaque, nerve fiber winding and selective neuron and synapse loss, the clinical early stage shows dysmnesia and cognitive disorder as main manifestations, and the late stage shows mental symptoms. At present, the pathogenesis and pathogenesis of AD are not clear, and a plurality of researches suggest that tau protein plays an important role in the occurrence and development of AD, phosphorylated tau protein is gathered in cells of AD degenerative neurons and is related to the clinical dementia degree of AD patients, and phosphorylation of tau protein and PI (proline-tyrosine kinase)3Inhibition of the K/Akt signaling pathway, and PI3The K/Akt pathway is closely related to AD to inhibit PI3The K/Akt pathway can promote AD pathological changes. Research also shows that PTEN overexpression can reduce tau protein phosphorylation in cells, PTEN mutation can enhance tau protein phosphorylation, and PTEN acts on tau protein by reducing ERK activity, so that inhibition of PTEN lipid phosphatase activity can resist tau protein hyperphosphorylation and inhibit or delay the occurrence and development of AD, and PTEN abnormal expression influences tau protein phosphorylation and is one of pathogenesis of AD.
Disclosure of Invention
The invention aims to provide a primer for detecting c.1026+32T > G site mutation of a human PTEN gene, a kit and a use method thereof, which have potential to be used as a molecular marker for screening AD susceptible population and have important practical significance for early prevention, early diagnosis and early treatment of diseases of susceptible individuals and family members thereof.
The invention provides a DNA molecule, wherein the base sequence of the DNA molecule generates c.1026+32T > G site mutation.
Preferably, the mutation of the DNA molecule is based on alignment with PTEN standard sequence NG _ 007466.2.
Preferably, the oligonucleotide specifically hybridizes to a DNA molecule that is mutated at the c.1026+32T > G site of the human PTEN gene.
The invention also provides an oligonucleotide for detecting c.1026+32T > G site mutation of the human PTEN gene, which is characterized by comprising a pair of primers for detecting c.1026+32T > G site mutation of the human PTEN gene.
Preferably, the base sequences of the pair of primers are: SEQ 8-F: ACCATTGAAATTTATATGCCACC, respectively;
SEQ8-R：TGCTGCCGGTAAACTCCAC。
preferably, the oligonucleotide further comprises a pair of sequencing primers, and the base sequences of the pair of sequencing primers are:
M13-F：TGTAAAACGACGGCCAGT；
M13-R：AACAGCTATGACCATG。
the invention also provides a kit for detecting the mutation of the c.1026+32T > G locus of the human PTEN gene, which comprises oligonucleotides for detecting the mutation of the c.1026+32T > G locus of the human PTEN gene.
Preferably, the oligonucleotide specifically hybridizes to a DNA molecule that is mutated at the c.1026+32T > G site of the human PTEN gene.
Preferably, the oligonucleotides include a pair of primers that detect mutations at the c.1026+32T > G sites of the human PTEN gene.
Preferably, the base sequences of the pair of primers are:
SEQ8-F：ACCATTGAAATTTATATGCCACC；
SEQ8-R：TGCTGCCGGTAAACTCCAC。
the invention also provides a use method of the kit for detecting the c.1026+32T > G site mutation of the human PTEN gene, which comprises the following steps:
(1) extracting nucleic acid of a sample: the sample is peripheral blood, and the nucleic acid is extracted by adopting a Tiangen blood genome extraction kit;
(2) preparing a PCR reaction solution: pre-mixing and subpackaging PCR buffer solution, dNTPs, DNA Polymerase and primers according to the quantity required by an experiment by using a high-success-rate PCR enzyme KOD Fx of TOYOBO company, finally adding an unknown DNA template, a positive reference substance and a negative reference substance to form a PCR reaction system, mixing uniformly, and isolating instantly for 5s to perform PCR amplification;
the base sequence of the primer for amplifying the mutation of the c.1026+32T > G site of the PTEN gene is as follows:
SEQ8-F：ACCATTGAAATTTATATGCCACC；
SEQ8-R：TGCTGCCGGTAAACTCCAC；
(3) and (3) PCR amplification: stage 1: 94 ℃ for 2 min; stage 2: 98 ℃, 10sec, 58 ℃, 30sec, 72 ℃, 50sec, 40 cycles; stage 3: 68 ℃ for 6 min; 4 ℃, forever;
(4) after the PCR reaction is finished, carrying out preliminary result interpretation through agarose gel electrophoresis;
(5) sequencing the product in the step (3) by using sequencing primers M13-F and M13-R to obtain an amplified gene sequence;
the sequencing primer base sequence is:
M13-F：TGTAAAACGACGGCCAGT
M13-R：AACAGCTATGACCATG；
(6) comparing the gene sequence obtained in the step (5) with a PTEN standard sequence in a known gene library, judging a sequencing result, and determining whether the PTEN gene in an unknown sample generates c.1026+32T > G site mutation;
has the advantages that: (1) the primer for detecting C.1026+32T & gtG site mutation of the PTEN gene ensures the specificity of a detection result; (2) by adopting a Sanger generation sequencing technology, compared with a fluorescent quantitative PCR method, the method avoids the use of probes and the complexity of data processing, reduces the detection cost, is simpler to operate, reduces the workload of the detection process and saves the manpower; (3) DNA sequence results can be obtained through Sanger generation sequencing, and the accuracy of detection results is improved through comparison with standard sequences; (4) a stable amplification system is constructed by optimizing reaction conditions, so that the amplification efficiency can reach the best, and the sensitivity of an experiment is improved; (5) the invention discovers that the PTEN gene generates c.1026+32T > G mutation for the first time, has potential to be used as a molecular marker for screening AD susceptible population, and has important practical significance for early prevention, early diagnosis and early treatment of diseases of susceptible individuals and family members thereof.
Drawings
FIG. 1 shows agarose gel electrophoresis of the sample band with a size of 517 bp.
FIG. 2 alignment chart of c.1026+32T > G sites of PTEN gene without mutation, i.e. T > T.
FIG. 3 alignment chart of sequences of PTEN gene c.1026+32T > G site T > G mutation or T > T/G heterozygous mutation, wherein T > T/G indicates that sample c.1026+32T > G site is partially mutated, and partial T is replaced by G, namely T > T/G.
FIG. 4 c.1026+32T mutation point from the last amino acid of exon 8, i.e., the 3' splice site, the box position is the position of c.1026+ 32T.
Detailed Description
Example 1
The primer for detecting c.1026+32T > G site mutation of the human PTEN gene has the base sequence as follows:
SEQ8-F：ACCATTGAAATTTATATGCCACC
SEQ8-R：TGCTGCCGGTAAACTCCAC
the primer for amplifying the c.1026+32T > G site mutation of the PTEN gene comprises a sequencing primer, and the base sequence of the primer is as follows:
M13-F：TGTAAAACGACGGCCAGT
M13-R：AACAGCTATGACCATG
in the invention, a kit for detecting mutation of c.1026+32T > G locus of human PTEN gene comprises a primer for detecting mutation of c.1026+32T > G locus of PTEN gene and PCR reaction solution; the PCR reaction solution comprises PCR buffer (2X PCR buffer for KOD FX), dNTPs (2mM dNTPs), DNA Polymerase (KOD FX (1.0U/. mu.l)), DEPC water; the initial concentration of the upstream and downstream primers used was 10. mu.M.
The kit is frozen and stored at the temperature of-20 ℃, and repeated freezing and thawing are avoided.
In the present invention, the kit is used in a method, and comprises the following steps:
(1) extracting nucleic acid of a sample: the sample is peripheral blood, and the nucleic acid is extracted by adopting a Tiangen blood genome extraction kit;
(2) preparing a PCR reaction solution: premixing and packaging PCR buffer solution, dNTPs, DNA Polymerase and primers according to the quantity required by an experiment by using a high-success-rate PCR enzyme KOD Fx of TOYOBO company, finally adding an unknown DNA template to form a PCR reaction system, mixing uniformly, isolating instantly for 5s, and carrying out PCR amplification;
the base sequence of the primer for amplifying the mutation of the c.1026+32T > G site of the PTEN gene is as follows:
SEQ8-F：ACCATTGAAATTTATATGCCACC
SEQ8-R：TGCTGCCGGTAAACTCCAC
(3) and (3) PCR amplification: stage 1: pre-denaturation at 94 ℃ for 2 min; stage 2: denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 30sec, extension at 72 ℃ for 50sec, and cycle for 40 cycles; stage 3: final extension at 68 deg.C for 6 min; 4 ℃, forever;
(4) after the PCR reaction is finished, carrying out preliminary result interpretation through agarose gel electrophoresis;
(5) sequencing the product in the step (3) by using sequencing primers M13-F and M13-R to obtain an amplified gene sequence;
the sequencing primer base sequence is:
M13-F：TGTAAAACGACGGCCAGT
M13-R：AACAGCTATGACCATG
the sequencing system reagent comprises: sequencing purification solution (ExoI:0.6U, CIP:1.2U), EDTA (125mmol), absolute ethanol, 75% ethanol, HIDI (highly deionized formamide), sequencing primers: and (3.2) upstream and downstream primers for detecting PTEN mutation sites.
(6) Comparing the gene sequence obtained in the step (5) with a PTEN standard sequence in a known gene library, judging a sequencing result, and determining whether the PTEN gene of an unknown sample has c.1026+32T > G site mutation;
example 2
(1) Extraction of peripheral blood genomic DNA
In the using method of the kit, the Tiangen blood genome extraction kit is adopted for extracting the nucleic acid of the sample, the NANODROP2000 spectrophotometer is adopted for measuring the DNA concentration and the purity, and the specific operation steps are as follows:
1) to 200. mu.L of blood was added 20. mu.L of LProteinase K solution, and the mixture was mixed well.
2) Adding 200 μ L buffer GB, mixing thoroughly, standing at 70 deg.C for 10min, and clarifying the solution.
3) Add 200. mu.L of absolute ethanol and mix well with shaking for 15s, at which time a flocculent precipitate may appear.
4) The solution was introduced into an adsorption column CB3, centrifuged at 12,000rpm for 30 seconds, and the waste liquid was discarded.
5) To the adsorption column CB3, 500. mu.L of buffer GD was added, and the mixture was centrifuged at 12,000rpm for 30 seconds, and the waste liquid was discarded.
6) 600. mu.L of the rinsing solution PW was added to the adsorption column CB3, and the mixture was centrifuged at 12,000rpm for 30 seconds, and the waste solution was discarded.
7) Operation 6 is repeated.
8) The adsorption column CB3 was returned to the collection tube, centrifuged at 12,000rpm for 2min, and the waste liquid was discarded. The adsorption column CB3 was left at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.
9) Transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50 mu L of elution buffer TE into the middle part of the adsorption membrane, standing at room temperature for 2-5min, centrifuging at 12,000rpm for 2min, and collecting the solution into the centrifuge tube.
(2) Preparing the PCR reaction solution:
using the high success rate PCR enzyme KOD Fx from TOYOBO, PCR amplification reagents included: 2mM dNTPs, 2 XPCR Buffer for KOD FX, KOD FX (1.0U/. mu.l), DEPC water;
the PCR reaction system is 20 mu l, PCR buffer solution, dNTPs, DNA Polymerase, DEPC water and primers are premixed and packaged into 19 mu l according to the quantity required by the experiment, finally, unknown DNA template, positive reference substance and negative reference substance are added to form the PCR reaction system, 1 mu l DNA in the PCR reaction solution of the detection system is added, and 1 mu l DEPC water is directly added to the negative reference substance. After mixing, the mixture was centrifuged briefly to collect the liquid adhering to the tube wall, and finally PCR amplification was performed.
(2) Amplification:
PCR amplification was performed using an ABI veriti.96w PCR instrument. The reaction conditions were as follows:
stage 1: pre-denaturation at 94 ℃ for 2 min;
stage 2: denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 30sec, extension at 72 ℃ for 50sec, and cycle for 40 cycles;
stage 3: final extension at 68 deg.C for 6 min; 4 ℃, forever;
(4) electrophoresis:
1.5% agarose gel electrophoresis, 110V, 35min, observing by a gel imaging system through a full-automatic gel imaging analyzer (culture JS-680D), and preliminarily judging the experimental result according to the existence and the size of a strip.
(5) Sanger sequencing:
take 9. mu.L of PCR product and 2. mu.L of purification system. Purification was performed according to the following procedure:
Figure BDA0003455043990000061
Figure BDA0003455043990000071
mu.l of the purified product was mixed with the upper and lower sequencing primers, respectively, according to the following system:
Figure BDA0003455043990000072
sequencing reaction program:
Figure BDA0003455043990000073
and (3) a precipitation link:
adding 2 mu l of 125mmol EDTA into the product after the sequencing reaction, and standing for 5 min; adding 15 mul of absolute ethyl alcohol, and mixing evenly by vortex; centrifuging at 3700rpm for 30 min; inverting, centrifuging for 15sec, adding 50ml 70% ethanol, and mixing by vortex; centrifuging at 3700rpm for 15 min; inverting and centrifuging for 15sec, and placing on a metal bath at 95 ℃; after addition of 10. mu.l CBL, denaturation was carried out for 5min and finally sequencing was carried out on a sequencer (ABI3730) at-20 ℃ for 2 min.
(6) And (3) analyzing a sequencing result:
the invention adopts SeqMan software to identify and analyze mutation sites, specifically compares a DNA sequence obtained by sequencing with a PTEN standard sequence (NG-007466.2), and reports the result according to the actual mutation condition.
Example 3 samples for clinical preliminary diagnosis of AD were tested using the test kit of the invention.
In total, 10 samples were taken and tested, and genomic DNA was extracted, and reagents were prepared and tested as described in example 2.
Each sample was added to 2ul of the PCR reaction solution in the detection system. The detection time in the PCR instrument is 100 minutes. The results of the 10 sample experiments are shown in the following table:
sample numbering c.1026+32T mutational events
1S-227 T/G
1S-230 T/G
1S-254 T
1S-255 T/G
1S-256 G
1S-272 T
1S-273 T
1S-288 G
1S-285 T/G
1S-216 T/G
From the table, it was found that the mutation incidence of c.1026+32T was 70%.
Example 4 randomized clinical sample testing
Randomly taking 10 parts of clinical samples to be detected, extracting genome DNA, preparing a reagent and detecting according to the method described in the embodiment 2. Each sample was added to 2. mu.l of the detection system PCR reaction solution. The detection is carried out by a common PCR instrument for 100 minutes. The results of the experiment are as follows:
sample numbering c.1026+32T mutational events
217 T
218 T/G
219 G
220 T
221 T
267 T
271 G
274 T/G
293 T
296 T/G
217 T
From the table it can be analytically found that the mutation incidence of c.1026+32T is 50%, by reviewing the sample situation and follow-up, where samples 219 and 271 are elderly patients and have some cognitive impairment.
Example 5 results analytical judgment
By analyzing example 3 and example 4, it was found that there was a certain correlation between PTEN mutation and senile dementia (AD), and the incidence of c.1026+32T > G mutation was increased. For this reason, analysis using the Mutation Survey software revealed that this Mutation site was very close to the cleavage site at the 3' end of exon 8 of PTEN, and thus had some regulatory effect on PTEN cleavage when translating proteins. The specific sites are shown in FIG. 4.
Sequence listing
<110> Hangzhou Aidikang medical inspection center Co., Ltd
<120> DNA molecule, oligonucleotide and kit for detecting c.1026+32T > G site mutation of human PTEN gene
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
accattgaaa tttatatgcc acc 23
<210> 2
<211> 19
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
tgctgccggt aaactccac 19
<210> 3
<211> 18
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
tgtaaaacga cggccagt 18
<210> 4
<211> 16
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 4
aacagctatg accatg 16

Claims (10)

1. A DNA molecule having a base sequence with a c.1026+32T > G site mutation.
2. The DNA molecule of claim 1, which is mutated based on alignment with PTEN standard sequence NG _ 007466.2.
3. An oligonucleotide for detecting mutations at the c.1026+32T > G sites of the human PTEN gene, wherein the oligonucleotide specifically hybridizes to a DNA molecule which is mutated at the c.1026+32T > G sites of the human PTEN gene.
4. An oligonucleotide for detecting c.1026+32T > G site mutation of human PTEN gene, which is characterized in that the oligonucleotide comprises a pair of primers for detecting c.1026+32T > G site mutation of human PTEN gene.
5. The oligonucleotide of claim 4, wherein the pair of primers have a base sequence of:
SEQ8-F：ACCATTGAAATTTATATGCCACC；
SEQ8-R：TGCTGCCGGTAAACTCCAC。
6. the oligonucleotide of claim 5, further comprising a pair of sequencing primers having the base sequences of:
M13-F：TGTAAAACGACGGCCAGT；
M13-R：AACAGCTATGACCATG。
7. a kit for detecting c.1026+32T > G site mutation of a human PTEN gene, which is characterized by comprising oligonucleotides for detecting c.1026+32T > G site mutation of the human PTEN gene.
8. The kit of claim 6 wherein the oligonucleotide specifically hybridizes to a DNA molecule mutated at the c.1026+32T > G site of the human PTEN gene.
9. The kit of claim 6, wherein the oligonucleotides comprise a pair of primers that detect mutations at the c.1026+32T > G sites of the human PTEN gene.
10. The kit according to claim 8, wherein the pair of primers have base sequences of:
SEQ8-F：ACCATTGAAATTTATATGCCACC；
SEQ8-R：TGCTGCCGGTAAACTCCAC。
CN202210002016.0A 2022-01-04 2022-01-04 DNA molecule, oligonucleotide and kit for detecting c.1026+32T > G site mutation of human PTEN gene Pending CN114381457A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210002016.0A CN114381457A (en) 2022-01-04 2022-01-04 DNA molecule, oligonucleotide and kit for detecting c.1026+32T > G site mutation of human PTEN gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210002016.0A CN114381457A (en) 2022-01-04 2022-01-04 DNA molecule, oligonucleotide and kit for detecting c.1026+32T > G site mutation of human PTEN gene

Publications (1)

Publication Number Publication Date
CN114381457A true CN114381457A (en) 2022-04-22

Family

ID=81200257

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210002016.0A Pending CN114381457A (en) 2022-01-04 2022-01-04 DNA molecule, oligonucleotide and kit for detecting c.1026+32T > G site mutation of human PTEN gene

Country Status (1)

Country Link
CN (1) CN114381457A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105506106A (en) * 2015-12-30 2016-04-20 杭州艾迪康医学检验中心有限公司 Method and primer for detecting whole exons of FIX gene
US20170037475A1 (en) * 2014-04-09 2017-02-09 Lineagen, Inc. Genetic markers associated with asd and other childhood developmental delay disorders
CN111893173A (en) * 2020-07-22 2020-11-06 福州艾迪康医学检验所有限公司 Primer, method and kit for detecting PEAR1 SNP locus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170037475A1 (en) * 2014-04-09 2017-02-09 Lineagen, Inc. Genetic markers associated with asd and other childhood developmental delay disorders
CN105506106A (en) * 2015-12-30 2016-04-20 杭州艾迪康医学检验中心有限公司 Method and primer for detecting whole exons of FIX gene
CN111893173A (en) * 2020-07-22 2020-11-06 福州艾迪康医学检验所有限公司 Primer, method and kit for detecting PEAR1 SNP locus

Similar Documents

Publication Publication Date Title
Zhang et al. Genomic variations of the mevalonate pathway in porokeratosis
CN110468192A (en) A kind of flight time mass spectrum method for nucleic acid analysis detecting the gene mutation of human myeloid&#39;s property muscular atrophy
CN101490280A (en) Procedure and methods for detecting alzheimer&#39;s disease
CN106987642A (en) Detect the kit and method of the full extron of MPL genes
CN106755399B (en) A kind of I type neurofibromatosis pathogenic mutation gene and the Etiologic reagent based on this mutated gene
CN104862407A (en) Primer and method for detecting EZH2 genes
CN109321638A (en) Detect primer, method and the kit of the 15th exon site mutation of TSC1
CN104178487A (en) ATM gene mutant and its application
CN114381457A (en) DNA molecule, oligonucleotide and kit for detecting c.1026+32T &gt; G site mutation of human PTEN gene
CN109628563A (en) Detect primer, kit and the method in the mutational site PIGA gene promoter region 4972A &gt; G
CN110714066A (en) DNA library for detecting and diagnosing corneal dystrophy disease-causing gene and application thereof
US5882868A (en) Method of diagnosing spinal muscular atrophy
CN107058531A (en) A kind of kit and method for detecting Niemann-Pick disease SMPD1 gene mutations
CN113832224A (en) Method for detecting SCN1A gene toxic exon variation
CN106967819A (en) Detect the kit and method of hyper-IgE syndrome STAT3 gene mutations
CN108531573A (en) Detect primer, kit and the method for methemoglobinemia CYB5R gene mutations
KR102585879B1 (en) Single nucleotide polymorphism markers for determining of probability of skin hydration and use thereof
CN114381513B (en) Biomarker related to X-linked lymphoproliferative disorder and application thereof
CN109112211A (en) A kind of the primer combination and method of human embryos Chediak-Higashi syndrome LYST detection in Gene Mutation
CN107904293A (en) Detect the primer and method of GNAS gene point mutations
Zhang et al. A SPAST gene-related hereditary spastic paraplegia type 4 family: Identification by a novel mutation
CN114411265A (en) DNA library for detecting and diagnosing related gene of idiopathic hypogonadotropic hormone hypogonadism and application thereof
CN117821590A (en) Application of primer in preparation of kit for detecting PRRT2 gene frameshift mutation
CN106834491B (en) Breast cancer prognosis-related gene mutation detection kit and its application method
Chelak et al. Detection of IVS4+ 1G> A mutation in phenylalanine hydroxylase gene in North of Iran using PCR-sequencing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination