CN114381377A

CN114381377A - Aspergillus MF1 for removing heavy metal ions, microbial inoculum and preparation method and application thereof

Info

Publication number: CN114381377A
Application number: CN202111334940.0A
Authority: CN
Inventors: 王进; 王陈; 岳正波; 潘鑫; 贾亚文
Original assignee: Hefei University of Technology
Current assignee: Hefei University of Technology
Priority date: 2021-11-11
Filing date: 2021-11-11
Publication date: 2022-04-22
Anticipated expiration: 2041-11-11
Also published as: CN114381377B

Abstract

The invention relates to the field of environmental protection, in particular to an aspergillus MF1 strain for removing heavy metal ions, a microbial inoculum, a heavy metal degradation agent and application thereof. The invention provides Aspergillus sp (Aspergillus sp) MF1 for removing heavy metal ions, wherein the collection number of the Aspergillus MF1 is GDMCC NO. 61350. The strain disclosed by the invention can realize the effect of removing various heavy metal ions under the condition of low pH.

Description

Aspergillus MF1 for removing heavy metal ions, microbial inoculum and preparation method and application thereof

Technical Field

The invention relates to the field of environmental protection, in particular to an aspergillus MF1 strain for removing heavy metal ions, a microbial inoculum and a preparation method and application thereof.

Background

In the mining process, sulfide minerals are subjected to a series of physicochemical reactions such as leaching, oxidation and hydrolysis under the action of air, water and microorganisms to form a sulfuric acid-sulfuric acid ferric iron solution with a low pH value, generally 2.5-5.5, and under the condition, various metal ions such as Cu in the ores can be dissolved out²⁺、Zn²⁺、Pb²⁺、Mn²⁺And Cd²⁺And the heavy metal ions have high toxicity, so that not only can water resources be seriously polluted and the yield and the quality of crops be influenced, but also the heavy metal ions are easily enriched and expanded in a biological chain, and finally chronic poisoning is caused by accumulation in certain organs of a human body and the health of human beings is harmed. Therefore, according to the pollution characteristics of acid mine wastewater (AMD), an economical and practical treatment method is sought, the harm of the acid mine wastewater is eliminated, and the sustainability of mineral resource development is ensured, which becomes a problem of wide attention of governments and various social circles.

Among the AMD treatment methods, the microbiological method is a treatment technology applied to wider AMD treatment due to the characteristics of strong applicability, low investment, environmental friendliness, small pollution and the like, and the currently applied microorganisms comprise algae, fungi and bacteria, but the heavy metal ions are mainly removed under a neutral condition or a slightly acidic condition, but the reports of screening the fungus strains for obtaining the heavy metal ion resistance in an extremely acidic environment are relatively limited. In addition, since acidic industrial wastewater, especially acidic mine wastewater, generally contains a plurality of metal ions at the same time, it is necessary to select an acid-resistant strain capable of removing a plurality of heavy metals at the same time.

Disclosure of Invention

In order to solve the problems, the invention provides an aspergillus MF1 strain for removing heavy metal ions, a microbial inoculum, and a preparation method and application thereof. The strain disclosed by the invention can realize the effect of removing various heavy metal ions under the condition of low pH.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides Aspergillus sp (Aspergillus sp) MF1 for removing heavy metal ions, wherein the collection number of the Aspergillus MF1 is GDMCC NO. 61350.

The invention also provides a microbial inoculum, and the effective component of the microbial inoculum comprises the aspergillus MF 1.

Preferably, the number of spores of Aspergillus MF1 per Kg or L of the microbial inoculum is 8X 10¹⁰And (4) respectively.

The invention also provides a preparation method of the microbial inoculum, which comprises the following steps: mixing and culturing the strain and a culture medium to obtain the microbial inoculum; the culture medium comprises a nitrogen source and a carbon source; the carbon source comprises glucose and/or sucrose; the nitrogen source comprises yeast and/or peptone.

Preferably, the weight ratio of the carbon source to the nitrogen source is (7.5-15): 1.

The invention also provides application of the aspergillus MF1 or the microbial inoculum prepared by the preparation method in removing heavy metal ions.

The invention also provides application of the aspergillus MF1 or the microbial inoculum prepared by the preparation method in removing heavy metal ions in water.

Preferably, the water comprises wastewater or groundwater.

Preferably, the wastewater comprises acidic wastewater.

Preferably, the pH value of the acidic wastewater is more than or equal to 3.5.

Has the advantages that: the invention provides Aspergillus sp (Aspergillus sp) MF1 for removing heavy metal ions, wherein the collection number of the Aspergillus MF1 is GDMCC NO. 61350. The selected strain is screened from acid mine wastewater in the east of Anhui province, so that the strain can tolerate low pH and can effectively remove various heavy metal ions; and the strain is aligned with Cu²⁺The maximum tolerated concentration is 770.18mg/g when Cu²⁺At concentrations of 50mg/L and 100mg/L, Aspergillus MF1 was added to Cu²⁺The removal rate of the catalyst can reach 78.40 percent and 64.47 percent respectively.

Biological preservation Instructions

Aspergillus sp MF1, deposited in Guangdong province microorganism culture Collection (GDMCC for short), with the deposit address of No. 59, No. 5, Michelia furiosaefolia Middy No. 100, 2020, 12, 7 days, and the deposit number of GDMCC NO. 61350.

Drawings

FIG. 1 is a morphological identification diagram of Aspergillus MF1, which is a colony morphology diagram of Aspergillus MF1 and a thallus morphology diagram of Aspergillus MF 1;

FIG. 2 is a diagram showing the results of 18S rDNA PCR of Aspergillus MF1, wherein the left image is a feature map and the right image is a gel electrophoresis image of PCR products of Aspergillus strains;

FIG. 3 is a phylogenetic tree of Aspergillus MF 1;

FIG. 4 is a graph of the effect of different pH on the growth of Aspergillus MF 1;

FIG. 5 shows the biomass of Aspergillus MF1 under different carbon source conditions;

FIG. 6 shows the biomass of Aspergillus MF1 under different nitrogen sources;

FIG. 7 shows Cu in the growth process of Aspergillus MF1²⁺Concentration change and Aspergillus MF1 vs Cu²⁺The removal rate;

FIG. 8 shows Mn in the growth process of Aspergillus MF1²⁺A change in concentration;

FIG. 9 shows Aspergillus MF1 vs Mn²⁺The removal rate;

FIG. 10 is a graph showing the effect of Aspergillus MF1 on different metal ion concentrations in the presence of various metal ions at pH 4;

FIG. 11 shows the removal of different metal ions by Aspergillus MF1 in the presence of various metal ions at pH 4;

FIG. 12 is a graph showing the effect of Aspergillus MF1 on different metal ion concentrations in the presence of various metal ions at pH 5.5;

FIG. 13 shows the removal of different metal ions by Aspergillus MF1 in the presence of multiple metal ions at pH 5.5.

Detailed Description

The aspergillus MF1 of the invention preferably has the following properties:

(1) the bacterial colony is gray yellow, the surface is dry and uneven, the middle part is raised, and the edge is flat;

(2) the hyphae grow vigorously, one end of the hyphae is in a long column shape, the other end of the hyphae is in a crown shape, a circle of spores grow outside the hyphae, and the spores are in a green and oval shape;

(3) the acid resistance of the strain is strong, and the strain can survive in the environment with the pH value more than or equal to 3.5;

(4) the nucleotide sequence of 18SrDNA of aspergillus MF1 is shown as SEQ ID NO: 1, and the following components: TGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCCACC CGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGC CGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATG AACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAA CTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAA TGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAAC GCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATT GCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGG GGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTAT GGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCA ACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACT TAAGCATA are provided. The selected strain is screened from acid mine wastewater in the east of Anhui province, is obtained by screening under an extreme acid condition and can normally grow and grow under the condition that the pH is more than or equal to 3.5, so that the strain can tolerate low pH and simultaneously remove heavy metals, and has higher removal rate under a neutral condition relatively.

The invention provides a microbial inoculum, the effective component of which comprises the aspergillus MF 1. In the present invention, the number of spores of Aspergillus MF1 per Kg or per L of the microbial inoculum is preferably 8X 10¹⁰And (4) respectively. The microbial inoculum can effectively remove various heavy metal ions, and has high removal rate.

In the present invention, the carbon source preferably includes glucose; the nitrogen source preferably comprises yeast; the weight ratio of the carbon source to the nitrogen source is preferably (7.5-15): 1, and more preferably 10: 1. The source of the carbon source or nitrogen source is not particularly limited in the present invention, and commercially available products known to those skilled in the art may be used. By optimizing the culture medium, the invention has the advantages of high biological quantity of the cultured strain in a certain time and low culture cost.

The strain disclosed by the invention has the advantages of low pH tolerance, high removal rate and low culture cost, and can be used for effectively removing various heavy metal ions, so that the strain, a microbial inoculum containing the strain and a heavy metal degradation agent containing the strain can be applied to removal of the heavy metal ions.

The invention provides application of the aspergillus MF1 or the microbial inoculum prepared by the preparation method in removal of heavy metal ions, and further application in removal of heavy metal ions in water, wherein the heavy metal ions comprise Fe³⁺、Al³⁺、Mn²⁺、Cu²⁺And Zn²⁺One or more of the above; the water preferably comprises waste water and ground water; the wastewater comprises preferably acidic wastewater, further preferably acidic industrial wastewater, and more preferably acidic mine wastewater. The acidic mine wastewater disclosed by the invention is preferably the acidic mine wastewater (AMD for short) in an extreme environment formed by exposing sulfide ore stored underground in mine mining, road construction and other large-scale excavation activities and under the combined action of water, oxygen, thiobacillus ferrooxidans and other factors, and has the characteristics of low pH, high-concentration sulfate radical and high-concentration heavy metal ions.

The pH value of the acidic mine wastewater is preferably 2.5-6.5; the concentration of sulfate radicals in the acid mine wastewater is preferably 500-5000 mg/L; the concentration of different heavy metal ions in the acid mine wastewater is preferably 5-500 mg/L, wherein Fe³⁺The concentration of (B) is preferably 5-500 mg/L, Al³⁺The concentration of (B) is preferably 5-1000 mg/L, Mn²⁺Is preferably 5～1000mg/L，Cu²⁺The concentration of (b) is preferably 5-100 mg/L, Zn²⁺The concentration of (b) is preferably 5 to 100 mg/L.

In order to further illustrate the invention, the following describes in detail the aspergillus MF1 for removing heavy metal ions, the microbial inoculum and the preparation method and application thereof provided by the invention with reference to the drawings and the examples, but the invention is not to be construed as limiting the scope of the invention.

Example 1

Enrichment culture of aspergillus MF 1: taking 50mL of acid mine wastewater in east of Anhui province, and using a bench centrifuge at 3000 r.min^-1Removing impurities by low-speed centrifugation; transferring 1mL of centrifuged supernatant into 50mL of modified Martin liquid medium (formula shown in Table 1), and culturing at 28 deg.C and 120r min^-1Carrying out enrichment culture for 72h under the condition, carrying out transfer culture once every 3 days according to the inoculum size of 2 percent of the volume ratio, and carrying out transfer culture for 2 times for later use;

separation and purification of aspergillus MF 1: before the experiment, sterilizing a Bengal red culture medium, a culture dish, a coating rod, a dilution tube, pure water and the like in a high-temperature sterilization pot at 121 ℃ for 20min, pouring 25-30 mL of flat plates in a sterile environment, and cooling for later use; collecting 1mL of the enriched bacterial solution after 3 times of subculture, and placing the bacterial solution in a dilution tube according to l0^-1、10^-2、10^-3、 10^-4、10^-5Sequentially diluting the culture solution in a gradient manner, respectively sucking 0.2mL of diluted bacterial solutions with different gradients in an aseptic environment, coating the diluted bacterial solutions on a plate of a Bengal culture medium (formula shown in table 1), inversely culturing the diluted bacterial solutions in a constant-temperature incubator at 28 ℃ for 2-3 days until macroscopic colonies grow on the plate; selecting typical single bacterial colony growing on the plate, repeatedly streaking until the shape of the bacteria is uniform by microscopic examination, and stopping streaking separation. Inoculating the obtained pure colony in a bacteria-protecting tube, storing in a refrigerator at 4 ℃ as a strain, and transferring to a refrigerator at-81 ℃ for storage after one day;

TABLE 1 culture Medium formulation

Example 2

Morphological identification: the bacterial strain obtained in example 1 is observed by a high-power fluorescence microscope for colony, hypha, spore and other structures, the color, size and shape of the fungus are recorded, and the identification is carried out by referring to ' fungi identification handbook ' (Weijing super, 1979) and ' Chinese fungi (Zhang Zhongyi, 2014), and the identification result is shown in figure 1: the colony is gray yellow, the surface is dry and uneven, the middle part is raised, and the edge is flat; the hyphae grow vigorously, one end of the hyphae is in a long column shape, the other end of the hyphae is in a crown shape, a circle of spores grow outside the hyphae, and the spores are in a green and oval shape; the preliminary identification result was Aspergillus.

Example 3

Molecular biological identification: DNA of the strain selected in example 1 was extracted according to an Ezup column type fungal genome DNA extraction kit (SK8259) provided by Shanghai bioengineering, Ltd., and PCR amplification was performed on the extracted DNA using 18SrDNA universal primers NS1(SEQ ID NO: 5'-GTAGTCATATGCTTGTCTC-3') and NS6(SEQ ID NO: 3: 5'-GCATCACAGACCTGTTATTGCCTC-3'); the PCR amplification result was observed by gel electrophoresis (1% agarose electrophoresis, 150V, 100mA 20min electrophoresis observation, results are shown in FIG. 2), the PCR product was sequenced by Shanghai bioengineering, Inc., and the sequencing result is shown in SEQ ID NO: 1 is shown in the specification; the 18SrDNA sequencing results were blast aligned at NCBI and phylogenetic trees were constructed using software MEGA-X, see FIG. 3.

As can be seen from FIGS. 2 and 3, the results of PCR product gel electrophoresis and phylogenetic tree show that the similarity of the strain sequence after blast comparison on NCBI to Aspergillus spp reaches 99.77%, which proves that a pure strain of Aspergillus spp is obtained by screening.

Example 4

Taking Aspergillus (Aspergillus sp) MF1 biomass as evaluation index, setting pH gradient of 1.5, 2.5, 3.5, 4.5, 5.5, 7.0, selecting improved Martin type culture medium (peptone 5.00g, yeast extract powder 2.00g, glucose 20.00g, potassium dihydrogen phosphate 1.00g, magnesium sulfate 0.50g, chloramphenicol 0.10g, distilled water 1000mL), adding 100 μ L Aspergillus (Aspergillus sp) MF1 spore suspension, wherein spore concentration in the spore suspension is 8 × 10¹⁰CFU/L, culturing at 28 deg.C for 120r min^-1The culture is carried out for 144h in a constant-temperature shaking incubator, samples are taken every 16h and placed in an ultracentrifuge at low temperature, and the rotating speed is adjusted to 8000 r.min^-1Centrifuging for 5min, discarding supernatant, and measuring dry weight of mycelia, wherein the result is shown in FIG. 4, and the strain can normally grow under the condition that pH is 3.5-7.0; under the condition of pH being 2.5, the strain can grow, but the growth amount is low; the strain can grow abnormally at pH 1.5.

Example 5

Culture Medium optimization experiment

Under the acidic condition of pH3.5, the culture conditions such as carbon-nitrogen ratio of carbon-nitrogen source type are optimized by taking aspergillus biomass and carbon-nitrogen source utilization rate as evaluation indexes.

The carbon source is glucose, sucrose, starch, ethylene glycol and sodium acetate respectively, the nitrogen source is yeast, peptone + yeast, urea, sodium nitrate and ammonium sulfate respectively, the carbon-nitrogen ratio is 5.0, 7.5, 10.0, 12.5 and 15.0 respectively, an improved martin culture medium (the culture medium is the same as the embodiment 4) is selected, 100 mu L of Aspergillus (Aspergillus sp) MF1 spore suspension is added, wherein the spore concentration in the spore suspension is 8 multiplied by 10¹⁰CFU/L, culturing at 28 deg.C for 120r min^-1The culture is carried out for 144h in a constant-temperature shaking incubator, samples are taken every 16h and placed in an ultracentrifuge at low temperature, and the rotating speed is adjusted to 8000 r.min^-1Centrifuging for 5min, discarding supernatant, and measuring dry weight of mycelium, the measurement results are shown in tables 2-4, FIG. 5 and FIG. 6.

Table 2 biomass and specific growth rate of Aspergillus sp.mf1 under different carbon source conditions

Optimization of conditions	Optimized formula	biomass/(g.L)^-1)	Specific growth rate 10^-2/h^-1
					Glucose	8.96±0.26	5.64±0.01
	Sucrose	8.03±0.06	5.52±0.01
				Carbon source	Starch	6.38±0.09	5.28±0.02
	Sodium acetate	4.16±0.05	4.84±0.01
					Ethylene glycol	2.25±0.08	4.20±0.04

Table 3 biomass and specific growth rate of Aspergillus sp.mf1 under different carbon source conditions

TABLE 4 Biomass and specific growth Rate of Aspergillus sp.MF1 under different carbon to nitrogen ratios

As can be seen from tables 2 to 4 and FIGS. 5 and 6, when the carbon source is glucose or sucrose, the nitrogen source is yeast and/or peptone, and the carbon-nitrogen ratio is (7.5-15): 1, the biomass of the strain cultured within a certain period of time is high, and the culture cost is low; and when the carbon source is glucose, the nitrogen source is yeast, the carbon-nitrogen ratio is 10:1, and the biomass is highest.

Example 6

CuSO was added to the modified Martin medium (same medium as in example 4)₄Solution to Cu²⁺The concentration is 50mg/L, 100mg/L, 300mg/L, 500mg/L and 1000mg/L respectively, 100 μ L Aspergillus (Aspergillus sp) MF1 spore suspension is added, wherein the spore concentration in the spore suspension is 8 × 10¹⁰CFU/L, adjusting pH to 3.5, culturing at 28 deg.C and 120r/min for 144h, sampling at 48h intervals to determine fungal biomass, and measuring Cu in the sample supernatant by flame atomic absorption method (atomic absorption spectrometer AA240FS, VAR-IAN, USA)²⁺Concentration, and calculating Cu after 144h of culture²⁺The removal rates and the measurement results are shown in Table 5, Table 6 and FIG. 7.

TABLE 5 different Cu at pH3.5²⁺Concentration of (2) treating Cu at different times²⁺Concentration (unit: g/L)

Note: 0h Cu in Table 5²⁺The concentration is determined by flame atomic absorption spectrophotometer, and the prepared Cu²⁺There is some error in the concentration, but the error is within the range allowed by the measurement.

TABLE 6 different Cu at pH3.5²⁺Concentration of Cu after 144h treatment²⁺Removal rate

Cu²⁺Treatment concentration (mg/L)	50	100	300	500	1000
						Removal Rate (%)	78.40	64.47	20.44	14.33	13.36

Note: the removal rate in table 6 is (measured value of 0 h-measured value of 144 h)/measured value of 144h × 100%.

As is clear from Table 5, Table 6 and FIG. 7, under the condition of pH3.5, Aspergillus MF1 for Cu²⁺The removal of (1) is mainly after 48h, because after 48h, the aspergillus MF1 is in a logarithmic growth stage, the thalli are propagated in large quantity, and a large amount of Cu is removed²⁺(ii) a And Aspergillus MF1 for Cu²⁺Removal rate with Cu²⁺Increased and decreased concentration of Cu²⁺At a concentration of 50mg/L, the removal rate is as high as 78.40 percent along with Cu²⁺The concentration is increased to 1000mg/L, and the removal rate is reduced to 13.36 percent.

Example 7

Improvement of respective directionMartin medium (Medium same as example 4) supplemented with MnSO₄·H₂O solution to Mn²⁺The concentration is 100mg/L, 300mg/L, 500mg/L, 1000mg/L and 2000mg/L respectively, 100 μ L of Aspergillus (Aspergillus sp) MF1 spore suspension is added, wherein the spore concentration in the spore suspension is 8 × 10¹⁰CFU/L, adjusting pH to 3.5, culturing at 28 deg.C and 120r/min for 144h, sampling at 48h intervals to measure fungal biomass, and measuring Mn in the sample supernatant by flame atomic absorption method (atomic absorption spectrometer AA240FS, VAR-IAN, USA)²⁺Concentration, and calculating Mn after 144h of culture²⁺The removal rates and the measurement results are shown in table 7, table 8, fig. 8 and fig. 9.

TABLE 7 different Mn at pH3.5²⁺Concentration of (2) Mn at different times²⁺Concentration (unit: g/L)

Note: mn of 0h in Table 7²⁺The concentration is determined by flame atomic absorption spectrophotometer, and the Mn is prepared²⁺There is some error in the concentration, but the error is within the range allowed by the measurement.

TABLE 8 different Mn at pH3.5²⁺Mn after concentration treatment for 144h²⁺Removal rate

Mn²⁺Treatment concentration (mg/L)	100	300	500	1000	2000
						Removal Rate (%)	92.69	43.05	39.24	20.89	12.35

Note: the removal rate in table 8 is (measured value of 0 h-measured value of 144 h)/measured value of 144h × 100%.

As is clear from tables 7 and 8, at pH3.5, Aspergillus was used for Mn²⁺The removal of (1) is mainly after 48 hours, because after 48 hours, the aspergillus is in the logarithmic growth stage, the thalli are propagated in large quantity, and a large amount of Mn is removed²⁺(ii) a Aspergillus for Mn²⁺Removal Rate with Mn²⁺Increased and decreased concentration of Mn²⁺The removal rate is up to 92.69 percent when the concentration is 100mg/L, and the removal rate is changed along with Mn²⁺The concentration is increased to 2000mg/L, and the removal rate is reduced to 12.35 percent

Example 8

Fe was added to a modified Martin medium (same medium as in example 4) having a pH of 4³⁺、Al³⁺、 Mn²⁺、Cu²⁺、Zn²⁺Obtaining a stock solution conditioning medium, wherein the stock solution conditioning medium contains Fe³⁺Has a concentration of 100 mg.L^-1，Al³⁺Has a concentration of 500 mg.L^-1，Mn²⁺Has a concentration of 500 mg.L^-1，Cu²⁺Has a concentration of 100 mg.L^-1，Zn²⁺Has a concentration of 100 mg.L^-1Adding 100 μ L spore suspension of Aspergillus (Aspergillus sp) MF1, wherein the spore concentration in the spore suspension is 8 × 10¹⁰CFU/L, noted as experimental group; adding 100 μ L spore suspension of Aspergillus (Aspergillus sp) MF1 into modified Martin medium with pH of 4, wherein the spore concentration in the spore suspension is 8 × 10¹⁰CFU/L, as control group;

the experimental group and the control group were respectively cultured at 28 deg.C and 120r min^-1The culture is continuously carried out for 112h in a constant-temperature shaking incubator, the sample is placed in a super-speed low-temperature centrifuge after being sampled, and the rotating speed is adjusted to 8000 r-min^-1Centrifuging for 5min, and collecting supernatant for determining Fe³⁺、Al³⁺、Mn²⁺、Cu²⁺、Zn²⁺The concentration change results are shown in table 10 and fig. 10, the heavy metal ion removal effect is shown in fig. 11, the hyphae are used for determining the dry weight, and the dry weight results are shown in table 9.

TABLE 9 Effect of various Metal ions on the growth of Aspergillus (Aspergillus sp) MF1 at pH4

	Biomass (g/L)	Error of the measurement
			Control group	9.4382	2.01％
Experimental group	9.3423	0.76％

As shown in table 9, the growth of the aspergillus MF1 test group was not much affected by the heavy metal ions in the presence of the heavy metal ions, and the biomass accounted for 98.98% of the control group in the absence of the heavy metal ions.

TABLE 10 influence of Aspergillus sp MF1 on the concentration of various metal ions in the coexistence of various metal ions at pH4

	Initial concentration (mg/L)	Concentration after treatment (mg/L)	Error of the measurement	Removal Rate (%)
					Fe ³⁺	100	54.58	3.62％	45.42％
Al
	³⁺	500	285.44	2.79％	42.91％
Mn
	²⁺	500	459.85	1.68％	8.03％
Cu
	²⁺	100	61.65	9.84％	38.35％
Zn
	²⁺	100	79.15	2.86％	20.85％

As is clear from Table 10, FIG. 10 and FIG. 11, the strain of the present invention can effectively remove a plurality of heavy metal ions under the conditions of coexistence of a plurality of heavy metal ions and low pH, and has high removal rates for ferric iron, aluminum and copper ions, wherein the removal rate for ferric iron reaches 45.42%, the removal rate for aluminum ions reaches 42.91%, and the treatment effect for aluminum-containing wastewater under low pH is superior to that of the treatment results of other methods.

Example 9

Addition of Fe to modified Martin Medium pH5.5³⁺、Al³⁺、Mn²⁺、Cu²⁺、Zn²⁺Stock solution conditioned media, wherein the stock solution conditioned media contains Fe³⁺Has a concentration of 50 mg.L^-1，Al³⁺Has a concentration of 50 mg.L^-1，Mn²⁺Has a concentration of 50 mg.L^-1，Cu²⁺Has a concentration of 50 mg.L^-1，Zn²⁺Has a concentration of 50 mg.L^-1Adding 100 μ L spore suspension of Aspergillus (Aspergillus sp) MF1, wherein the spore concentration in the suspension is 8 × 10¹⁰CFU/L, noted as experimental group; adding 100 μ L of spore suspension of Aspergillus (Aspergillus sp) MF1 into modified Martin medium with pH of 5.5, wherein the spore concentration in the suspension of steamed stuffed bun is 8 × 10¹⁰CFU/L, as control group;

the experimental group and the control group were respectively cultured at 28 deg.C and 120r min^-1The culture is continuously carried out for 112h in a constant-temperature shaking incubator, the sample is placed in a super-speed low-temperature centrifuge after being sampled, and the rotating speed is adjusted to 8000 r-min^-1Centrifuging for 5min, and reserving supernatant for measuring Fe in solution³⁺、Al³⁺、Mn²⁺、Cu²⁺、Zn²⁺The concentration change of (3) was repeated for each set of experiments, the concentration change is shown in table 12 and fig. 12, the heavy metal ion removal effect is shown in fig. 13, the hyphae are used for determining the dry weight, and the dry weight results are shown in table 11.

TABLE 11 Effect of various Metal ions on the growth of Aspergillus sp MF1 at pH5.5

	Biomass (g/L)	Error of the measurement
			Control group	12.4961	1.73％
Experimental group	11.7865	0.21％

As shown in table 11, the growth of the experimental group of aspergillus was less affected than the control group in the presence of various heavy metal ions, and the biomass accounted for 94.32% of the growth in the absence of heavy metal ions.

TABLE 12 Effect of Aspergillus sp MF1 on different concentrations of Metal ions in the coexistence of multiple Metal ions at pH5.5

	Initial concentration (mg/L)	Concentration after treatment (mg/L)	Error of the measurement	Removal Rate (%)
					Fe ³⁺	50	12.15	5.2％	75.70％
Al
	³⁺	50	21.06	2.62％	57.88％
Mn
	²⁺	50	46.08	0.61％	7.84％
Cu
	²⁺	50	15.69	2.34％	68.62％
Zn²⁺						50	34.82	3.21％	30.36％

As is clear from Table 12, FIG. 12 and FIG. 13, the strain of the present invention can effectively remove a plurality of heavy metal ions under the conditions of coexistence of a plurality of heavy metal ions and low pH, and has high removal rates for ferric iron, aluminum and copper ions, wherein the removal rate for ferric iron reaches 75.70%, the removal rate for aluminum ions reaches 57.88%, and the treatment effect for aluminum-containing wastewater under low pH is superior to that of the treatment results of other methods.

According to the embodiments described above, the selected strain is screened from acid mine wastewater in east Anhui, and can not only tolerate low pH, but also effectively remove various heavy metal ions; and the strain is aligned with Cu²⁺The maximum tolerated concentration is 770.18mg/g when Cu²⁺At concentrations of 50mg/L and 100mg/L, Aspergillus MF1 was added to Cu²⁺The removal rate of the catalyst can reach 78.40 percent and 64.47 percent respectively.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of fertilizer industry

<120> aspergillus MF1 for removing heavy metal ions, microbial inoculum and preparation method and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 569

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgcggaagga tcattaccga gtgagggccc tctgggtcca acctccccac ccgtgtctat 60

cgtaccttgt tgcttcggcg ggcccgccgt ttcgacggcc gccggggagg ccttgcgccc 120

ccgggcccgc gcccgccgaa gaccccaaca tgaacgctgt tctgaaagta tgcagtctga 180

gttgattatc gtaatcagtt aaaactttca acaacggatc tcttggttcc ggcatcgatg 240

aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa tcatcgagtc 300

tttgaacgca cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc 360

tgccctcaag cacggcttgt gtgttgggcc cccgtccccc tctcccgggg gacgggcccg 420

aaaggcagcg gcggcaccgc gtccggtcct cgagcgtatg gggctttgtc acctgctctg 480

taggcccggc cggcgccagc cgacacccaa ctttattttt ctaaggttga cctcggatca 540

ggtagggata cccgctgaac ttaagcata 569

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtagtcatat gcttgtctc 19

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcatcacaga cctgttattg cctc 24

Claims

1. Aspergillus sp MF1 for removing heavy metal ions, wherein Aspergillus MF1 has a collection number of GDMCC NO. 61350.

2. An agent characterized in that the active ingredient of the agent comprises the aspergillus MF1 as claimed in claim 1.

3. The microbial inoculum according to claim 2, wherein the number of spores of Aspergillus MF1 per Kg or per L of the microbial inoculum is 8X 10¹⁰And (4) respectively.

4. The method for producing the microbial agent according to claim 2 or 3, comprising: culturing the strain of claim 1 in a mixed manner with a culture medium to obtain the microbial inoculum; the culture medium comprises a nitrogen source and a carbon source; the carbon source comprises glucose and/or sucrose; the nitrogen source comprises yeast and/or peptone.

5. The method according to claim 4, wherein the weight ratio of the carbon source to the nitrogen source is (7.5-15): 1.

6. Use of the microbial inoculum of aspergillus MF1 of claim 1 or the microbial inoculum of claim 2 or 3 or prepared by the preparation method of claim 5 in removing heavy metal ions.

7. Use of an aspergillus MF1 as claimed in claim 1 or a microbial inoculum as claimed in claim 2 or 3 or prepared by the preparation method as claimed in claim 4 or 5 for removing heavy metal ions in water.

8. Use according to claim 7, wherein the water comprises waste water or ground water.

9. Use according to claim 8, wherein the waste water comprises acidic waste water.

10. The use according to claim 9, wherein the pH value of the acidic wastewater is 3.5 or more.