CN113881582A

CN113881582A - Rhodotorula MF4 for removing heavy metal ions, microbial inoculum and application thereof

Info

Publication number: CN113881582A
Application number: CN202111332834.9A
Authority: CN
Inventors: 岳正波; 王进; 王陈; 潘鑫
Original assignee: Hefei University of Technology
Current assignee: Hefei University of Technology
Priority date: 2021-11-11
Filing date: 2021-11-11
Publication date: 2022-01-04

Abstract

The invention relates to the field of environmental protection, in particular to rhodotorula MF4 for removing heavy metal ions, a microbial inoculum and application thereof. The invention provides rhodotorula (Rhodotorula taiwanensis) MF4 for removing heavy metal ions, wherein the preservation number of the rhodotorula MF4 is GDMCC No. 61687. The strain disclosed by the invention can realize the effect of removing various heavy metal ions under the condition of low pH.

Description

Rhodotorula MF4 for removing heavy metal ions, microbial inoculum and application thereof

Technical Field

The invention relates to the field of environmental protection, in particular to rhodotorula MF4 for removing heavy metal ions, a microbial inoculum and application thereof.

Background

In the mining process, sulfide minerals are subjected to a series of physical and chemical reactions such as leaching, oxidation and hydrolysis under the action of air, water and microorganisms to form a pH valueThe low sulfuric acid-sulfuric acid ferric solution, generally 2.5-5.5, can dissolve out various metal ions in the ore, such as Cu²⁺、Zn²⁺、Pb²⁺、Mn²⁺And Cd²⁺And the heavy metal ions have high toxicity, so that not only can water resources be seriously polluted and the yield and the quality of crops be influenced, but also the heavy metal ions are easily enriched and expanded in a biological chain, and finally chronic poisoning is caused by accumulation in certain organs of a human body and the health of human beings is harmed. Therefore, according to the pollution characteristics of acid mine wastewater (AMD), an economical and practical treatment method is sought, the harm of the acid mine wastewater is eliminated, and the sustainability of mineral resource development is ensured, which becomes a problem of wide attention of governments and various social circles.

Among the AMD treatment methods, the microbiological method is a treatment technology applied to wider AMD treatment due to the characteristics of strong applicability, low investment, environmental friendliness, small pollution and the like, and the currently applied microorganisms comprise algae, fungi and bacteria, but the heavy metal ions are mainly removed under a neutral condition or a slightly acidic condition, but the reports of screening the fungus strains for obtaining the heavy metal ion resistance in an extremely acidic environment are relatively limited. In addition, since acidic industrial wastewater, especially acidic mine wastewater, generally contains a plurality of metal ions at the same time, it is necessary to screen out acid-resistant manganese oxidizing bacteria capable of removing a plurality of heavy metals at the same time.

Disclosure of Invention

In order to solve the problems, the invention provides a rhodotorula MF4 strain for removing heavy metal ions, a microbial inoculum and application thereof. The strain disclosed by the invention can realize the effect of removing various heavy metal ions under the condition of low pH.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 for removing heavy metal ions, wherein the preservation number of the Rhodotorula MF4 is GDMCC No. 61687.

The invention provides a microbial inoculum, the effective components of which comprise conidium or thallus of rhodotorula MF 4.

It is preferable thatWhen the effective component of the microbial inoculum is conidium, the spore concentration of the rhodotorula MF4 in the microbial inoculum is 1.1 multiplied by 10⁶～1.7×10⁸Per mL; when the effective component of the microbial inoculum is thallus, the thallus concentration of the rhodotorula MF4 is 10-20 g/L.

The invention provides application of the rhodotorula MF4 or the microbial inoculum in the technical scheme in removing heavy metal ions.

The invention provides application of the rhodotorula MF4 or the microbial inoculum in the technical scheme in removing heavy metal ions in water.

Preferably, the heavy metal ions include Fe³⁺、Al³⁺、Mn²⁺、Cu²⁺And Zn²⁺One or more of them.

Preferably, the water comprises wastewater or groundwater.

Preferably, the wastewater comprises neutral wastewater or acidic wastewater.

Preferably, the acidic wastewater comprises acidic industrial wastewater; the acidic industrial wastewater comprises acidic mine wastewater.

Has the advantages that: the invention provides Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 for removing heavy metal ions, wherein the preservation number of the Rhodotorula MF4 is GDMCC No. 61687. The selected strain is screened from acid mine wastewater in the east of Anhui province, can tolerate low pH and can effectively remove various heavy metal ions. And the strain is in Cu²⁺The growth was not normally observed under the culture conditions at a concentration of 500mg/L, in Mn²⁺Can grow normally under the culture condition with the concentration of 2000mg/L when Mn is added²⁺The strain has Mn pairs at concentrations of 50mg/L and 100mg/L²⁺The removal rate of the catalyst can reach 33.58 percent and 21.1 percent respectively.

Biological preservation Instructions

Rhodotorula taiwanensis MF4 is deposited in Guangdong province microorganism culture collection center, and the deposit address is No. 59 building 5 of Middleyao No. 100 of Middleyao, Guangdong province microorganism research institute, the deposit date is 26/5 of 2021/5, and the deposit number is GDMCC No. 61687.

Drawings

FIG. 1 is a diagram of the colony morphology of Rhodotorula taiwanensis MF 4;

FIG. 2 is a morphological diagram of Rhodotorula taiwanensis MF4 cells;

FIG. 3 is a diagram showing the PCR result of 18SrDNA of Rhodotorula taiwanensis MF4, wherein the left panel shows a feature map and the right panel shows a gel electrophoresis chart of a PCR product of Rhodotorula taiwanensis MF 4;

FIG. 4 is a phylogenetic tree of Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF 4;

FIG. 5 is a graph showing the effect of different pH on the growth of Rhodotorula taiwanensis MF 4;

FIG. 6 is a graph showing the effect of Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 on different metal ion concentrations in the presence of various metal ions at pH 4;

FIG. 7 shows the removal of different metal ions by Rhodotorula taiwanensis MF4 in the presence of various metal ions at pH 4;

FIG. 8 is a graph showing the effect of Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 on different metal ion concentrations at pH 5.5;

FIG. 9 shows the removal of different metal ions by Rhodotorula taiwanensis MF4 in the presence of multiple metal ions at pH 5.5;

FIG. 10 shows Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 for Mn²⁺The removal effect of (3);

FIG. 11 is a graph showing the effect of Rhodotorula taiwanensis MF4 on different metal ion concentrations in a simulated natural mine wastewater environment, in which (a) is a TFe concentration variation graph, and (b) is Al³⁺(c) is Mn²⁺The concentration change chart of (d) is Cu²⁺(e) is Zn²⁺(f) is Cd²⁺A graph of concentration change of (c);

FIG. 12 is a flow chart of an experiment in which AMD is acid mine wastewater.

Detailed Description

The invention provides Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 for removing heavy metal ions, wherein the preservation number of the Rhodotorula MF4 is GDMCC No: 61687.

the physiological properties of the strains of the invention are shown in fig. 1 and 2: the shape of the yeast cell is mostly spherical and oval, which is much larger than that of a single cell individual of bacteria, generally 1-5 μm or 5-20 μm, the yeast has no flagella, can not move, the bacterial colony is large and thick, the surface of the bacterial colony is smooth, moist and sticky, the bacterial colony is easy to pick up, the texture of the bacterial colony is uniform, the colors of the front side, the back side, the edge and the central part are uniform, and the bacterial colony is red. The selected strain is screened from acid mine wastewater in the east of Anhui province, is obtained by screening under an extreme acid condition and can grow under the condition that the pH value is 2 (figure 11), so that the strain can tolerate low pH value and simultaneously remove heavy metal, and has higher removal rate under a neutral condition relatively. The invention carries out molecular biological identification on the strain, and the sequence of 26SrDNA is preferably shown as SEQ ID NO.3, and specifically comprises the following steps: CGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAACGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCTGGGGTGGATAATGGTAGAGAGAAGGTAGCAGTTCCGGCTGTGTTATAGCTCTCTGCTGGATACACCTTGGGGGACTGAGGAACGCAGTGTGCCTTACGGCGGATTTCTCGAGATCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGACCCGTCTT comparison of 26SrDNA of this species at NCBI found 99.88% similarity to Rhodotorula.

And manganese-containing wastewater is adsorbed and treated by saccharomyces cerevisiae (Zhang Kai, Wang Yueshing, Zhang Jian, etc.)]Industrial safety and environmental protection, 2014(10) 13-15.) Saccharomyces cerevisiae at pH3.5 to extremely low concentration of 4mg/L Mn²⁺The removal rate of the strain is only about 50 percent, and the strain has the same pH value of 50mg/L Mn²⁺The removal effect (up to 33.58 percent) is far better than that of the saccharomyces cerevisiae on Mn²⁺The removal effect of (1). Therefore, in Mn²⁺In terms of elimination, the strains of the invention have significant advantages over other strains.

The invention provides a microbial inoculum, the effective component of which comprises conidium or thallus of rhodotorula MF 4. In the invention, when the active ingredient of the microbial inoculum is conidium, the active ingredient in the microbial inoculum is preferably lysis solution, fermentation liquor or spore suspension of rhodotorula MF 4. In the invention, when the active ingredient in the microbial inoculum is preferably lysate, fermentation liquor or spore suspension of rhodotorula glutinis MF4, the spore concentration of the rhodotorula glutinis MF4 in the microbial inoculum is preferably 1.1 × 10⁶～1.7×10⁸one/mL, more preferably 2X 10⁷～4×10⁸one/mL, more preferably 3.2X 10⁸Per mL; when the active ingredients of the microbial inoculum are thalli, the concentration of the rhodotorula MF4 is preferably 10-20 g/L, namely 10-20 g of rhodotorula MF4 thalli are contained in 1L of wastewater, and more preferably 15.21 +/-0.36 g.L^-1That is, 1L of wastewater contained 15.21. + -. 0.36g of Rhodotorula MF4 cells. The geotrichum candidum MF5 in the microbial inoculum can adsorb heavy metals on the surface of the microbial inoculum or secrete active components such as organic acids and the like to be combined with heavy metal ions, and the metal ions are conveyed to cells through a plurality of transport mechanisms, so that the effect of removing the metal ions is achieved. Therefore, the microbial inoculum can effectively remove various heavy metal ions, and has high removal rate.

The strain disclosed by the invention has the advantages of low pH tolerance, high removal rate and low culture cost, and can be used for effectively removing various heavy metal ions, so that the strain and a microbial inoculum containing the strain can be applied to removing the heavy metal ions.

The invention provides application of the rhodotorula MF4 or the microbial inoculum in removing heavy metal ions, and further application in removing heavy metal ions in water, wherein the heavy metal ions comprise Fe³⁺、Al³⁺、Mn²⁺、Cu²⁺And Zn²⁺One ofOr a plurality of the components; the water preferably comprises waste water and ground water; the wastewater comprises preferably neutral wastewater or acidic wastewater; the neutral wastewater preferably comprises heavy metal-containing neutral wastewater discharged in the industrial production processes of mining and metallurgy, mechanical manufacturing, chemical engineering, electronics, instruments and the like, and is further preferably salt wastewater; the acidic wastewater preferably comprises acidic industrial wastewater, more preferably comprises acidic mine wastewater. The acidic mine wastewater disclosed by the invention is preferably the acidic mine wastewater (AMD for short) in an extreme environment formed by exposing sulfide ore stored underground in mine mining, road construction and other large-scale excavation activities and under the combined action of water, oxygen, thiobacillus ferrooxidans and other factors, and has the characteristics of low pH, high-concentration sulfate radical and high-concentration heavy metal ions.

The concentration of chloride ions in the neutral wastewater is preferably 100-3000 mg/L, more preferably 200-2800 mg/L, more preferably 300-2500 mg/L, the concentration of nitrogen and phosphorus is preferably 50-2000 mg/L, more preferably 100-1900 mg/L, more preferably 300-1500 mg/L, the concentration of COD is preferably 1000-8000 mg/L, more preferably 2000-7000 mg/L, more preferably 3000-6000 mg/L.

The pH value of the acidic mine wastewater is preferably 2.5-6.5, more preferably 3-6, and even more preferably 3.5-5.5; the concentration of sulfate radicals in the acid mine wastewater is preferably 500-5000 mg/L, more preferably 1000-4000 mg/L, and even more preferably 2000-3000 mg/L; fe in heavy metal ions in the acid mine wastewater³⁺The concentration of (B) is preferably 5 to 500mg/L, more preferably 10 to 90mg/L, still more preferably 20 to 80mg/L, most preferably 30 to 70mg/L, Al³⁺The concentration of (B) is preferably 5 to 1000mg/L, more preferably 50 to 400mg/L, still more preferably 100 to 350mg/L, most preferably 150 to 300mg/L, Mn²⁺The concentration of (b) is preferably 5 to 1000mg/L, more preferably 50 to 400mg/L, more preferably 100 to 350mg/L, most preferably 150 to 300mg/L, Cu²⁺The concentration of (b) is preferably 5 to 100mg/L, more preferably 10 to 90mg/L, still more preferably 20 to 80mg/L, most preferably 30 to 70mg/L, Zn²⁺The concentration of (b) is preferably 5 to 100mg/L, and further preferablyPreferably 10 to 90mg/L, more preferably 20 to 80mg/L, and most preferably 30 to 70 mg/L.

In order to further illustrate the invention, the following detailed description of the rhodotorula MF4 for removing heavy metal ions, the microbial inoculum, the degradation agent and the application thereof provided by the invention are provided with reference to the drawings and the examples, but the invention is not to be construed as limiting the scope of the invention.

The following tests were carried out according to the test flow chart of fig. 12:

example 1

Enrichment culture of fungi: taking 50mL of acid mine wastewater (pH is 3.67, sulfate radical concentration is 3870mg/L, Fe) from east of Anhui province³⁺Has a concentration of 398.7mg/L and Al³⁺Has a concentration of 912.3mg/L, Mn²⁺Has a concentration of 776.2mg/L, Cu²⁺Has a concentration of 43.9mg/L, Zn²⁺At a concentration of 49.21mg/L) was added, and the mixture was centrifuged at 3000 r.min in a desk top centrifuge^-1And (4) centrifuging at low speed to remove impurities. 1mL of the centrifuged supernatant was inoculated into 50mL of a fermentation broth (3.00 g of sodium nitrate, 1.00g of potassium dihydrogen phosphate, 0.50g of magnesium sulfate, 0.01g of ferrous sulfate, 30.00g of sucrose, 0.10g of chloramphenicol, 1000mL of distilled water), a modified Martin broth (5.00 g of peptone, 2.00g of yeast extract, 20.00g of glucose, 1.00g of potassium dihydrogen phosphate, 0.50g of magnesium sulfate, 0.10g of chloramphenicol, 1000mL of distilled water), and a sand broth (10.00 g of peptone, 40.00g of glucose, 0.10g of chloramphenicol, 1000mL of distilled water), respectively, at 28 ℃ and at a rotation speed of 120r/min^-1Carrying out enrichment culture for 72h under the condition, carrying out subculture for 1 time at intervals of 3d according to the inoculum size of 2% of the volume of the culture medium, carrying out subculture for 2 times for later use, and selecting an improved Martin culture medium with good strain growth for later separation and purification of fungi.

Separation and purification of fungi: before the experiment, Bengal red medium (glucose 10.00g, peptone 5.00g, potassium dihydrogen phosphate 1.00g, magnesium sulfate (MgSO)₄·7H₂O)0.50g, Bengal 0.033g, chloramphenicol 0.10g, agar 20.00g, distilled water 1000mL), potato medium (potato extract powder 10.00g, glucose 20.00g, chloramphenicol 0.10g, agar 13.00g, distilled water 1000mL), petri dish, coating rod, dilution tube, pure water, etc. sterilized at 121 deg.CAnd after 20min of bacteria culture, pouring 25-30 mL of the Bengal culture medium and the potato culture medium into a flat plate respectively in a sterile environment, and cooling for later use. Taking 1mL of the bacterial solution after 3 times of subculture, and placing the bacterial solution in a dilution tube according to l0^-1、10^-2、10^-3、10^-4、10^-5Sequentially diluting the culture solution in gradient, respectively sucking 0.2mL of diluted bacterial solution with different gradients in sterile environment, coating on a Bengal culture medium plate and a potato culture medium plate, performing inverted culture in a constant-temperature incubator at 28 ℃, culturing for 2-3 days until the plates grow colonies visible to naked eyes, and selecting strains with good growth vigor (the concentration gradient is 10)^-3Diluted bacteria) was followed by repeated streaking.

Selecting typical single colonies growing on a Bengal red plate, repeatedly streaking until the shapes of thalli are uniform through microscopic examination, and stopping streaking and separating. Inoculating the obtained pure bacterial colony in a bacteria-preserving tube, preserving in a refrigerator at 4 ℃ as a bacterial strain, and transferring to a refrigerator at-81 ℃ after one day to preserve to obtain the bacterial strain I.

Example 2

Morphological identification: the bacterial strain I obtained in example 1 was observed with a high-power fluorescence microscope for colony, hypha, spore and other structures, and the color, size and shape of the fungus were recorded, and identified with reference to "handbook of fungal identification (Weijing super, 1979) and" Chinese journal of fungi "(Zhang Zhongyi, 2014).

The morphological identification results are shown in fig. 1 and fig. 2: the shape of the yeast cell is mostly spherical and oval, which is much larger than that of a single cell individual of bacteria, generally 1-5 μm or 5-20 μm, the yeast has no flagella, can not move, the bacterial colony is large and thick, the surface of the bacterial colony is smooth, moist and sticky, the bacterial colony is easy to pick up, the texture of the bacterial colony is uniform, the colors of the front side, the back side, the edge and the central part are uniform, and the bacterial colony is red.

Example 3

Molecular biological identification: extracting DNA of the strain I screened in the example 1 according to an Ezup column type fungal genome DNA extraction kit (SK8259) provided by Shanghai bioengineering GmbH, performing PCR amplification on the extracted DNA, wherein the primers are 26SrDNA universal primers NL1(5'-GCATATCAATAAGCGGAGGAAAAG-3', primer F, SEQ ID NO.1), NL4(5'-GGTCCGTGTTTCAAGACGG-3', primer R, SEQ ID NO.2), and the PCR amplification sequence is shown in Table 1; the PCR amplification procedure is shown in Table 2.

TABLE 1 PCR amplification sequences

Reaction components	Volume (μ l)
		10×PCRBuffer
dNTP(each10mM)
		TaqPlusDNAPolymerase(5U/μl)
50mMMgSO₄	Total of 12.5
		Primer F (10mM)	1
Primer R (10mM)	1
		Template(DNA)	1
ddH₂O	9.5
		Total	25

TABLE 2 PCR amplification procedure

Temperature (. degree.C.)	Time	Circulation of
			95	5min
94	30s
			57	30s	30cyc
72	90s
			72	10min

The results of PCR amplification were observed by gel electrophoresis (1% agarose electrophoresis, 150V, 100mA 20min electrophoresis), and the results are shown in FIG. 3, where a band was amplified in the lane, and a pure red yeast strain was screened out.

The PCR product was sequenced by Shanghai bioengineering GmbH, and the sequence of 26SrDNA was: CGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAACGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCTGGGGTGGATAATGGTAGAGAGAAGGTAGCAGTTCCGGCTGTGTTATAGCTCTCTGCTGGATACACCTTGGGGGACTGAGGAACGCAGTGTGCCTTACGGCGGATTTCTCGAGATCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGACCCGTCTT (SEQ ID NO.3)

26SrDNA sequencing result is subjected to blast comparison on NCBI, and the similarity of Rhodotorula Rhodotorula reaches 99.66%. The result of constructing a phylogenetic tree using software MEGA-X is shown in FIG. 4, and a pure red yeast strain was obtained and named Rhodotorula taiwanensis MF 4.

Example 4

Using Rhodotorula taiwanensis MF4 biomass as evaluation index, setting pH gradients of 1.5, 2.5, 3.5, 4.5, 5.5 and 7.0, selecting improved Martin type culture medium, adding 100 μ L Rhodotorula taiwanensis MF4 spore suspension, wherein spore concentration in the spore suspension is 1.2 × 10⁷each/mL, culturing at 28 deg.C for 120r min^-1The culture is carried out for 112h in a constant-temperature shaking incubator, samples are taken every 16h and placed in an ultracentrifuge at low temperature, and the rotating speed is adjusted to 8000 r-min^-1Centrifuging for 5min, discarding supernatant, and determining dry weight of mycelium, the results are shown in Table 3 and FIG. 5.

TABLE 3 Effect of various metal ions coexisting at different pH values on the growth of Rhodotorula taiwanensis MF4

	pH7	pH5.5	pH4.5	pH3.5	pH2.5	pH1.5
							Time (h)	Dry weight (g/L)	Dry weight (g/L)	Dry weight (g/L)	Dry weight (g/L)	Dry weight (g/L)	Dry weight (g/L)
0	0.06545	0.053	0.03333	0.04444	0.02778	0.04
							16	0.06807	0.093	0.45556	0.37778	0.18333	0.06
32	2.94	3.82255	1.96444	1.75556	0.23	0.05
							48	5.90291	5.59	4.15556	3.71111	0.74	0.07
64	7.97018	7.65	5.76667	5.23333	0.99	0.08
							80	10.76073	8.532	8.321	7.11111	1.05	0.06
96	11.57745	10.567	9.39	8.923	2.19	0.05
							112	11.28	10.545	9.372	8.899	2.15	0.07

As is clear from Table 3 and FIG. 5, the strain grew normally at a pH of 3.5 to 7.0; under the condition of pH being 2.5, the strain can grow, but the growth amount is low; under the condition that the pH value is 1.5, the strain can grow abnormally, which shows that the strain can resist the pH value of 2.5-7.0, and the biomass is reduced along with the reduction of the pH value.

Example 5

Addition of Fe to modified Martin Medium pH4³⁺、Al³⁺、Mn²⁺、Cu²⁺、Zn²⁺Obtaining a stock solution conditioning medium, wherein the stock solution conditioning medium contains Fe³⁺Has a concentration of 100 mg.L^-1，Al³⁺Has a concentration of 500 mg.L^-1，Mn² ⁺Has a concentration of 500 mg.L^-1，Cu²⁺Has a concentration of 100 mg.L^-1，Zn²⁺Has a concentration of 100 mg.L^-1Adding 100 μ L spore suspension of Rhodotorula taiwanensis MF4, wherein the spore concentration in the spore suspension is 1.52 × 10⁶Marking the number of the cells per mL as an experimental group; to the direction ofAdding 100 μ L spore suspension of Rhodotorula taiwanensis MF4 into modified Martin medium with pH of 4, wherein the spore concentration in the spore suspension is 1.42 × 10⁶one/mL, marked as control group;

the experimental group and the control group were respectively cultured at 28 deg.C and 120r min^-1The culture is continuously carried out for 112h in a constant-temperature shaking incubator, the sample is placed in a super-speed low-temperature centrifuge after being sampled, and the rotating speed is adjusted to 8000 r-min^-1Centrifuging for 5min, and collecting supernatant for determining Fe³⁺、Al³⁺、Mn²⁺、Cu²⁺、Zn²⁺The concentration change results are shown in table 5 and fig. 6, the heavy metal ion removal rates are shown in table 5 and fig. 7, the hyphae are used for determining the dry weight, and the dry weight results are shown in table 4.

TABLE 4 Effect of various Metal ions on the growth of Rhodotorula taiwanensis MF4 in the coexistence of various Metal ions at pH4

	Biomass (g/L)	Error of the measurement
			Control group	9.2563	1.75％
Experimental group	8.7832	1.56％

As shown in table 4, the strain of the present invention can grow normally under the condition of low pH when a plurality of heavy metal ions are mixed, and the biomass is not much different from that under the condition of no heavy metal, and is 94.89% under the condition of no heavy metal.

TABLE 5 influence of Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 on the concentration of various metal ions and removal rate in the coexistence of various metal ions at pH4

	Initial concentration (mg/L)	Concentration after treatment (mg/L)	Error of the measurement	Removal Rate (%)
					Fe ³⁺	100	28.989	1.3％	71.01％
Al
	³⁺	500	281.4167	0.66％	43.72％
Mn
	²⁺	500	433.8	2.16％	13.24％
Cu
	²⁺	100	62.58	0.64％	37.42％
Zn
	²⁺	100	77.76	10.01％	22.24％

As is clear from Table 5, FIG. 6 and FIG. 7, the strain of the present invention can effectively remove a plurality of heavy metal ions, particularly Fe, under low pH conditions in which a plurality of heavy metal ions coexist³⁺The removal rate can reach 71.01%, and Al is the second factor³⁺The removal rate can reach 43.72 percent compared with Al treated at other low pH values³⁺The strain has obviously better removal effect in the method of waste water.

Example 6

Addition of Fe to modified Martin Medium pH5.5³⁺、Al³⁺、Mn²⁺、Cu²⁺、Zn²⁺Stock solution conditioned media, wherein the stock solution conditioned media contains Fe³⁺Has a concentration of 50 mg.L^-1，Al³⁺Has a concentration of 50 mg.L^-1，Mn²⁺Has a concentration of 50 mg.L^-1，Cu²⁺Has a concentration of 50 mg.L^-1，Zn²⁺Has a concentration of 50 mg.L^-1Adding 100 μ L spore suspension of Rhodotorula taiwanensis MF4, wherein the spore concentration in the spore suspension is 1.56 × 10⁶Marking the number of the cells per mL as an experimental group; adding into improved Martin culture medium with pH of 5.5100 μ L of spore suspension of Rhodotorula taiwanensis MF4, wherein the spore concentration in the spore suspension is 1.56X 10⁶one/mL, marked as control group;

the experimental group and the control group were respectively cultured at 28 deg.C and 120r min^-1The culture is continuously carried out for 112h in a constant-temperature shaking incubator, the sample is placed in a super-speed low-temperature centrifuge after being sampled, and the rotating speed is adjusted to 8000 r-min^-1Centrifuging for 5min, and reserving supernatant for measuring Fe in solution³⁺、Al³⁺、Mn²⁺、Cu²⁺、Zn²⁺The concentration change of (3) was repeated for each set of experiments, the concentration change is shown in table 7 and fig. 8, the removal rate of heavy metal ions is shown in table 7 and fig. 9, the hyphae were used to measure the dry weight, and the dry weight results are shown in table 6.

TABLE 6 Effect of various Metal ions on the growth of Rhodotorula taiwanensis MF4 in the coexistence of various Metal ions at pH5.5

	Biomass (g/L)	Error of the measurement
			Control group	10.7721	3.01％
Experimental group	10.0935	0.98％

As shown in Table 6, the strain of the present invention can grow normally under the condition of low pH when a plurality of heavy metal ions are mixed, and the biomass is not much different from that under the condition of no heavy metal, and is 93.70% under the condition of no heavy metal.

TABLE 7 influence of Rhodotorula taiwanensis MF4 on the concentration of various metal ions and removal rate in the coexistence of various metal ions at pH5.5

As is clear from tables 7, 8 and 9, the strain of the present invention can effectively remove various heavy metal ions, especially Fe, under the condition that various heavy metal ions coexist and the pH is low³⁺And Al³⁺The removal rate can reach 52.85 percent, and for Al³⁺The removal rate of the aluminum alloy can also reach 40.05 percent compared with the Al treated under other low pH values³⁺The method for removing the wastewater by using the strain has obviously better removal effect and can also remove low-concentration Cu²⁺The removal effect is good, and the removal rate can reach 49.88% at 50 mg/L.

Example 7

Separately, Mn was added to the modified Martin medium at pH3.5²⁺The stock solution (preparation process comprises accurately weighing 92.1818g manganese sulfate monohydrate, adding about 600mL deionized water for dissolving, transferring to a 1L volumetric flask, adding deionized water to constant volume to scale mark, shaking to obtain Mn 30000mg/L²⁺Stock solution, ready for use) to Mn in the medium²⁺The concentration is 50, 100, 300, 500, 1000, 2000mg/L, and 100 μ L spore suspension of Rhodotorula taiwanensis MF4 is added, wherein the spore suspension concentration is 1.2 × 10⁷Culturing at 28 deg.C and 120r/min for 112 h/mL, adjusting pH to 3.5, sampling, placing in ultracentrifuge at 8000 r/min^-1Centrifuging for 5min, and performing flame atomic absorption spectrometry (AA 240 FS)VAR- -IAN, USA) for Mn²⁺Concentration, which was repeated 3 times per set of experiments, was varied as shown in Table 9, the removal rate of heavy metal ions was as shown in Table 9 and FIG. 10, the mycelia were used for the determination of dry weight, and the results of dry weight are as shown in Table 8.

TABLE 8 Mn at various concentrations at pH3.5²⁺Effect on growth of Rhodotorula taiwanensis MF4

	Biomass (g/L)	Error of the measurement
			Concentration of manganese ion: 50mg/L	10.9682	4.11％
Concentration of manganese ion: 100mg/L	10.7412	1.78％
			Concentration of manganese ion: 300mg/L	10.2312	2.39％
Concentration of manganese ion: 500mg/L	9.7286	4.91％
			Concentration of manganese ion: 1000mg/L	9.3721	3.56％
Concentration of manganese ion: 2000mg/L	8.4032	4.21％

As is clear from Table 8, the strain of the present invention was found to be at low pH even when Mn is present²⁺Can grow normally when the biomass reaches 2000mg/L, under the condition, the biomass can reach 76.64 percent under the normal growth condition, and the biomass of the strain can be changed along with Mn²⁺The concentration increases and decreases.

TABLE 9 Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 at pH3.5 for various concentrations of Mn²⁺Concentration impact and removal rate

As is clear from Table 9 and FIG. 10, the strain of the present invention exhibited low Mn concentrations at low pH²⁺Good removal effect and high Mn concentration²⁺Also has good tolerance in Mn²⁺When the concentration reaches 50mg/L, the removal rate can reach 33.58%, but the removal rate gradually decreases with the increase of the concentration of Mn2 +.

Example 8

To investigate the actual effect of acid-resistant Rhodotorula taiwanensis MF4 on mine wastewater, 60L of mine wastewater (the heavy metal content of acid mine wastewater is shown in Table 10) from east Anhui was placed in a vertical reactor with a volume of 70L, 400g of glucose, 100g of peptone and 40g of yeast extract powder were added to the reactor on the basis of a modified Martin medium, and 500mL of 15.21 + -0.36 g.L-extract powder was inoculated^-1Rhodotorula taiwanensis MF4 cells, Rhodotorula (Rhodotorula taiwanensis) was addedRhodotorula taiwanensis) MF4 bacteria, so that 15.21 +/-0.36 g of Rhodotorula (Rhodotorula taiwanensis) MF4 bacteria are contained in 1L of wastewater, thereby simulating the growth and repair effects of fungi in the natural mine wastewater environment state, and designing a blank control group (namely adding 500mL of deionized water without adding a microbial inoculum) in an experiment. The change conditions of indexes such as a plurality of heavy metals are sampled and monitored at a position 30cm below the liquid level of the reactor regularly, and the change of the concentration of the heavy metals is shown in figure 11.

TABLE 10 heavy metal content of acidic mine wastewater

Index (I)	Unit of	Parameter(s)
			pH	-	3.67
TFe (Total iron)	mg·L^-1	432.12
			Mn	mg·L^-1	776.2
Cu	mg·L^-1	43.9
			Zn	mg·L^-1	49.21
Cd	mg·L^-1	0.27
			Al	mg·L^-1	912.3

TABLE 11 Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 comparison of TFe and Al in a state simulating a natural mine wastewater environment³⁺And Mn²⁺Influence of Metal ion concentration

TABLE 12 Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 for Cu in simulated natural mine wastewater environment²⁺、Zn²⁺And Cd²⁺Influence of Metal ion concentration

As shown in fig. 11, the concentrations of the metal ions in the experimental group were decreased to different degrees compared to the blank control group, wherein the total iron removal rate reached 80.20% after 248 days, and Al content was increased³⁺The removal rate reaches 46.64 percent, and Mn²⁺The removal rate reaches 10.62 percent, and Cu²⁺The removal rate reaches 65.01 percent, and Zn²⁺The removal rate reaches 88.45 percent, and Cd²⁺The removal rate reaches 99.11 percent, which shows that Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 still has great bioremediation potential even in acid mine wastewater containing various heavy metal ions.

The embodiments described above show that the selected strain of the invention is screened from acid mine wastewater in east of Anhui province, and can effectively remove various heavy metal ions while tolerating low pH. And the strain is in Cu²⁺The growth was not normally observed under the culture conditions at a concentration of 500mg/L, in Mn²⁺Can grow normally under the culture condition with the concentration of 2000mg/L when Mn is added²⁺The strain has Mn pairs at concentrations of 50mg/L and 100mg/L²⁺The removal rate of the catalyst can reach 33.58 percent and 21.1 percent respectively.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of fertilizer industry

<120> rhodotorula MF4 for removing heavy metal ions, microbial inoculum and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcatatcaat aagcggagga aaag 24

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggtccgtgtt tcaagacgg 19

<210> 3

<211> 589

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggaggaaaa gaaactaaca aggattcccc tagtagcggc gagcgaagcg ggaagagctc 60

aaatttataa tctggcacct tcggtgtccg agttgtaatc tctagaagtg ttttccgcgt 120

tggaccgcac acaagtctgt tggaatacag cggcatagtg gtgagacccc cgtatatggt 180

gcggacgccc aacgctttgt gatacacttt cgaagagtcg agttgtttgg gaatgcagct 240

caaattgggt ggtaaattcc atctaaagct aaatattggc gagagaccga tagcgaacaa 300

gtaccgtgag ggaaagatga aaagcacttt ggaaagagag ttaacagtac gtgaaattgt 360

tggaagggaa acgcttgaag tcagacttgc ttgccgagca atcggtttgc aggccagcat 420

cagttttctg gggtggataa tggtagagag aaggtagcag ttccggctgt gttatagctc 480

tctgctggat acaccttggg ggactgagga acgcagtgtg ccttacggcg gatttctcga 540

gatcttcaca cttaggatgc tggtggaatg gctttaaacg acccgtctt 589

Claims

1. Rhodotorula taiwanensis (Rhodotorula taiwanensis) MF4 for removing heavy metal ions is characterized in that the preservation number of Rhodotorula MF4 is GDMCC No. 61687.

2. A microbial inoculum, characterized in that the effective component of the microbial inoculum comprises conidium or thallus of rhodotorula glutinis MF4 as claimed in claim 1.

3. The microbial inoculum according to claim 2, wherein when the effective component of the microbial inoculum is conidium, the spore concentration of rhodotorula rubra MF4 in the microbial inoculum is 1.1 x 10⁶～1.7×10⁸Per mL; when the effective component of the microbial inoculum is thallus, the red yeastThe bacterial concentration of the mother MF4 is 10-20 g/L.

4. Use of Rhodotorula glutinis MF4 as claimed in claim 1 or microbial inoculum as claimed in claim 2 or 3 for removing heavy metal ions.

5. Use of Rhodotorula glutinis MF4 as claimed in claim 1 or microbial inoculum as claimed in claim 2 or 3 for removing heavy metal ions in water.

6. Use according to claim 5, wherein the heavy metal ions comprise Fe³⁺、Al³⁺、Mn²⁺、Cu²⁺And Zn²⁺One or more of them.

7. Use according to claim 5, wherein the water comprises waste water or ground water.

8. Use according to claim 7, wherein the waste water comprises neutral waste water or acidic waste water.

9. The use according to claim 8, wherein the acidic wastewater comprises acidic industrial wastewater; the acidic industrial wastewater comprises acidic mine wastewater.