CN114376996A

CN114376996A - Application of honokiol in preparation of medicine for treating porcine hemagglutinating encephalomyelitis virus infection

Info

Publication number: CN114376996A
Application number: CN202210036347.6A
Authority: CN
Inventors: 兰云刚; 贺文琦; 曹泽昭; 陆慧君; 王炳量; 赵越; 王改丽; 宋斯伟; 高丰
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2022-01-13
Filing date: 2022-01-13
Publication date: 2022-04-22
Anticipated expiration: 2042-01-13
Also published as: CN114376996B

Abstract

The invention relates to an application of honokiol in preparation of a medicament for treating swine hemagglutinating encephalomyelitis virus infection, belonging to the technical field of medicines. The results of researches on in vitro pig hemagglutinating encephalomyelitis virus infected cell models and in vivo pig hemagglutinating encephalomyelitis virus infected mouse model experiments show that honokiol can directly inhibit the replication of pig hemagglutinating encephalomyelitis virus at the gene and protein level in vitro and in vivo, reduce the virus titer, prove that honokiol has obvious effect of resisting the pig hemagglutinating encephalomyelitis virus, can be used for preparing a new medicament for resisting the pig hemagglutinating encephalomyelitis virus infection, and has important significance for the confirmation of a medicament target.

Description

Application of honokiol in preparation of medicine for treating porcine hemagglutinating encephalomyelitis virus infection

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to application of honokiol in preparation of a medicine for treating swine hemagglutinating encephalomyelitis virus infection.

Background

Honokiol is a biphenol compound present in dried bark, root bark and branch bark of Magnolia officinalis and Magnolia obovata Thunb of Magnoliaceae. Honokiol is one of main drug effect components in magnolia officinalis, has various pharmacological actions and has obvious action effects in the aspects of resisting tumors, protecting cardiovascular system, protecting nervous system and the like. However, no report of honokiol for treating Porcine Hemagglutinating Encephalomyelitis Virus (PHEV) infection is seen at home and abroad at present.

Porcine hemagglutinating encephalomyelitis disease is an acute and contact infectious disease of pigs caused by porcine hemagglutinating encephalomyelitis virus infection. After the piglet fed with the feed is infected with the hemagglutinating encephalomyelitis virus within 3 weeks, the piglet fed with the feed presents obvious neurological symptoms and causes non-suppurative encephalomyelitis, and the death rate can reach 100 percent. The porcine hemagglutinating encephalomyelitis virus is widely distributed in the world, the reports of the infection of the pig group with the disease are on the rising trend year by year, and the porcine hemagglutinating encephalomyelitis virus attracts high attention to people for the lethal infection of piglets; however, no specific therapeutic drug exists for the disease, so that a novel drug for resisting the porcine hemagglutinating encephalomyelitis virus infection is urgently required to be searched. The invention discovers for the first time that honokiol has the function of resisting the infection of the porcine hemagglutinating encephalomyelitis virus in vivo and in vitro.

Disclosure of Invention

The invention provides an application of honokiol in preparing a medicament for treating porcine hemagglutinating encephalomyelitis virus infection.

Furthermore, the preparation of the medicament for treating the pig hemagglutinating encephalomyelitis virus infection is injection, capsule, tablet or powder injection.

Compared with the prior art, the invention has the beneficial effects that:

the application of honokiol in preparing the medicament for treating the porcine hemagglutinating encephalomyelitis virus infection shows that the honokiol can directly inhibit the replication of the porcine hemagglutinating encephalomyelitis virus in the gene and protein expression level in vitro and in vivo through the research of an in vitro porcine hemagglutinating encephalomyelitis virus infected cell model and an in vivo porcine hemagglutinating encephalomyelitis virus infected mouse model test, reduces the virus titer, proves that the honokiol has the obvious effect of resisting the porcine hemagglutinating encephalomyelitis virus, can be used for preparing the development of a new medicament for resisting the porcine hemagglutinating encephalomyelitis virus infection, and has important significance for the confirmation of a medicament target.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

Figure 1 is a graph of the effect of honokiol solutions of different concentrations on cell viability.

FIG. 2 shows the results of a 12h experiment in which a solution of honokiol was added to N2a cells, and then a PHEV was inoculated and incubated for 12h, where A is the protein expression level of the PHEV, B is the protein expression level analysis of the PHEV, and C is the mRNA expression level of the PHEV.

FIG. 3 shows the results of a 24h incubation test in which honokiol solution and PHEV were added simultaneously to N2a cells, where A is the protein expression level of PHEV, B is the statistical analysis of the protein expression level of PHEV, and C is the statistical analysis of the mRNA expression level of PHEV.

FIG. 4 shows the results of incubation for 12h with PHEV inoculated in N2a cells, followed by incubation for 12h with honokiol solution, where A is the protein expression level of PHEV, B is the statistical analysis of the protein expression level of PHEV, and C is the statistical analysis of the mRNA expression level of PHEV.

FIG. 5 is the in vivo daily average body weight change curves of mice in 14 days of the blank control group, the DMSO control group, the inoculation group and the honokiol inoculation group.

In FIG. 6, A is the protein expression level of PHEV in the virus-inoculated group and the honokiol virus-inoculated group, and B is the statistical analysis of the protein expression level of PHEV.

FIG. 7 is a statistical analysis of PHEV mRNA expression levels in the vaccinated and honokiol vaccinated groups.

Detailed Description

For a further understanding of the invention, reference will now be made to the preferred embodiments of the invention, but it is to be understood that the description is intended to illustrate further features and advantages of the invention, and not to limit the scope of the claims.

The porcine hemagglutinating encephalomyelitis virus infection of the present invention refers to viral infection caused by coronavirus genus, wherein the viral infection refers to infection caused by porcine hemagglutinating encephalomyelitis virus.

The molecular formula of the honokiol is C₁₈H₁₈O₂Relative molecular mass 266.33, structural formula as follows:

the dosage form of the medicament for treating the porcine hemagglutinating encephalomyelitis virus infection is not particularly limited, and is preferably injection, capsule, tablet or powder injection.

The terms used in the present invention generally have meanings commonly understood by those of ordinary skill in the art, unless otherwise specified. In order to make those skilled in the art better understand the technical solution of the present invention, the present invention will be further described in detail with reference to the following embodiments.

In the following examples, various procedures and methods not described in detail are conventional methods well known in the art. Materials, reagents, devices, instruments, apparatuses and the like used in the following examples are commercially available unless otherwise specified.

The present invention is further illustrated by the following examples.

Example 1

Test for in vitro anti-porcine hemagglutinating encephalomyelitis virus effect of honokiol

1.1 dissolution and storage of Honokiol (HNK)

25mg of honokiol was weighed out and dissolved in 100. mu.L of dimethyl sulfoxide (DMSO) solution as a stock solution, and stored at 4 ℃.

1.2 culture of mouse neuroma blast (N2a cell)

N2a cells were cultured using DMEM containing 6 wt% serum and 1 wt% diabody (penicillin and streptomycin).

1.3 Effect of honokiol on the viability of N2a cells

Culturing N2a cells in a 96-well plate culture dish, and preparing honokiol into solutions with different concentrations of 10 muM/L, 15 muM/L, 20 muM/L, 25 muM/L and 30 muM/L when the concentration of the honokiol is 70-80%. The N2a cells were incubated for 24h with different concentrations of solutions, and the effect of different concentrations of honokiol solutions on cell viability was determined by the CCK-8 method, and the results are shown in FIG. 1.

As can be seen from FIG. 1, the honokiol solution has no obvious influence on the vitality of N2a cells at 10-25. mu.M/L, and the vitality of the cells is obviously reduced at 30. mu.M/L, so that the honokiol solution at 25. mu.M/L is selected to detect the influence of the honokiol on the PHEV infection in the subsequent in vitro experiments.

1.4 prevention and treatment effects of Honokiol on PHEV infection

The honokiol in-vitro anti-PHEV test respectively establishes prevention, direct virus killing and treatment modes. The three modes are used for respectively extracting RNA and protein in cells to carry out RT-qPCR and western blot tests, and detecting the mRNA expression level of the PHEV and the change of the protein expression level of the PHEV.

1.4.1 RT-qPCR test detection method

Inoculating N2a cells into a six-hole plate, and performing virus inoculation or drug addition treatment according to the requirements of different modes when the cells are expanded to 70-80%. After incubation, extracting total RNA in the cell, and detecting the mRNA expression level of PHEV in the cell.

Method for extracting total RNA (RNA extraction and reverse transcription) in cells: after incubation, the six-well plate was removed from the cell incubator and washed three times with PBS. 1ml of RNAioso PLUS per well was added according to the RNAioso PLUS instructions and subsequent experiments were performed as described. After RNA is mentioned, reverse transcription is carried out according to the M-MLV reverse transcriptase instructions. And (3) performing real-time fluorescence PCR detection by using the reverse transcribed cDNA as a template. The cDNA amplification reaction system is 20 μ l: mu.l SYBRGreen Mix, 1. mu.l forward primer, 1. mu.l reverse primer, 6. mu.l RNase-free water, 2. mu.l DNA template. (PHEV forward primer: TCTGGGAATCCTGACGAG; PHEV reverse primer: AGGCGCTGCAACACTTAC; GARDH forward primer: CTCAACTACATGGTCTACATGTTC; GAPDH reverse primer: ATTTGATGTTAGTGGGGTCTCGCTC)

The detection procedure comprises the following steps: 3min at 95 ℃; 10s at 95 ℃; 30s at 60 ℃ for 40 cycles; 10min at 72 ℃.

The housekeeping gene GAPDH was used as a control, and 2 was used^﹣△△CTAnalysis of PHEV for changes in mRNA transcript levels.

Detection method of 1.4.2 western blot test

Inoculating N2a cells into a six-hole plate, and performing virus inoculation or drug addition treatment according to the requirements of different modes when the cells are expanded to 70-80%. And after the incubation is finished, extracting protein in the cell, and detecting the protein expression level of PHEV in the cell.

The method for extracting the intracellular protein comprises the following steps: after incubation, the six-well plate was removed from the cell incubator and washed three times with PBS. Mu.l of protein lysate (RIPA Lysis Buffer) and protein inhibitor (PMSF) at a volume ratio of 100:1 were added to each well, incubated on ice for 15min, and the cells were scraped off with a spatula and incubated for another 15 min. Centrifuging at 12000Xg for 10min, sucking supernatant, adding 5 Xloading buffer solution (the volume ratio of the supernatant to the buffer solution is 4:1), and boiling in boiling water for 10 min. SDS-PAGE protein samples are separated, transferred to a PVDF membrane, incubated with a primary antibody and a secondary antibody in sequence, and finally ECL color development is carried out. The concentration of polyclonal antibody against PHEV was (1:800) and the concentration of horseradish peroxidase-labeled secondary antibody (goat anti-mouse) was (1: 10000).

1.4.3 different mode requirements

The prevention mode refers to: after adding honokiol solution into N2a cells for 12h, inoculating PHEV and incubating for 12h, the test result is shown in FIG. 2.

The direct virus killing mode refers to: the test results are shown in fig. 3, wherein honokiol solution and PHEV are added into N2a cells at the same time, and incubated for 24 h.

The treatment mode refers to: the test results are shown in fig. 4, where PHEV is inoculated into N2a cells for 12h, and then honokiol solution is added for 12 h.

Wherein, the TCID of the virus strain PHEV-CC14(Genebank serial number: MF083115.1)₅₀Value of 10^-4.8mu.L, adding 70 mu.l of virus solution into each hole; the concentration of the honokiol solution is 25 mu M/L, and 2ml of honokiol solution is added into each hole.

From the results of fig. 2, fig. 3, and fig. 4, it can be seen that the 25 μ M/L honokiol solution can significantly reduce the mRNA and protein of PHEV compared to the control group in all three patterns, and has a statistically significant difference. Through the test results, it can be determined that honokiol can obviously inhibit the replication of PHEV in vitro experiments.

Example 2

Experimental therapeutic study on porcine hemagglutinating encephalomyelitis virus infected mice

2.1 preparation of honokiol solution: the 1.1 medium honokiol stock solution of example 1 was dissolved in purified water and the gavage dose of the mice was 25mg/kg (200. mu.L).

2.2 Experimental groups

The test mice are divided into four groups by using C57 with the age of 4 weeks, wherein the four groups are respectively a blank control group (WT), a DMSO control group (DMSO), a virus inoculation group (PHEV) and a honokiol virus inoculation group (P + HNK), each group comprises ten mice, and the test period is 14 days; mice in PHEV and P + HNK groups were each nasally inoculated with 50. mu.l of virus fluid (TCID)₅₀Value of 10^-4.8100 μ L); the P + HNK group mice were fed with 25mg/kg (200. mu.L) of honokiol per day within 14 days; the mice in the WT group and the PHEV group are gazed with 200 mu L of purified water every day within 14 days; DMSO group mice within 14 daysGavage contained a dose of DMSO of purified water (200 μ Ι _ with P + HNK). At 14 days, the brain tissues of the mice in the group of PHEV and P + HNK are taken, and the mRNA and protein contents of the PHEV in the brain tissues are detected by using an RT-qPCR and western blot test method.

2.2 detection method

The detection method of the RT-PCR test comprises the following steps: 0.1g brain tissue was added to 1ml of RNAioso PLUS, and the rest was the same as 1.4.1 of example 1.

The detection method of the western blot test comprises the following steps: 0.1g of brain tissue was added 1ml of protein lysate and protein inhibitor (100: 1), and the rest was the same as 1.4.2 of example 1.

The average daily body weight change in the mice over 14 days is shown in FIG. 5. As can be seen from the results in fig. 5, the body weights of the mice in the blank control group and the DMSO control group continuously increased and the body weights of the mice in the vaccinated group and the honokiol vaccinated group continuously decreased within 14 days, but the body weight decrease of the honokiol vaccinated group was less than that of the vaccinated group.

The mRNA expression level changes of PHEVs in the vaccinated group and the honokiol vaccinated group are shown in fig. 6, and the protein expression level changes are shown in fig. 7. As can be seen from the results of fig. 6 and 7, the mRNA expression level and the protein expression level of PHEV were significantly reduced in the honokiol virus-inoculated group compared to the virus-inoculated group, and were statistically significantly different. Through the test results, it can be determined that honokiol can obviously inhibit the replication of PHEV and can play a better prevention and treatment effect in-vivo experiments

It should be understood that the above embodiments are only examples for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither necessary nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the spirit or scope of the invention.

Claims

1. Application of honokiol in preparing medicine for treating pig hemagglutinating encephalomyelitis virus infection is provided.

2. The application of honokiol according to claim 1 in preparing a medicament for treating swine hemagglutinating encephalomyelitis virus infection, wherein the medicament for treating swine hemagglutinating encephalomyelitis virus infection is in the form of injection, capsule, tablet or powder injection.