CN114381439A

CN114381439A - Weakening method of influenza virus combining synonymous mutation with deletion mutation, attenuated influenza virus strain and application

Info

Publication number: CN114381439A
Application number: CN202210100642.3A
Authority: CN
Inventors: 毛水花; 周孟云; 陈瑞婷; 刘晓菲; 宋家升
Original assignee: Zhejiang Difu Runsi Biotechnology Co ltd
Current assignee: Zhejiang Difu Runsi Biotechnology Co ltd
Priority date: 2022-01-27
Filing date: 2022-01-27
Publication date: 2022-04-22
Anticipated expiration: 2042-01-27
Also published as: CN114381439B

Abstract

The invention relates to a weakening method of influenza virus with synonymous mutation combined with deletion mutation, a weakening influenza virus strain and application, and belongs to the technical field of weakening virus vaccines. The weakening method comprises the following steps: the method carries out synonymous mutation on the overlapped part of the M2 gene and the M1 gene in the M gene of the influenza A virus, ensures the completeness and invariance of an M1 amino acid sequence, simultaneously carries out mutation of a stop codon and deletion of a part of nucleotide sequence in a transmembrane region of the M2 gene, and utilizes a reverse genetic operating system to save a strain causing the weak influenza virus. The virus obtained by the weakening method has stable propagation process and no possibility of returning to a wild type; the virus can grow and reproduce in MDCK cells when being inoculated with high dose, and has restrictive replication capacity; has good safety and good immune effect, and can be used as a candidate strain of attenuated live vaccine.

Description

Weakening method of influenza virus combining synonymous mutation with deletion mutation, attenuated influenza virus strain and application

Technical Field

The invention relates to the technical field of attenuated virus vaccines, in particular to an influenza virus attenuation method combining synonymous mutation with deletion mutation, attenuated influenza virus strains and application.

Background

Influenza viruses belong to the orthomyxoviridae family, are single-stranded negative-strand segmented RNA viruses, possess a high degree of genetic drift, and are almost all outbreaks every year, resulting in the need for vaccine production and development from strains circulating every year, in accordance with the season. The attenuated live influenza virus vaccine is fast and convenient to produce, and can produce mucosal immunity and prevent virus infection and spread compared with an inactivated vaccine.

Influenza virus is a segmented negative-strand RNA virus whose genome comprises mainly eight segments PB1, PB2, PA, HA, NP, NA, M and NS. Wherein the M gene encodes both M1 and M2 proteins by alternative splicing. M1 is a structural protein of the virus, forming a protein coating layer under the viral envelope, and is involved in virus assembly and budding. The M2 protein is highly conserved in influenza A, and the M2 protein has ion channel activity, plays a role in the early stage of the virus life cycle, namely the virus infiltration and membrane removal stage, is involved in virus assembly and morphogenesis, and can be used as a research point of virus weakening. However, there is still a lack of efficient influenza virus attenuation methods for the M gene.

Disclosure of Invention

The invention aims to provide a weakening method of influenza virus based on synonymy mutation, deletion and mutation of M gene, a weakened influenza virus strain and application. The attenuated influenza virus strain obtained by the attenuation method has the following advantages: 1) the proliferation process is stable, and the possibility of returning to the wild type is avoided; 2) the low-dose virus-inoculated MDCK cell virus cannot be propagated, can grow and propagate in MDCK cells during high-dose virus inoculation, embodies the restrictive propagation capacity of the attenuated virus, and has greater induced immune potential compared with transient defective virus; 3) the safety is good, the immune effect is good, and the vaccine can be used as a candidate strain of attenuated live vaccine; 4) SPF chick embryos can be inoculated and grown and propagated in the chick embryos, which brings great convenience for production practice. 5) The weakening mode is suitable for the influenza A virus subtype and is an important mode for weakening the influenza A virus.

The invention provides a weakening method of influenza virus combining synonymous mutation, deletion and mutation, which comprises the following steps:

the method carries out synonymous mutation on the overlapped part of the M2 gene and the M1 gene in the M gene of the influenza A virus, ensures the completeness and invariance of an M1 amino acid sequence, simultaneously carries out mutation of a stop codon and deletion of a part of nucleotide sequence in a transmembrane region of the M2 gene, and utilizes a reverse genetic operating system to save a strain causing the weak influenza virus.

Preferably, the background strain of the attenuation method comprises A/Puerto Rico/8/1934.

Preferably, the synonymous mutation comprises mutation of base 715 to base 760 of the M gene into a nucleotide sequence shown in SEQ ID NO. 1.

Preferably, the mutation of the stop codon comprises the mutation of a 761 th base to a 766 th base of the M gene into a nucleotide sequence shown as SEQ ID NO. 2.

Preferably, the deletion part nucleotide sequence includes: deleting the nucleotide sequence from 767 th base to 877 th base of M gene at any position and length.

Preferably, the deletion part nucleotide sequence includes:

deleting 767 th base to 774 th base of M gene;

deleting base 767 to base 794 of the M gene;

deleting 767 th base to 817 th base of the M gene;

deleting from 767 th base to 839 th base of M gene;

alternatively, the deletion of base 767 to 877 of the M gene is performed.

The invention also provides a attenuated influenza virus strain prepared by the attenuation method based on the technical scheme.

Preferably, the attenuated influenza virus strain takes A/Puerto Rico/8/1934 as background, and carries out synonymous mutation, stop codon mutation and deletion part of nucleotide sequence modification on M gene, and the nucleotide sequence of the modified influenza virus M gene is shown in one of SEQ ID NO. 3-7.

The invention also provides a group of defective plasmids for preparing the attenuated influenza virus strain in the technical scheme, and the defective plasmids contain M genes of influenza viruses with synonymous mutation, deletion and mutation.

The invention also provides the weakening method in the technical scheme or the weakening influenza virus strain in the technical scheme or the application of the defective plasmid in the technical scheme in preparation and production of influenza weakening virus vaccines.

The invention provides a method for weakening influenza viruses by combining synonymous mutation with deletion and mutation. The invention introduces the synonymous mutation near the splicing position of the M gene to cause the abnormal alternative splicing of the M gene, combines deletion and mutation on the basis of the synonymous mutation and changes an RNA sequence at a base level in order to prevent the reversion of a wild type, thereby further influencing the secondary structure of the RNA and generating a series of strains causing the influenza virus. And different from the early influenza weakening method, the attenuated influenza virus strain 1) generated by the invention has little possibility of being recovered into a wild type and almost no possibility; 2) the low-dose virus-inoculated MDCK cell virus cannot be propagated, can grow and propagate in MDCK cells during high-dose virus inoculation, embodies the restrictive propagation capacity of the attenuated virus, and has greater induced immune potential compared with transient defective virus; 3) mouse tests show that the attenuated influenza virus has good safety and good immune effect and can be used as a candidate strain of attenuated live vaccine; 4) can grow well on chicken embryos and provides possibility for producing viruses by the chicken embryos.

Drawings

FIG. 1 is a graph showing the growth of M-deficient influenza viruses provided by the present invention;

FIG. 2 is a graph showing the results of proliferation of M-deficient influenza viruses provided by the present invention in MDCK cells;

FIG. 3 is a graph showing the change in body weight of mice inoculated with a virus according to the present invention;

FIG. 4 is a graph showing the results of virus titers in turbinate and alveolar tissues three days after the mice are inoculated with the viruses provided by the present invention;

FIG. 5 is a graph showing the result of pathological section of lung lobe tissue three days after the mice are inoculated with the virus;

FIG. 6 is a graph showing the change in body weight of immunized mice after challenge by the present invention over 10 days.

Detailed Description

The invention preferably introduces synonymous mutation near the splicing position of the M gene (the overlapped part of the M2 gene and the M1 gene), causes the M gene to be abnormally spliced, combines deletion and mutation on the basis of the synonymous mutation, and changes the RNA sequence at the base level, thereby further influencing the secondary structure of the RNA and generating a series of attenuated influenza virus strains. The attenuated influenza virus strain prepared by the attenuation method has extremely low possibility of being recovered into a wild type and almost no possibility; and the virus can grow well on MDCK cells or chick embryos, and the virus production possibility of the chick embryos or MDCK cells is provided. Meanwhile, mouse experiments show that the attenuated influenza virus strain produced by the invention is safe on mice, and lays a foundation for producing safe and effective attenuated influenza vaccines.

In the present invention, the background strain of the attenuation method preferably includes A/Puerto Rico/8/1934.

In the present invention, the synonymous mutation preferably comprises mutating base 715 to base 760 of the M gene to a nucleotide sequence as shown in SEQ ID NO. 1. Specifically, the sequence GCCTATCAGAAACGAATGGGGGTGCAGATGCAACGGTTCAAGTGAT (SEQ ID NO.18) is mutated into the sequence GCGTACCAAAAGCGTATGGGTGTTCAAATGCAGAGATTTAAATAAG (SEQ ID NO.1) to form M (sn) defective plasmid.

In the present invention, the mutation of the stop codon preferably comprises mutating the 761 th to 766 th bases of the M gene into a nucleotide sequence as shown in SEQ ID No. 2. Namely, the invention introduces two stop codons, in particular to mutate the base CCTTC (SEQ ID NO.19) from the 761 th site to the 766 th site into TGATGA (SEQ ID NO. 2).

In the present invention, the deletion portion nucleotide sequence preferably includes: deleting the nucleotide sequence from 767 th base to 877 th base of M gene at any position and length; more preferably, the deletion part nucleotide sequence includes:

deleting 767 th base to 774 th base of M gene;

deleting base 767 to base 794 of the M gene;

deleting 767 th base to 817 th base of the M gene;

deleting from 767 th base to 839 th base of M gene;

alternatively, the deletion of base 767 to 877 of the M gene is performed.

Specifically, the invention deletes the base ACTATTGC (SEQ ID NO.20) from 767 th base to 774 th base of the M gene; after combining the synonymous mutation and the terminator mutation, an M (sn) + Mut6+ Del8 defective plasmid is formed;

deletion of base 767 to base 794 ACTATTGCCGCAAATATCATTGGGATCT of the M gene (SEQ ID NO. 21); after combining the synonymous mutation and the terminator mutation, an M (sn) + Mut6+ Del28 defective plasmid is formed;

deletion of base 767 to base 817 ACTATTGCCGCAAATATCATTGGGATCTTGCACTTGACATTGTGGATTCTT (SEQ ID NO.22) of the M gene; after combining the synonymous mutation and the terminator mutation, an M (sn) + Mut6+ Del51 defective plasmid is formed;

deletion of from base 767 to base 839 of the M gene ACTATTGCCGCAAATATCATTGGGATCTTGCACTTGACATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCA (SEQ ID NO. 23); after combining the synonymous mutation and the terminator mutation, an M (sn) + Mut6+ Del73 defective plasmid is formed;

or, deletion of base 767 to base 877 ACTATTGCCGCAAATATCATTGGGATCTTGCACTTGACATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCATTTACCGTCGCTTTAAATACGGACTGAAAGGAGGGCCT of the M gene (SEQ ID NO. 24); after combining the synonymous mutation and the terminator mutation described above, an M (sn) + Mut6+ Del 111-deficient plasmid was formed.

In the invention, preferably, an M gene defective plasmid is constructed according to the condition of combining deletion and mutation with the synonymous mutation, and then the M gene defective plasmid is co-transfected with other 7 plasmids (PB2, PB1, PA, NP, NS, HA and NA) of PR8 background influenza reverse inheritance and a plasmid (PR8-M2) expressing full-length M2 protein to obtain a virus strain causing weak influenza after the virus is harvested.

The invention also provides a attenuated influenza virus strain prepared by the attenuation method based on the technical scheme. In the invention, the M gene is subjected to synonymous mutation, stop codon mutation and deletion of partial nucleotide sequence modification by taking A/Puerto Rico/8/1934 as a background. In the invention, the nucleotide sequence of the modified influenza virus M gene is preferably shown in one of SEQ ID NO. 3-7.

The invention also provides a group of defective plasmids for preparing the attenuated influenza virus strain in the technical scheme, and the defective plasmids contain M genes of influenza viruses with synonymous mutation, deletion and mutation. In the present invention, the defective plasmid preferably contains a nucleotide sequence represented by one of SEQ ID Nos. 3 to 7. In the present invention, the nucleotide sequence of the primer used for preparing the defective plasmid is preferably as shown in SEQ ID NO. 8-17.

The weakening method of the influenza virus with the synonymous mutation and the deletion mutation, the attenuated influenza virus strain and the application are further described in detail by combining specific examples, and the technical scheme of the invention comprises but is not limited to the following examples.

Example 1

M Gene-deficient plasmid construction

Designing primers M (sn) -F: atgggtgttcaaatgcagagatttaaataagcctctcactattgccgcaaat (SEQ ID NO.25) and M (sn) -R: gagaggcttatttaaatctctg (SEQ ID NO.26), using pPlu-PR 8-M (M gene nucleotide sequence is shown in SEQ ID NO. 27) vector plasmid in influenza reverse genetics 8 plasmid system as a template, carrying out PCR amplification on the synonymous mutation sequence according to PrimerSTAR instruction, determining that the amplified sequence is correct in size through gel electrophoresis, cutting gel, recovering the target fragment, and carrying out PCR amplification according to PrimerSTAR instruction

The HiFi DNAAssembly kit instructions require homologous recombination cloning to obtain the m (sn) plasmid. On the basis of M (sn) plasmid, primers are designed for PCR amplification and homologous recombination to obtain M (sn) + Mut6+ Del8 defective plasmid, M (sn) + Mut6+ Del28 defective plasmid, M (sn) + Mut6+ Del51 defective plasmid, M (sn) + Mut6+ Del73 defective plasmid and M (sn) + Mut6+ Del111 defective plasmid.

Primers used for amplification are shown in table 1:

TABLE 1 primers for amplification

Example 2

Defective influenza virus rescue

And (3) spreading 293T cells on a specially-made six-hole plate in a Saimearfly manner, and performing transfection when the cell density reaches 70-80%. The classical '6 + 2' influenza reverse genetics operating system is adopted to rescue defective recombinant influenza virus. 6 PR8 internal genes pFlu-PR8-PB2, pFlu-PR8-PB1, pFlu-PR8-PA, pFlu-PR8-NP, pFlu-PR8-NS and pFlu-PR8-M gene-deficient plasmids, and 2 external genes pFlu-PR8-HA, pFlu-PR8-NA each 0.5ug and a plasmid expressing full-length M2 0.25ug were co-transfected into 293T cells (Lipofectamine 3000), respectively. The culture medium containing TPCK-Trypsin at a final concentration of 0.5ug/ml was changed after the transfer for 24 hours, and the cell supernatant was collected after the transfer for 48 hours and inoculated with 8-day-old SPF chick embryos through the allantoic cavity at a concentration of 0.2 ml/piece. The inoculated chick embryos are cultured in an incubator at 37 ℃ for 48 h. Chick embryo allantoic fluid (F0) was collected, and a defective influenza virus was obtained separately and assayed for its hemagglutination potential. If there is no hemagglutination, the virus is harvested as a blind passage and tested for hemagglutination. The obtained M-deficient influenza viruses are respectively named as PR8-M (sn), PR8-M (sn) + Mut6+ Del8, PR8-M (sn) + Mut6+ Del28, PR8-M (sn) + Mut6+ Del51, PR8-M (sn) + Mut6+ Del73 and PR8-M (sn) + Mut6+ Del 111.

Example 3

Viral growth curve

Spreading MDCK-M2 cells in 24-well plate, inoculating M-deficient influenza virus strain into cells at a dose of multiplicity of infection (MOI) of 0.001 after the cells grow into a monolayer, repeating for 3 times, removing liquid from 24-well plate after infection for 2h, washing with PBS, adding DMEM medium containing 2% FBS to maintain cell growth, standing at 37 deg.C and 5% CO₂And culturing in an incubator. Respectively harvesting viruses at 12h, 24h, 36h, 48h, 60h and 72h after infection, continuously diluting the harvested virus liquid at different time points by 10 times, repeating each dilution by 4 times, respectively inoculating the virus liquid in a 96-well plate to MDCK-M2 cells growing to a monolayer, maintaining the growth of the cells by changing into 2% FBS DMEM culture solution after infecting for 2h, observing lesions after 48h, collecting the toxic valence of defective influenza virus strains, and calculating the TCID of the defective influenza virus strains by using a Reed-Muench method₅₀After the data analysis was completed, the growth curve of M-deficient influenza virus was plotted, and the results are shown in fig. 1.

All the attenuated viruses have reduced growth capacity compared with wild type PR8 virus. At 24h post-infection, the titers of each type of attenuated virus were approximately 10⁵A TCID₅₀Ml, but then the virus proliferates in large quantitiesAt 48h post-infection, the attenuated virus titer was at 10⁷A TCID₅₀About/ml. Therefore, the attenuated virus strains generated by the invention can grow in MDCK-M2 cells at high titer, and meet the normal production requirement.

Example 4

M-deficient influenza viruses can grow on normal MDCK

Respectively taking 250, 1000, 4000, 16000, 64000, 256000, 1024000 and 4096000 TCIDs₅₀The M-deficient influenza viruses of (a) were inoculated into 48-well MDCK cells, and cytopathic effects were observed and cell culture fluid HA titers were detected. The results are shown in FIG. 2. The result shows that the M-defective influenza virus can not be proliferated when the MDCK cell is inoculated with low dose virus, can grow and propagate in the MDCK cell when the MDCK cell is inoculated with high dose virus, embodies the restrictive proliferation capability of the attenuated virus, and is beneficial to inducing better protective power compared with transient defective virus.

Example 5

M-deficient influenza viruses can grow in chicken embryos

Respectively inoculating the M-defective influenza virus stock solution into SPF (specific pathogen free) chick embryos of 10 days old, 100 mu L per embryo, inoculating three chick embryos to each virus, and harvesting allantoic fluid after 72 hours to detect the virus HA titer. The results are shown in table 2:

TABLE 2M defective influenza Virus HA Titers

As shown in Table 2, all M-deficient influenza viruses can grow and propagate in chicken embryos in large quantities, and the HA titer can reach 2 at most^9.5Above, the average number of strains can reach 2^8.5. The culture of the chick embryos has high productivity, and has simple requirements on equipment plants compared with cell culture, thereby providing great convenience for producing defective influenza viruses.

Example 6

Passage test

The virus is continuously passaged for 10 generations in an MDCK-M2 cell line, and the stability of the virus M gene is detected by sequencing. Through detection, all the M genes of the attenuated viruses have no change compared with those before passage, and therefore, the attenuated influenza viruses of the invention are stably inherited at a gene level.

Example 7

M-deficient influenza virus mouse assay

And (3) taking 7-8-week-old Balb/c female mice, inoculating the M-defective influenza virus and the wild PR8 strain into the nose, and administering PBS to control mice, wherein each group comprises 5-8 mice. Mice were recorded daily for weight change and signs of infection after vaccination (FIG. 3), PR8-M (sn) + Mut6+ Del8, PR8-M (sn) + Mut6+ Del51, PR8-M (sn) + Mut6+ Del73 3 mice were euthanized 3 times per group, and lung and turbinate tissues were dissected for pathological examination and tissue virus titers were determined. The pathological examination adopts paraffin embedded tissues, and the tissues are photographed after the processes of slicing, rinsing, baking, HE dyeing and the like. The virus titer was determined as follows: the MDCK-M2 cells are paved on a 96-well plate, after the cells grow into a monolayer, the recombinant viruses are diluted by DMEM in a gradient mode according to the continuous 10-fold ratio, and the dilution is carried out until the recombinant viruses reach 10^-6That is, the medium in the 96-well plate was then discarded, the plate was washed with DMEM, 100. mu.L of the corresponding dilution of recombinant virus solution was added to each well, each gradient was repeated 4 times, and the incubation was performed at 37 ℃ with 5% CO₂After the cells are incubated in the cell culture box for 2 hours, the cell supernatant is discarded and is changed into a DMEM medium containing 2% FBS to maintain the growth of the cells, the supernatant is discarded after 48 hours, the plate is washed twice by PBS, the fluorescence condition in each hole is observed and recorded under an inverted fluorescence microscope, and the TCID of the cells is calculated by applying a Reed-Muench method₅₀. Blood was collected 14 days after the first immunization, and the serum HI (blood coagulation titer inhibition) level of the mice was examined. The HI level detection method is as follows: preparing four units of antigen, wherein the dilution multiple of the virus antigen is equal to the virus agglutination valence/4, simultaneously inactivating the mouse serum to be detected at 56 ℃ for 30min in advance, adding 25 mu L of the serum to be detected into a first hole of a 96-hole plate, and adding 1: 2, adding four units of antigen of 25 mu L into the diluted serum, adding 25 mu L of each chicken erythrocyte suspension into each hole after reacting for 30min at room temperature, standing for 30min at room temperature, observing test results and recording the highest dilution with hemagglutination, namely HI level, wherein the results are shown in table 3. Mice immunized 21 days later with PR8 virus 10⁶TCID₅₀Challenge was performed at a dose of 50uL and mouse status and weight changes were recorded (FIG. 6).

From the results, the body weight of the mice slightly decreased within 5% on day 2 and day 3 after the mice were infected with the defective attenuated virus, and then the body weight was recovered, and all the infected mice except the control group on day 5 recovered to the original body weight and grew normally, and the mental state of the mice was good by day 14. In contrast, the control group of 5 mice inoculated with the wild-type PR8 virus all died on day 5. Meanwhile, 3 days after inoculation, the wild type PR8 strain has higher virus titer in mouse turbinate and lung lobe tissues than that of attenuated influenza virus. In lung tissue, the wild-type virus titer is significantly higher than that of attenuated influenza virus PR8-M (sn) + Mut6+ Del8, PR8-M (sn) + Mut6+ Del51, PR8-M (sn) + Mut6+ Del73 (FIG. 4), and a small amount of PR8-M (sn) + Mut6+ Del73 recombinant virus can still be detected in lung lobe tissue. In addition, pathological section results show that PR8-M (sn) + Mut6+ Del73 attenuated virus strain causes diffuse lymphocyte infiltration around a small number of bronchi of lung lobe 2/3 lung tissue of mouse, moderate fibrosis characteristic is seen in lung interstitium, PR8-M (sn) + Mut6+ Del8 causes diffuse lymphocyte infiltration around a small number of bronchi of lung lobe 1/3 lung lobe, moderate and mild fibrosis characteristic is seen in lung interstitium, PR8-M (sn) + Mut6+ Del51 causes diffuse lymphocyte infiltration only around a small number of bronchi of lung lobe. It can be seen that the attenuated strains produced by the same attenuation method have differences in toxicity, wherein the PR8-m (sn) + Mut6+ Del73 strain has higher toxicity (fig. 5).

Combining the results of FIG. 3 and FIG. 4, it can be seen that the defective influenza virus rescued by the present invention is safe in mice and does not cause death of mice, but has different pathogenic degrees to mice, and the more toxic is PR8-M (sn) + Mut6+ Del73 strain.

TABLE 3 serum HI antibody results

Serum HI antibodies are shown in table 3 14 days after infection of the mice with the virus. As can be seen from the results in Table 3, the mice produced effective HI antibody titers, with all HI levels reaching 2⁴To 2⁸Among them, PR8-M (sn) + Mut6+ Del8, PR8-M (sn) + Mut6+ Del73 strains have excellent immune effect and can achieve complete protection. PR8-M (sn) + Mut6+ Del28 causes the obvious insufficient immune effect of the low virulent strain. In addition, the results in fig. 6 show that all strains can protect mice from viral infection after challenge. Except for the large change of body weight of the mice in the group PR8-M (sn) + Mut6+ Del51, the body weight of the mice in the group PR8-M (sn) + Mut6+ Del8 and PR8-M (sn) + Mut6+ Del73 basically keeps stable, and the immune effect of the PR8-M (sn) + Mut6+ Del51 strain is weaker than that of the PR8-M sn (sn) + Mut6+ Del8 and PR8-M (sn) + Mut6+ Del73 as shown by combining HI antibody titer and the result of the toxicity test. The above results further illustrate that the attenuated influenza viruses of the present invention produced effective antibodies against influenza HA, but the attenuated viruses produced by different attenuation methods were different in immune efficacy.

The results show that the attenuated viruses produced by the attenuation method have good growth characteristics and can grow in MDCK-M2 and chick embryos. Meanwhile, high-dose virus inoculation can be propagated in MDCK cells, virus limited replication capacity is shown, and compared with single-replication viruses, the virus-free recombinant virus has more excellent immunity performance. In addition, the attenuation method produces different attenuated viruses with different toxicity and immunogenicity, wherein the strain with higher toxicity is PR8-M (sn) + Mut6+ Del73, and the strain with lower immunogenicity is PR8-M (sn) + Mut6+ Del 28. By combining the growth characteristics, toxicity and immunogenicity data, the strain with better performance in the invention is PR8-M (sn) + Mut6+ Del 8. According to different purposes of preparing the influenza vaccine, the weakening method can lay a foundation for preparing the influenza attenuated live vaccine candidate strain and the avian influenza attenuated inactivated vaccine.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Zhejiang Difu moist biotech Co., Ltd

<120> weakening method of influenza virus combining synonymous mutation with deletion mutation, weakened influenza virus strain and application

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcgtaccaaa agcgtatggg tgttcaaatg cagagattta aataag 46

<210> 2

<211> 6

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgatga 6

<210> 3

<211> 974

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgacgca aatatcattg 780

ggatcttgca cttgacattg tggattcttg atcgtctttt tttcaaatgc atttaccgtc 840

gctttaaata cggactgaaa ggagggcctt ctacggaagg agtgccaaag tctatgaggg 900

aagaatatcg aaaggaacag cagagtgctg tggatgctga cgatggtcat tttgtcagca 960

tagagctgga gtaa 974

<210> 4

<211> 954

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgatgca cttgacattg 780

tggattcttg atcgtctttt tttcaaatgc atttaccgtc gctttaaata cggactgaaa 840

ggagggcctt ctacggaagg agtgccaaag tctatgaggg aagaatatcg aaaggaacag 900

cagagtgctg tggatgctga cgatggtcat tttgtcagca tagagctgga gtaa 954

<210> 5

<211> 931

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgagatc gtcttttttt 780

caaatgcatt taccgtcgct ttaaatacgg actgaaagga gggccttcta cggaaggagt 840

gccaaagtct atgagggaag aatatcgaaa ggaacagcag agtgctgtgg atgctgacga 900

tggtcatttt gtcagcatag agctggagta a 931

<210> 6

<211> 909

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgattta ccgtcgcttt 780

aaatacggac tgaaaggagg gccttctacg gaaggagtgc caaagtctat gagggaagaa 840

tatcgaaagg aacagcagag tgctgtggat gctgacgatg gtcattttgt cagcatagag 900

ctggagtaa 909

<210> 7

<211> 871

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcgtac 720

caaaagcgta tgggtgttca aatgcagaga tttaaataag tgatgatcta cggaaggagt 780

gccaaagtct atgagggaag aatatcgaaa ggaacagcag agtgctgtgg atgctgacga 840

tggtcatttt gtcagcatag agctggagta a 871

<210> 8

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tcaagtgatt gatgacgcaa atatcattgg gatcttgc 38

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcatcaatca cttgaaccgt tg 22

<210> 10

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcaagtgatt gatgatgcac ttgacattgt ggattcttg 39

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcatcaatca cttgaaccgt tg 22

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tcaagtgatt gatgagatcg tctttttttc aaatg 35

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tcatcaatca cttgaaccgt tg 22

<210> 14

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcaagtgatt gatgatttac cgtcgcttta aatacg 36

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tcatcaatca cttgaaccgt tg 22

<210> 16

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tcaagtgatt gatgatctac ggaaggagtg ccaaag 36

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tcatcaatca cttgaaccgt tg 22

<210> 18

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gcctatcaga aacgaatggg ggtgcagatg caacggttca agtgat 46

<210> 19

<211> 6

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cctctc 6

<210> 20

<211> 8

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

actattgc 8

<210> 21

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

actattgccg caaatatcat tgggatct 28

<210> 22

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

actattgccg caaatatcat tgggatcttg cacttgacat tgtggattct t 51

<210> 23

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

actattgccg caaatatcat tgggatcttg cacttgacat tgtggattct tgatcgtctt 60

tttttcaaat gca 73

<210> 24

<211> 111

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

actattgccg caaatatcat tgggatcttg cacttgacat tgtggattct tgatcgtctt 60

tttttcaaat gcatttaccg tcgctttaaa tacggactga aaggagggcc t 111

<210> 25

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

atgggtgttc aaatgcagag atttaaataa gcctctcact attgccgcaa at 52

<210> 26

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gagaggctta tttaaatctc tg 22

<210> 27

<211> 982

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60

aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120

gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180

ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240

caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300

aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360

gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420

gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480

tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540

ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600

gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660

actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcctat 720

cagaaacgaa tgggggtgca gatgcaacgg ttcaagtgat cctctcacta ttgccgcaaa 780

tatcattggg atcttgcact tgacattgtg gattcttgat cgtctttttt tcaaatgcat 840

ttaccgtcgc tttaaatacg gactgaaagg agggccttct acggaaggag tgccaaagtc 900

tatgagggaa gaatatcgaa aggaacagca gagtgctgtg gatgctgacg atggtcattt 960

tgtcagcata gagctggagt aa 982

Claims

1. A method of attenuating influenza viruses with synonymous mutations in combination with deletions and mutations comprising the steps of:

2. The method of attenuating of claim 1 wherein the background strain of the method of attenuating comprises a/Puerto Rico/8/1934.

3. The weakening method according to claim 1, wherein the synonymous mutation comprises mutation from 715 th base to 760 th base of the M gene into the nucleotide sequence shown in SEQ ID No. 1.

4. The weakening method according to claim 1, wherein the mutation of the stop codon comprises the mutation of the 761 th base to the 766 th base of the M gene into the nucleotide sequence shown in SEQ ID No. 2.

5. The weakening method according to claim 1, wherein the deletion of the partial nucleotide sequence comprises: deleting the nucleotide sequence from 767 th base to 877 th base of M gene at any position and length.

6. The weakening method according to claim 5, wherein the deletion of the partial nucleotide sequence comprises:

deleting 767 th base to 774 th base of M gene;

deleting base 767 to base 794 of the M gene;

deleting 767 th base to 817 th base of the M gene;

deleting from 767 th base to 839 th base of M gene;

alternatively, the deletion of base 767 to 877 of the M gene is performed.

7. An attenuated influenza virus strain produced by the attenuation method according to any one of claims 1 to 6.

8. The attenuated influenza virus strain of claim 7, wherein the M gene is modified by a synonymous mutation, a stop codon mutation and a deletion of a part of the nucleotide sequence in the background of A/Puerto Rico/8/1934.

9. A set of defective plasmids for use in the preparation of the attenuated influenza strain of claim 7 or 8, wherein said defective plasmids contain synonymous mutations in combination with deleted and mutated M gene of influenza virus.

10. Use of the attenuating method of any one of claims 1 to 6 or the attenuating influenza virus strain of claim 7 or 8 or the defective plasmid of claim 9 for the preparation and production of an influenza attenuated virus vaccine.