CN114381439B

CN114381439B - Weakening method of synonymous mutation combined with deletion mutation influenza virus, weakened influenza virus strain and application

Info

Publication number: CN114381439B
Application number: CN202210100642.3A
Authority: CN
Inventors: 毛水花; 周孟云; 陈瑞婷; 刘晓菲; 宋家升
Original assignee: Zhejiang Difu Runsi Biotechnology Co ltd
Current assignee: Zhejiang Difu Runsi Biotechnology Co ltd
Priority date: 2022-01-27
Filing date: 2022-01-27
Publication date: 2023-12-15
Anticipated expiration: 2042-01-27
Also published as: CN114381439A

Abstract

The invention relates to a weakening method of influenza virus by combining synonymous mutation with deletion mutation, a weakening influenza virus strain and application thereof, and belongs to the technical field of weakening virus vaccines. The weakening method comprises the following steps: and (3) synonymous mutation is carried out on the overlapped part of the M2 gene and the M1 gene in the M gene of the influenza A virus, so that the integrity and invariance of the M1 amino acid sequence are ensured, meanwhile, stop codon mutation and deletion of partial nucleotide sequence are carried out in the membrane-spanning region of the M2 gene, and the attenuated influenza virus strain is saved by utilizing a reverse genetic operating system. The virus proliferation process obtained by the weakening method is stable and has no possibility of recovering the wild type; the strain can grow and reproduce in MDCK cells when the strain is inoculated at a high dose, and has the capacity of limiting replication; the safety is good, the immune effect is good, and the strain can be used as a candidate strain of attenuated live vaccine.

Description

Weakening method of synonymous mutation combined with deletion mutation influenza virus, weakened influenza virus strain and application

Technical Field

The invention relates to the technical field of attenuated virus vaccines, in particular to a method for attenuated influenza virus by combining synonymous mutation with deletion mutation, an attenuated influenza virus strain and application.

Background

Influenza viruses belong to the orthomyxoviridae family of single-stranded negative-strand segmented RNA viruses, possess a high degree of genetic drift, and almost yearly outbreak, resulting in the need for annual vaccine production development according to the strains prevalent in the current season. The production of the attenuated live vaccine of influenza virus is quick and convenient, and compared with an inactivated vaccine, the attenuated live vaccine of influenza virus can generate mucosal immunity and prevent virus infection and transmission.

Influenza virus is a segmented negative-strand RNA virus whose genome mainly comprises eight segments PB1, PB2, PA, HA, NP, NA, M and NS. Wherein the M gene encodes both M1 and M2 proteins by alternative splicing. M1 is a structural protein of the virus, forms a protein envelope layer under the virus envelope, and is related to virus assembly and budding. The M2 protein is highly conserved in influenza a, and the M2 protein has ion channel activity, acts in the early stages of the viral life cycle, i.e. the viral penetration and release phases, and is involved in viral assembly and morphogenesis, and can serve as a research point for viral attenuation. However, there is still a lack of efficient methods for influenza virus attenuation against the M gene.

Disclosure of Invention

The invention aims to provide a weakening method of influenza virus based on synonymous mutation combined deletion and mutation of M gene, and a weakening influenza virus strain and application thereof. The attenuated influenza virus strain obtained by the attenuation method has the following advantages: 1) The proliferation process is stable, and the possibility of recovering the wild type is avoided; 2) The low-dose virus-receiving MDCK cell virus cannot proliferate, and the high-dose virus-receiving MDCK cell virus can grow and proliferate in the MDCK cell, so that the restriction proliferation capacity of the attenuated virus is reflected, and the attenuated virus has larger induced immunity potential compared with the transient defective virus; 3) The safety is good, the immune effect is good, and the strain can be used as a candidate strain of attenuated live vaccine; 4) Can be inoculated with SPF chick embryo and grow and reproduce in chick embryo, and brings great convenience to production practice. 5) The weakening mode is suitable for influenza A virus subtypes and is an important mode for weakening influenza A viruses.

The invention provides a method for weakening influenza virus by combining synonymous mutation with deletion and mutation, which comprises the following steps:

and (3) synonymous mutation is carried out on the overlapped part of the M2 gene and the M1 gene in the M gene of the influenza A virus, so that the integrity and invariance of the M1 amino acid sequence are ensured, meanwhile, stop codon mutation and deletion of partial nucleotide sequence are carried out in the membrane-spanning region of the M2 gene, and the attenuated influenza virus strain is saved by utilizing a reverse genetic operating system.

Preferably, the background strain of the attenuation method comprises A/Puerto Rico/8/1934.

Preferably, the synonymous mutation comprises a mutation of the 715 th to 760 th bases of the M gene into the nucleotide sequence shown as SEQ ID NO. 1.

Preferably, the stop codon mutation comprises a mutation of the 761 st base to 766 th base of the M gene into the nucleotide sequence shown as SEQ ID NO. 2.

Preferably, the deletion portion nucleotide sequence includes: deleting the nucleotide sequence from 767 th base to 877 th base of M gene.

Preferably, the deletion portion nucleotide sequence includes:

deleting the 767 th base to 774 th base of the M gene;

deleting the 767 th base to 794 th base of the M gene;

deleting the 767 th base to 817 th base of the M gene;

deleting the 767 th base to 839 th base of the M gene;

or, the 767 th base to 877 th base of the M gene is deleted.

The invention also provides a attenuated influenza virus strain prepared by the attenuation method based on the technical scheme.

Preferably, the attenuated influenza virus strain uses A/Puerto Rico/8/1934 as a background, carries out synonymous mutation, termination codon mutation and partial nucleotide sequence deletion modification on an M gene, and the nucleotide sequence of the modified influenza virus M gene is shown as one of SEQ ID NO. 3-7.

The invention also provides a group of defective plasmids for preparing the attenuated influenza virus strain according to the technical scheme, wherein the defective plasmids contain M genes of influenza viruses with synonymous mutation combined with deletion and mutation.

The invention also provides the application of the weakening method or the weakening influenza virus strain or the defective plasmid in the preparation and production of influenza weakening virus vaccine.

The invention provides a method for weakening influenza virus by combining synonymous mutation with deletion and mutation. The invention introduces synonymous mutation near the splicing position of M gene to cause the abnormality of alternative splicing of M gene, combines deletion and mutation on the basis of synonymous mutation to change RNA sequence at the base level in order to prevent reversion to wild type, thereby further affecting the secondary structure of RNA and generating a series of attenuated influenza virus strains. And unlike the prior influenza-weakening method, the attenuated influenza virus strain 1) produced by the present invention has little possibility of recovering to the wild-type, and hardly any; 2) The low-dose virus-receiving MDCK cell virus cannot proliferate, and the high-dose virus-receiving MDCK cell virus can grow and proliferate in the MDCK cell, so that the restriction proliferation capacity of the attenuated virus is reflected, and the attenuated virus has larger induced immunity potential compared with the transient defective virus; 3) The mouse test shows that the attenuated influenza virus has good safety and good immune effect, and can be used as an attenuated live vaccine candidate strain; 4) Can grow well on the chick embryo, and provides possibility for chick embryo virus production.

Drawings

FIG. 1 is a graph showing the growth of M-deficient influenza virus provided by the present invention;

FIG. 2 is a graph showing the proliferation results of M-deficient influenza virus provided by the invention in MDCK cells;

FIG. 3 is a graph showing the change of body weight of mice inoculated with the virus according to the present invention;

FIG. 4 is a graph showing the results of three days after inoculation of mice with virus, the titres of turbinates and lung lobe tissue viruses provided by the present invention;

FIG. 5 is a graph showing the results of pathological sections of lung lobes three days after the mice are inoculated with the virus;

fig. 6 is a diagram showing the change of body weight of an immunized mouse 10 days after toxicity attack.

Detailed Description

The invention preferably introduces synonymous mutation near the splicing position of M gene (overlapped part of M2 gene and M1 gene), causes abnormality of M gene alternative splicing, combines deletion and mutation on the basis of synonymous mutation, changes RNA sequence at base level, thereby further affecting secondary structure of RNA, and generates a series of attenuated influenza virus strains. The attenuated influenza virus strain prepared by the attenuation method has little possibility of recovering to a wild type and almost no possibility; but also can grow well on MDCK cells or chick embryos, and provides possibility for producing viruses by the chick embryos or MDCK cells. Meanwhile, the mouse test shows that the attenuated influenza virus strain produced by the invention is safe on mice, and lays a foundation for producing safe and effective influenza attenuated vaccines.

In the present invention, the background strain of the attenuation method preferably comprises A/Puerto Rico/8/1934.

In the present invention, the synonymous mutation preferably includes a mutation of the 715 th to 760 th bases of the M gene into a nucleotide sequence shown as SEQ ID NO. 1. Specifically, sequence GCCTATCAGAAACGAATGGGGGTGCAGATGCAACGGTTCAAGTGAT (SEQ ID NO. 18) was mutated to sequence GCGTACCAAAAGCGTATGGGTGTTCAAATGCAGAGATTTAAATAAG (SEQ ID NO. 1) to form an M (sn) deficient plasmid.

In the present invention, the stop codon mutation preferably includes a mutation of the 761 th base to 766 th base of the M gene into a nucleotide sequence shown in SEQ ID NO. 2. Namely, the invention introduces two stop codons, in particular to mutate the 761 th base to 766 th base CCTCC (SEQ ID NO. 19) into TGATGA (SEQ ID NO. 2).

In the present invention, the deletion portion nucleotide sequence preferably includes: deleting the nucleotide sequence from 767 th base to 877 th base of M gene; more preferably, the deletion portion nucleotide sequence includes:

deleting the 767 th base to 774 th base of the M gene;

deleting the 767 th base to 794 th base of the M gene;

deleting the 767 th base to 817 th base of the M gene;

deleting the 767 th base to 839 th base of the M gene;

or, the 767 th base to 877 th base of the M gene is deleted.

Specifically, the invention deletes the base from 767 to 774 of M gene ACTATTGC (SEQ ID NO. 20); combining the synonymous mutation and the terminator mutation to form an M (sn) +Mut6+Del8 defective plasmid;

deleting the base 767 to base ACTATTGCCGCAAATATCATTGGGATCT (SEQ ID NO. 21) of the M gene; combining the synonymous mutation and the terminator mutation to form an M (sn) +Mut6+Del28 defective plasmid;

deleting the base 767 to 817 of the M gene ACTATTGCCGCAAATATCATTGGGATCTTGCACTTGACATTGTGGATTCTT (SEQ ID NO. 22); combining the synonymous mutation and the terminator mutation to form an M (sn) +Mut6+Del51 deficient plasmid;

deleting the 767 th base to the 839 th base ACTATTGCCGCAAATATCATTGGGATCTTGCACTTGACATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCA (SEQ ID NO. 23) of the M gene; combining the synonymous mutation and the terminator mutation to form an M (sn) +Mut6+Del73-deficient plasmid;

or, delete base 767 to base ACTATTGCCGCAAATATCATTGGGATCTTGCACTTGACATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCATTTACCGTCGCTTTAAATACGGACTGAAAGGAGGGCCT of 877 of M gene (SEQ ID NO. 24); after combining the synonymous mutation and the terminator mutation described above, an M (sn) +Mut6+Del111 deficient plasmid is formed.

The present invention preferably constructs M gene-deficient plasmids according to the above-described synonymous mutation combining deletion and mutation, and then co-transfects cells with other 7 plasmids (PB 2, PB1, PA, NP, NS, HA, NA) reverse inherited with PR8 background influenza and with plasmids expressing full-length M2 protein (PR 8-M2), and then harvests the virus to obtain attenuated influenza strains.

The invention also provides a attenuated influenza virus strain prepared by the attenuation method based on the technical scheme. In the invention, the attenuated influenza virus strain takes A/Puerto Rico/8/1934 as a background, and carries out synonymous mutation, termination codon mutation and modification of deleting part of nucleotide sequence on M genes. In the present invention, the nucleotide sequence of the modified influenza M gene is preferably as shown in one of SEQ ID NO.3 to 7.

The invention also provides a group of defective plasmids for preparing the attenuated influenza virus strain according to the technical scheme, wherein the defective plasmids contain M genes of influenza viruses with synonymous mutation combined with deletion and mutation. In the present invention, the defective plasmid preferably contains a nucleotide sequence shown as one of SEQ ID NOS.3 to 7. In the present invention, the nucleotide sequence of the primer used for preparing the defective plasmid is preferably as shown in SEQ ID NO. 8-17.

The method for weakening the influenza virus by synonymous mutation and deletion mutation and the strain and application of the influenza virus are described in further detail below with reference to specific examples, and the technical scheme of the invention includes but is not limited to the following examples.

Example 1

Construction of M Gene-deficient plasmid

Primers M (sn) -F atgggtgttcaaatgcagagatttaaataagcctctcactattgccgcaaat (SEQ ID NO. 25) and M (sn) were designed) Gagaggcttatttaaatctctg (SEQ ID NO. 26) and pGlu-PR 8-M (nucleotide sequence of M gene is shown as SEQ ID NO. 27) carrier plasmid in influenza reverse genetics 8 plasmid system is used as template, synonymous mutant sequences are amplified by PCR according to PrimerSTAR specification, the amplified sequences are determined to be correct in size by gel electrophoresis, target fragments are recovered by cutting gel, and the sequence is amplified according to the following stepsThe HiFi DNAAssembly kit instructions require homologous recombination cloning to obtain the M (sn) plasmid. On the basis of M (sn) plasmid, designing a primer for PCR amplification and homologous recombination to obtain M (sn) +Mut6+Del8 defective plasmid, M (sn) +Mut6+Del28 defective plasmid, M (sn) +Mut6+Del51 defective plasmid, M (sn) +Mut6+Del73 defective plasmid and M (sn) +Mut6+Del111 defective plasmid.

The primers used for amplification are shown in Table 1:

TABLE 1 primers for amplification

Example 2

Defective influenza virus rescue

And (3) paving the 293T cells into a special six-hole plate for the Siemens, and carrying out transfection when the cell density reaches 70-80%. The defective recombinant influenza virus was rescued using a classical "6+2" influenza reverse genetics operating system. The 6 PR8 internal genes pGlu-PR 8-PB2, pGlu-PR 8-PB1, pGlu-PR 8-PA, pGlu-PR 8-NP, pGlu-PR 8-NS and pGlu-PR 8-M gene-deficient plasmids, and the 2 external genes pGlu-PR 8-HA, pGlu-PR 8-NA, 0.5ug each and the plasmid 0.25ug expressing full length M2 were co-transfected into 293T cells (Lipofectamine 3000), respectively. The culture medium containing TPCK-Trypsin at a final concentration of 0.5ug/ml was changed 24 hours after the transfer, and the cell supernatant was collected 48 hours after the transfer, and inoculated with 8-day-old SPF chick embryos at 0.2 ml/piece through the allantoic cavity. The inoculated chick embryo is cultivated in a temperature box at 37 ℃ for 48 hours. The chick embryo allantoic fluid (F0 generation) was collected, defective influenza virus was obtained, and whether or not there was hemagglutination was determined. If there is no hemagglutination, the virus will be harvested for a blind generation and then tested for the presence of hemagglutination. The resulting M-deficient influenza viruses were designated PR8-M (sn), PR8-M (sn) +Mut6+Del8, PR8-M (sn) +Mut6+Del28, PR8-M (sn) +Mut6+Del51, PR8-M (sn) +Mut6+Del73 and PR8-M (sn) +Mut6+Del111, respectively.

Example 3

Viral growth curve

Spreading MDCK-M2 cells on 24-well plate, inoculating M defective influenza virus strain into cells at a dosage with multiplicity of infection (MOI) of 0.001 after the cells grow to form a monolayer, repeating for 3 times, removing liquid in 24-well plate after infection for 2 hr, washing with PBS, adding DMEM medium containing 2% FBS to maintain cell growth, placing at 37deg.C and 5% CO ₂ Culturing in an incubator. Harvesting viruses at 12h, 24h, 36h, 48h, 60h and 72h after infection, continuously diluting the virus liquid at different time points by 10 times, repeating 4 times of each dilution, respectively inoculating into MDCK-M2 cells growing to a single layer in a 96-well plate, changing into DMEM culture solution of 2% FBS after infection for 2h to maintain the growth of the cells, observing lesions after 48h, collecting the virus value of defective influenza virus strains, and calculating TCID (tumor cell death) by using a Reed-Muench method ₅₀ After the data analysis is completed, a growth curve of the M-deficient influenza virus is drawn, and the result is shown in FIG. 1.

All attenuated viruses had a reduced growth capacity compared to wild-type PR8 virus. At 24h post infection, the attenuated virus titres of each type were approximately 10 ⁵ TCID(s) ₅₀ Per ml, but after that, the virus grew, at 48h post infection, attenuated virus titres were 10 ⁷ TCID(s) ₅₀ About/ml. Therefore, the attenuated virus strain produced by the invention can grow in MDCK-M2 cells at high titer, and meets the normal production requirement.

Example 4

M-deficient influenza virus can grow on normal MDCK

Respectively taking 250, 1000, 4000 and 16000, 64000, 256000, 1024000, 4096000 TCIDs ₅₀ M-deficient influenza virus splice of (2)The 48-well plate MDCK cells are used for observing cytopathy and detecting HA titer of the cell culture solution. The results are shown in FIG. 2. The result shows that the M defective influenza virus can not proliferate in MDCK cells when the virus is inoculated at a low dose, and can grow and proliferate in MDCK cells when the virus is inoculated at a high dose, so that the capacity of weakening the virus to proliferate in a limiting way is reflected, and compared with the transient defective virus, the M defective influenza virus is favorable for inducing better protective force.

Example 5

M-deficient influenza virus can grow in chick embryo

The stock solutions of the M-deficiency influenza viruses are respectively inoculated with 10-day-old SPF chick embryos, 100 mu L/embryo is inoculated with three chick embryos for each strain of virus, and after 72 hours, allantoic fluid is harvested for detecting the HA titer of the virus. The results are shown in Table 2:

TABLE 2 HA titers from avian embryo cultures of M defective influenza virus

As can be seen from Table 2, all M-deficient influenza viruses can grow and reproduce in large quantities in chick embryos, and the HA titer can reach 2 at the highest ^9.5 The average number of strains can reach 2 ^8.5 . Besides higher productivity, the culture of the chick embryo has simple requirements on equipment factory buildings compared with cell culture, thereby providing great convenience for the production of defective influenza viruses.

Example 6

Passage test

The virus was serially passaged for 10 passages in MDCK-M2 cell line and the stability of the viral M gene was checked by sequencing. Through detection, all the M genes of the attenuated viruses are unchanged compared with the M genes before passage, and the attenuated influenza viruses are stably inherited at the gene level.

Example 7

M-deficiency influenza Virus mouse assay

Taking 7-8 week old Balb/c female mice, intranasal inoculating the M-deficiency influenza virus and the wild PR8 strain, and administering PBS to the mice in a control group, wherein each group comprises 5-8 mice. Daily record of mice body weight changes and sensations after inoculation3 days after inoculation, 3 mice from each group PR8-M (sn) +Mut6+Del8, PR8-M (sn) +Mut6+Del51, PR8-M (sn) +Mut6+Del73 were euthanized, lung and turbinate tissues were dissected for pathological detection and tissue virus titers were determined. The pathological detection adopts paraffin embedded tissues, and the photographing is carried out after the processes of slicing, bleaching, drying, HE dyeing and the like. The method for detecting the virus titer comprises the following steps: MDCK-M2 cells are spread in a 96-well plate, after the cells grow to be full of a single layer, DMEM is used for continuously and gradually diluting the recombinant virus by 10 times of proportion, and the recombinant virus is diluted to 10 ^-6 Then the culture medium in the 96-well plate is discarded, the plate is washed by DMEM, 100 mu L of recombinant virus solution with corresponding dilution is added into each well, each gradient is repeated for 4 times, and the temperature is 37 ℃ and the concentration is 5% CO ₂ After incubation for 2h in a cell incubator of (2), the cell supernatant was discarded, and replaced with DMEM medium containing 2% fbs to maintain cell growth, after 48h the supernatant was discarded, the plates were washed twice with PBS, the fluorescence in each well was observed under an inverted fluorescence microscope and recorded, and the TCID was calculated using the Reed-Muench method ₅₀ . Blood was collected 14 days after the first immunization, and serum HI (blood coagulation valence inhibition) levels of mice were detected. The HI level detection method is as follows: preparing four units of antigen, dilution multiple of virus antigen = virus agglutination/4, inactivating the serum to be detected of the mice for 30min at 56 ℃ in advance, adding 25 μl of the serum to be detected into the first well of the 96-well plate, and 1:2, adding 25 mu L of four-unit antigen into the diluted serum, reacting for 30min at room temperature, adding 25 mu L of 1% chicken erythrocyte suspension into each hole, standing for 30min at room temperature, observing test results, and recording the highest dilution with hemagglutination as HI level, wherein the results are shown in Table 3. PR8 Virus 10 at 21 days after mice immunization ⁶ TCID ₅₀ The challenge was performed at a dose of/50 uL and mice status and body weight changes were recorded (FIG. 6).

From the results, after mice are infected with defective attenuated viruses, the body weight of the mice is slightly reduced by less than 5% on the 2 nd day and 3 rd day, then the body weight is recovered, and the body weight of all the mice except the control group on the 5 th day is recovered to be original and normal, and the mental state of the mice is good until the 14 th day. In contrast, the control group of 5 mice vaccinated with wild-type PR8 virus all died on day 5. Meanwhile, the wild PR8 strain had higher virus titer in both mouse nasal A and lung lobe tissues than attenuated influenza virus 3 days after inoculation. In lung tissue, wild-type virus titers were significantly higher than attenuated influenza virus PR8-M (sn) +Mut6+Del8, PR8-M (sn) +Mut6+Del51, PR8-M (sn) +Mut6+Del73 (FIG. 4), and small amounts of PR8-M (sn) +Mut6+Del73 recombinant virus could still be detected in lung lobe tissue. In addition, the pathological section results show that the PR8-M (sn) +Mut6+Del73 attenuated virus strain causes diffuse lymphocyte infiltration around a small number of bronchi of 2/3 lung lobes of the lung tissue of the mouse, the pulmonary interstitial tissue sees moderate fibrosis characteristics, the PR8-M (sn) +Mut6+Del8 causes diffuse lymphocyte infiltration around a small number of bronchi of 1/3 lung lobes, the pulmonary interstitial tissue sees moderate fibrosis characteristics, and the PR8-M (sn) +Mut6+Del51 causes diffuse lymphocyte infiltration around only a small number of bronchi of lung lobes. As can be seen, the attenuated strains produced by the same attenuation method differ in toxicity, with PR8-M (sn) +Mut6+Del73 strains being more toxic (FIG. 5).

From a combination of the results shown in FIG. 3 and FIG. 4, it can be seen that the defective influenza virus obtained by rescue according to the present invention is generally safe in mice, does not cause death of mice, but has different degrees of pathogenicity to mice, and is PR8-M (sn) +Mut6+Del73 strain with higher toxicity.

TABLE 3 serum HI antibody results

Serum HI antibodies are shown in table 3 14 days after infection of mice with virus. As can be seen from the results in Table 3, mice developed potent HI antibody titers, with HI levels up to 2 on average ⁴ To 2 ⁸ Wherein, PR8-M (sn) +Mut6+Del8 and PR8-M (sn) +Mut6+Del73 strains have excellent immune effect and can achieve complete protection. PR8-M (sn) +Mut6+Del28 attenuated strain has obviously insufficient immune effect. In addition, the results in FIG. 6 show that all strains protect mice after challengeIs free from virus infection. In addition to the large weight change in mice of PR8-M (sn) +Mut6+Del51 group, the weights of mice of PR8-M (sn) +Mut6+Del8 and PR8-M (sn) +Mut6+Del73 group remained essentially steady, and although the toxicity of PR8-M (sn) +Mut6+Del51 virus strain was the weakest, the combined HI antibody titers and challenge test results showed that the immune effect of PR8-M (sn) +Mut6+Del51 strain was weaker than that of PR8-M (sn) +Mut6+Del8 and PR8-M (sn) +Mut6+Del73. The above results further demonstrate that the attenuated influenza viruses of the present invention produce potent antibodies against influenza HA, but that the attenuated viruses produced by different attenuation methods differ in immune effect.

From the above results, it is known that the attenuated viruses produced by the method of the present invention have good growth characteristics and can grow in MDCK-M2 and chick embryos. Meanwhile, the high-dose virus inoculation can be proliferated in MDCK cells, so that the virus restriction replication capacity is displayed, and the virus inoculation cell has more excellent immunity performance compared with single-copy viruses. In addition, the attenuation method produces different attenuated viruses with different toxicity and immunogenicity, wherein the strain with higher toxicity is PR8-M (sn) +Mut6+Del73, and the strain with lower immunogenicity is PR8-M (sn) +Mut6+Del28. Combining three aspects of growth characteristics, toxicity and immunogenicity, the strain with better expression in the invention is PR8-M (sn) +Mut6+Del8. According to different purposes of influenza vaccine preparation, the weakening method can lay a foundation for preparing influenza attenuated live vaccine candidate strains and avian influenza attenuated inactivated vaccines.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> Zhejiang Difu run Biotech Co., ltd

<120> method for weakening influenza virus by synonymous mutation combined with deletion mutation, and weakened influenza virus strain and application

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gcgtaccaaa agcgtatggg tgttcaaatg cagagattta aataag 46

<210> 2

<211> 6

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tgatga 6

<210> 3

<211> 974

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgacgca aatatcattg 780

ggatcttgca cttgacattg tggattcttg atcgtctttt tttcaaatgc atttaccgtc 840

gctttaaata cggactgaaa ggagggcctt ctacggaagg agtgccaaag tctatgaggg 900

aagaatatcg aaaggaacag cagagtgctg tggatgctga cgatggtcat tttgtcagca 960

tagagctgga gtaa 974

<210> 4

<211> 954

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgatgca cttgacattg 780

tggattcttg atcgtctttt tttcaaatgc atttaccgtc gctttaaata cggactgaaa 840

ggagggcctt ctacggaagg agtgccaaag tctatgaggg aagaatatcg aaaggaacag 900

cagagtgctg tggatgctga cgatggtcat tttgtcagca tagagctgga gtaa 954

<210> 5

<211> 931

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgagatc gtcttttttt 780

caaatgcatt taccgtcgct ttaaatacgg actgaaagga gggccttcta cggaaggagt 840

gccaaagtct atgagggaag aatatcgaaa ggaacagcag agtgctgtgg atgctgacga 900

tggtcatttt gtcagcatag agctggagta a 931

<210> 6

<211> 909

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgattta ccgtcgcttt 780

aaatacggac tgaaaggagg gccttctacg gaaggagtgc caaagtctat gagggaagaa 840

tatcgaaagg aacagcagag tgctgtggat gctgacgatg gtcattttgt cagcatagag 900

ctggagtaa 909

<210> 7

<211> 871

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgatcta cggaaggagt 780

gccaaagtct atgagggaag aatatcgaaa ggaacagcag agtgctgtgg atgctgacga 840

tggtcatttt gtcagcatag agctggagta a 871

<210> 8

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tcaagtgatt gatgacgcaa atatcattgg gatcttgc 38

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tcatcaatca cttgaaccgt tg 22

<210> 10

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tcaagtgatt gatgatgcac ttgacattgt ggattcttg 39

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

tcatcaatca cttgaaccgt tg 22

<210> 12

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

tcaagtgatt gatgagatcg tctttttttc aaatg 35

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

tcatcaatca cttgaaccgt tg 22

<210> 14

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

tcaagtgatt gatgatttac cgtcgcttta aatacg 36

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

tcatcaatca cttgaaccgt tg 22

<210> 16

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

tcaagtgatt gatgatctac ggaaggagtg ccaaag 36

<210> 17

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

tcatcaatca cttgaaccgt tg 22

<210> 18

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

gcctatcaga aacgaatggg ggtgcagatg caacggttca agtgat 46

<210> 19

<211> 6

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

cctctc 6

<210> 20

<211> 8

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

actattgc 8

<210> 21

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

actattgccg caaatatcat tgggatct 28

<210> 22

<211> 51

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

actattgccg caaatatcat tgggatcttg cacttgacat tgtggattct t 51

<210> 23

<211> 73

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

actattgccg caaatatcat tgggatcttg cacttgacat tgtggattct tgatcgtctt 60

tttttcaaat gca 73

<210> 24

<211> 111

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

actattgccg caaatatcat tgggatcttg cacttgacat tgtggattct tgatcgtctt 60

tttttcaaat gcatttaccg tcgctttaaa tacggactga aaggagggcc t 111

<210> 25

<211> 52

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

atgggtgttc aaatgcagag atttaaataa gcctctcact attgccgcaa at 52

<210> 26

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

gagaggctta tttaaatctc tg 22

<210> 27

<211> 982

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcctat 720

cagaaacgaa tgggggtgca gatgcaacgg ttcaagtgat cctctcacta ttgccgcaaa 780

tatcattggg atcttgcact tgacattgtg gattcttgat cgtctttttt tcaaatgcat 840

ttaccgtcgc tttaaatacg gactgaaagg agggccttct acggaaggag tgccaaagtc 900

tatgagggaa gaatatcgaa aggaacagca gagtgctgtg gatgctgacg atggtcattt 960

tgtcagcata gagctggagt aa 982

Claims

1. A method of attenuating an influenza virus with synonymous mutations in combination with deletions and mutations, comprising the steps of:

synonymous mutation is carried out on the overlapped part of the M2 gene and the M1 gene in the M gene of the influenza A virus, so that the integrity and invariance of the M1 amino acid sequence are ensured, meanwhile, stop codon mutation and partial deletion of the nucleotide sequence are carried out in the membrane-spanning region of the M2 gene, and a reverse genetic operation system is utilized to rescue out a attenuated influenza virus strain;

the synonymous mutation comprises the step of mutating the 715 th base to 760 th base of an M gene into a nucleotide sequence shown as SEQ ID NO. 1;

the stop codon mutation comprises the step of mutating 761 th base to 766 th base of an M gene into a nucleotide sequence shown as SEQ ID NO. 2;

the deletion portion nucleotide sequence includes:

deleting the 767 th base to 774 th base of the M gene;

deleting the 767 th base to 794 th base of the M gene;

deleting the 767 th base to 817 th base of the M gene;

deleting the 767 th base to 839 th base of the M gene;

or, the 767 th base to 877 th base of the M gene is deleted.

2. The method of attenuation according to claim 1, wherein the background strain of the method of attenuation comprises a/Puerto Rico/8/1934.

3. A attenuated influenza virus strain produced based on the attenuation method of claim 1 or 2.

4. The attenuated influenza virus strain of claim 3 wherein the attenuated influenza virus strain has been modified by synonymous mutation, termination codon mutation and deletion of a portion of the nucleotide sequence of the M gene in the context of a/Puerto Rico/8/1934.

5. A set of defective plasmids for the preparation of attenuated influenza strains according to claim 3 or 4, characterized in that said defective plasmids contain synonymous mutations in combination with deleted and mutated M genes of influenza virus.

6. Use of a attenuated method according to claim 1 or 2 or attenuated influenza strain according to claim 3 or 4 or a defective plasmid according to claim 5 for the preparation and production of an influenza attenuated virus vaccine.