CN114376996B - Application of honokiol in preparation of medicines for treating porcine hemagglutinating encephalomyelitis virus infection - Google Patents
Application of honokiol in preparation of medicines for treating porcine hemagglutinating encephalomyelitis virus infection Download PDFInfo
- Publication number
- CN114376996B CN114376996B CN202210036347.6A CN202210036347A CN114376996B CN 114376996 B CN114376996 B CN 114376996B CN 202210036347 A CN202210036347 A CN 202210036347A CN 114376996 B CN114376996 B CN 114376996B
- Authority
- CN
- China
- Prior art keywords
- honokiol
- encephalomyelitis virus
- hemagglutinating encephalomyelitis
- phev
- virus infection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
- A61K31/05—Phenols
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Virology (AREA)
- Public Health (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Oncology (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to application of honokiol in preparing a medicament for treating porcine hemagglutinating encephalomyelitis virus infection, and belongs to the technical field of medicines. According to the invention, the in-vitro pig hemagglutinating encephalomyelitis virus infection cell model and in-vivo pig hemagglutinating encephalomyelitis virus infection mouse model test are studied, and the results show that honokiol can directly inhibit the replication of pig hemagglutinating encephalomyelitis virus on the gene and protein levels in vitro and in vivo, so that the virus titer is reduced, and the honokiol has obvious effect of resisting the pig hemagglutinating encephalomyelitis virus, can be used for preparing new medicines for resisting the pig hemagglutinating encephalomyelitis virus infection, and has important significance for confirming drug targets.
Description
Technical Field
The invention belongs to the technical field of medicines, and particularly relates to application of honokiol in preparation of a medicine for treating porcine hemagglutinating encephalomyelitis virus infection.
Background
Honokiol is a biphenol compound existing in dried bark, root bark and branch bark of Magnolia officinalis and Magnolia officinalis of Magnoliaceae. Honokiol is one of main medicinal components in magnolia officinalis, has various pharmacological effects, and has remarkable effects in resisting tumor, protecting cardiovascular and protecting nervous system. However, no report of honokiol for treating the infection of the porcine hemagglutinating encephalomyelitis virus (Porcine hemagglutinating encephalomyelitis virus, PHEV) is found at home and abroad at present.
Porcine hemagglutinating encephalomyelitis is an acute, contagious disease in pigs caused by infection with porcine hemagglutinating encephalomyelitis virus. The piglet with the age of 3 weeks shows obvious neurological symptoms after being infected by the porcine hemagglutinating encephalomyelitis virus, and causes non-suppurative encephalomyelitis, and the death rate can reach 100 percent. Pig hemagglutinating encephalomyelitis viruses are widely distributed worldwide, and reports of pig herd infection of the diseases are in an ascending trend year by year, so that the pig hemagglutinating encephalomyelitis viruses are highly concerned for the fatal infection of piglets; however, no specific therapeutic drug is available for the disease, so that a novel drug for resisting the porcine hemagglutinating encephalomyelitis virus infection is urgently required to be sought. The invention discovers that honokiol has the effect of resisting the porcine hemagglutinating encephalomyelitis virus infection in vivo and in vitro for the first time.
Disclosure of Invention
The invention provides an application of honokiol in preparing a medicine for treating porcine hemagglutinating encephalomyelitis virus infection.
Furthermore, the preparation formulation of the drug for treating the porcine hemagglutinating encephalomyelitis virus infection is injection, capsule, tablet or powder injection.
Compared with the prior art, the invention has the beneficial effects that:
the application of honokiol in preparing the medicines for treating the porcine hemagglutinating encephalomyelitis virus infection is researched by an in vitro porcine hemagglutinating encephalomyelitis virus infection cell model and an in vivo porcine hemagglutinating encephalomyelitis virus infection mouse model test, and the results show that honokiol can directly inhibit replication of the porcine hemagglutinating encephalomyelitis virus on gene and protein expression levels in vitro and in vivo, reduce virus titer, prove that honokiol has obvious effect of resisting the porcine hemagglutinating encephalomyelitis virus, can be used for preparing new medicines for resisting the porcine hemagglutinating encephalomyelitis virus infection, and has important significance for confirmation of medicine targets.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a graph showing the effect of varying concentrations of honokiol solution on cell viability.
FIG. 2 shows the results of a test in which a honokiol solution was added to N2a cells for 12 hours, followed by incubation with PHEV for 12 hours, wherein A is the protein expression level of PHEV, B is the analysis of the protein expression level of PHEV, and C is the mRNA expression level of PHEV.
FIG. 3 shows the results of a 24-hour incubation test with a honokiol solution and PHEV added to N2a cells, wherein A is the protein expression level of PHEV, B is a statistical analysis of the protein expression level of PHEV, and C is a statistical analysis of the mRNA expression level of PHEV.
FIG. 4 shows the results of a test in which N2a cells were first incubated with PHEV for 12 hours, then incubated with magnolol solution for 12 hours, wherein A is the protein expression level of PHEV, B is a statistical analysis of the protein expression level of PHEV, and C is a statistical analysis of the mRNA expression level of PHEV.
FIG. 5 is a graph showing the daily average body weight change in mice in the blank control group, DMSO control group, toxin-receiving group and honokiol toxin-receiving group for 14 days.
In FIG. 6, A is the protein expression level of PHEV in the toxin-receiving group and the honokiol toxin-receiving group, and B is the statistical analysis of the protein expression level of PHEV.
FIG. 7 is a statistical analysis of the mRNA expression levels of PHEV in the toxin-receiving group and the honokiol toxin-receiving group.
Detailed Description
For a further understanding of the present invention, preferred embodiments of the invention are described below, but it is to be understood that these descriptions are merely intended to illustrate further features and advantages of the invention, and are not limiting of the claims of the invention.
The invention provides an application of honokiol in preparing a medicine for treating porcine hemagglutinating encephalomyelitis virus infection.
The porcine hemagglutinating encephalomyelitis virus infection refers to viral infection caused by coronavirus, wherein the viral infection refers to infection caused by porcine hemagglutinating encephalomyelitis virus.
The molecular formula of honokiol of the invention is C 18 H 18 O 2 The relative molecular mass is 266.33, and the structural formula is as follows:
the dosage form of the drug for treating the porcine hemagglutinating encephalomyelitis virus infection is not particularly limited, and is preferably an injection, a capsule, a tablet or a powder injection.
The terms used in the present invention generally have meanings commonly understood by those of ordinary skill in the art unless otherwise indicated. In order to enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in further detail with reference to examples.
In the following examples, various processes and methods, which are not described in detail, are conventional methods well known in the art. Materials, reagents, devices, instruments, equipment and the like used in the examples described below are commercially available unless otherwise specified.
The invention is further illustrated below with reference to examples.
Example 1
Test of in vitro anti-porcine hemagglutinating encephalomyelitis virus effect of honokiol
1.1 dissolution and storage of Honokiol (HNK)
25mg of magnolol and 100. Mu.L of dimethyl sulfoxide (DMSO) solution are weighed and dissolved as a storage solution, and the storage solution is preserved at 4 ℃.
1.2 culture of mouse neuroma blast (N2 a cells)
N2a cells were cultured with DMEM containing 6wt% serum and 1wt% diabody (penicillin and streptomycin).
1.3 Effect of honokiol on N2a cell viability
N2a cells are cultured in a 96-well plate culture dish, and when the cells rise to 70% -80%, honokiol is prepared into solutions with different concentrations, wherein the concentrations are respectively 10 mu M/L, 15 mu M/L, 20 mu M/L, 25 mu M/L and 30 mu M/L. N2a cells were incubated with different concentrations of the solution for 24h, and the effect of different concentrations of honokiol solution on cell viability was measured by CCK-8, and the test results are shown in FIG. 1.
As can be seen from FIG. 1, the honokiol solution had no significant effect on N2a cell viability at 10. Mu.M/L to 25. Mu.M/L, while cell viability was significantly reduced at 30. Mu.M/L, so that 25. Mu.M/L of honokiol solution was selected for subsequent in vitro experiments to detect the effect of honokiol on PHEV infection.
1.4 controlling effects of honokiol on PHEV infection
The honokiol in vitro PHEV-resistant test is respectively provided with a mode of preventing and directly killing viruses and treating. The three modes are respectively used for extracting RNA and protein in cells for RT-qPCR and western blot tests, and detecting the mRNA expression level of PHEV and the change of the protein expression level of PHEV.
1.4.1 Detection method of RT-qPCR test
And inoculating the N2a cells into a six-hole plate, and carrying out toxin-receiving or drug-adding treatment according to the requirements of different modes when the cells are expanded to 70-80%. After the incubation is completed, total RNA in the cells is extracted, and the mRNA expression level of PHEV in the cells is detected.
Methods for extracting total intracellular RNA (RNA extraction and reverse transcription): after incubation, the six well plates were removed from the cell incubator and washed three times with PBS. The subsequent experiments were performed according to instructions for RNAiso PLUS with 1ml RNOiso PLUS per well. After RNA was mentioned, reverse transcription was performed according to the M-MLV reverse transcriptase protocol. Real-time fluorescence PCR detection was performed using reverse transcribed cDNA as a template. The cDNA amplification reaction system was 20. Mu.l: 10. Mu.l SYBRGreen Mix, 1. Mu.l forward primer, 1. Mu.l reverse primer, 6. Mu.l RNase-free water, 2. Mu.l DNA template. ( PHEV forward primer: TCTGGGAATCCTGACGAG; PHEV reverse primer: AGGCGCTGCAACACTTAC; GARDH forward primer: CTCAACTACATGGTCTACATGTTC; GAPDH reverse primer: ATTTGATGTTAGTGGGGTCTCGCTC )
The detection procedure is as follows: 3min at 95 ℃;95 ℃ for 10s; 30s at 60 ℃ for 40 cycles; and at 72℃for 10min.
With housekeeping gene GAPDH as control, use 2 ﹣△△CT The PHEV was analyzed for changes in mRNA transcription level.
1.4.2 Detection method of western blot test
And inoculating the N2a cells into a six-hole plate, and carrying out toxin-receiving or drug-adding treatment according to the requirements of different modes when the cells are expanded to 70-80%. After the incubation is completed, intracellular proteins are extracted, and the protein expression level of intracellular PHEV is detected.
Method for extracting intracellular proteins: after incubation, the six well plates were removed from the cell incubator and washed three times with PBS. 200 μl of protein lysate (RIPA Lysis Buffer) and protein inhibitor (Phenylmethylsulfonyl fluoride, PMSF) were added per well in a volume ratio of 100:1, incubated on ice for 15min, scraped off cells with a spatula and incubated for a further 15min. Centrifuging at 12000Xg for 10min, sucking supernatant, adding 5X loading buffer (the volume ratio of supernatant to buffer is 4:1), and boiling in boiling water for 10min. Protein samples were separated by SDS-PAGE, transferred to PVDF membrane, incubated with primary and secondary antibodies sequentially, and finally ECL developed. Polyclonal antibody concentration of PHEV was used for primary antibody (1:800), and horseradish peroxidase-labeled secondary antibody (goat anti-mouse) was used at concentration (1:10000).
1.4.3 different mode requirements
The preventive mode means: after adding honokiol solution to N2a cells for 12h, PHEV was inoculated and incubated for 12h, and the test results are shown in FIG. 2.
Direct kill virus mode refers to: the honokiol solution and PHEV were added simultaneously to N2a cells and incubated for 24h, and the test results are shown in FIG. 3.
Treatment mode refers to: PHEV was inoculated into N2a cells for 12h, and then honokiol solution was added for 12h, and the test results are shown in FIG. 4.
Wherein, the virus strain PHEV-CC14 (Genebank serial number: MF 083115.1) has TCID 50 A value of 10 -4.8 100 μl of virus solution was added to each well in an amount of 70 μl; cortex Magnolia officinalisThe concentration of the phenol solution was 25. Mu.M/L, and 2ml was added to each well.
From the results of FIGS. 2, 3, and 4, it can be seen that 25. Mu.M/L honokiol solution significantly reduced the mRNA and protein of PHEV and that there were statistically significant differences between the three modes compared to the control. From the above experimental results, it was determined that neutralizing magnolol significantly inhibited PHEV replication in vitro experiments.
Example 2
Experimental therapeutic study of porcine hemagglutinating encephalomyelitis virus infected mice
2.1 and configuration of magnolol solution: the neutralized magnolol stock solution of example 1, 1.1 was dissolved in purified water and the mice were perfused with a dose of 25mg/kg (200. Mu.L).
2.2 Experimental grouping
The test mice were divided into four groups of 4-week-old C57, a blank control group (WT), a DMSO control group (DMSO), a virus-receiving group (PHEV), and a magnolol virus-receiving group (P+HNK), ten of which were each tested for 14 days; PHEV and P+HNK mice were inoculated with 50. Mu.l of virus liquid (TCID) by nasal drip 50 A value of 10 -4.8 100. Mu.L); P+HNK mice were perfused with 25mg/kg (200. Mu.L) of honokiol per day over 14 days; WT and PHEV mice were gavaged with 200 μl of purified water daily for 14 days; DMSO group mice were gavaged over 14 days with purified water (200 μl) dosed with DMSO with the group p+hnk. At day 14, brain tissues of mice of PHEV and P+HNK groups were taken, and the mRNA and protein contents of PHEV in brain tissues were detected by RT-qPCR and western blot test methods.
2.2 detection method
The detection method of the RT-PCR test comprises the following steps: 0.1g of brain tissue was added to 1ml of RNAiso PLUS, the remainder being the same as 1.4.1 of example 1.
The detection method of the western blot test comprises the following steps: 0.1g of brain tissue was added with 1ml of protein lysate and protein inhibitor (100:1), the remainder being the same as 1.4.2 of example 1.
Daily average body weight changes in mice over 14 days are shown in figure 5. As can be seen from the results of fig. 5, the mice in the blank control group and DMSO control group had their weights continuously increased, and the mice in the toxin-receiving group and the honokiol-receiving group had their weights continuously decreased, but the honokiol-receiving group had less weight-decreasing change than the toxin-receiving group, within 14 days.
The mRNA expression level changes of PHEV in the virus-receiving group and the honokiol virus-receiving group are shown in fig. 6, and the protein expression level changes are shown in fig. 7. From the results of fig. 6 and 7, it can be seen that the mRNA expression level and the protein expression level of PHEV of honokiol-receiving group were significantly reduced and statistically significantly different from those of the receiving group. Through the test results, the obtained magnolol can obviously inhibit the replication of PHEV and exert better control effect in-vivo experiments
It should be apparent that the above embodiments are merely examples for clarity of illustration and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. And obvious variations or modifications thereof are contemplated as falling within the scope of the present invention.
Claims (3)
1. Application of honokiol in preparing medicines for resisting pig hemagglutinating encephalomyelitis virus is provided.
2. The use of honokiol in the preparation of a medicament for resisting porcine hemagglutinating encephalomyelitis virus according to claim 1, wherein the medicament for resisting porcine hemagglutinating encephalomyelitis virus is in the form of injection, capsule or tablet.
3. The use of honokiol in preparing medicine for treating pig hemagglutinating encephalomyelitis virus according to claim 2, wherein the injection is powder injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210036347.6A CN114376996B (en) | 2022-01-13 | 2022-01-13 | Application of honokiol in preparation of medicines for treating porcine hemagglutinating encephalomyelitis virus infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210036347.6A CN114376996B (en) | 2022-01-13 | 2022-01-13 | Application of honokiol in preparation of medicines for treating porcine hemagglutinating encephalomyelitis virus infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114376996A CN114376996A (en) | 2022-04-22 |
| CN114376996B true CN114376996B (en) | 2023-09-15 |
Family
ID=81200968
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210036347.6A Active CN114376996B (en) | 2022-01-13 | 2022-01-13 | Application of honokiol in preparation of medicines for treating porcine hemagglutinating encephalomyelitis virus infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114376996B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112972435A (en) * | 2019-12-13 | 2021-06-18 | 福建中医药大学 | Application of magnolol in preparation of medicine for preventing and/or treating myelitis |
-
2022
- 2022-01-13 CN CN202210036347.6A patent/CN114376996B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112972435A (en) * | 2019-12-13 | 2021-06-18 | 福建中医药大学 | Application of magnolol in preparation of medicine for preventing and/or treating myelitis |
Non-Patent Citations (2)
| Title |
|---|
| 印晓星等主编.《临床药理学》.中国医药科技出版社,2016,(第2016年1月第1版第1次印刷版),第16页. * |
| 师东方主编.《猪病诊断与防治技术问答》.东北林业大学出版社,2004,(第2004年5月第1版第1次印刷版),第41-45页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114376996A (en) | 2022-04-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Microglia Polarization from M1 toward M2 Phenotype Is Promoted by Astragalus Polysaccharides Mediated through Inhibition of miR‐155 in Experimental Autoimmune Encephalomyelitis | |
| CN115531384A (en) | Application of dibenzyl isoquinoline alkaloid in preparation of anti-African swine fever virus medicine | |
| CN114376996B (en) | Application of honokiol in preparation of medicines for treating porcine hemagglutinating encephalomyelitis virus infection | |
| CN112043688A (en) | A composition for preventing and/or treating coronavirus infection | |
| CN107308168A (en) | A kind of medicine for suppressing the intracellular duplication of porcine reproductive and respiratory syndrome virus | |
| CN113368121A (en) | Anti-coronavirus phillyrin and phillygenin composition | |
| US20220202873A1 (en) | Use of extract from rabbit skin inflamed by vaccinia virus in treating hematopoietic system damage | |
| CN115998723A (en) | Application of shikimic acid in preparation of medicine for preventing and/or treating white spot syndrome of aquatic animals | |
| CN103251636B (en) | Medicament for treating Candida infections and diseases caused by Candida, and preparation method thereof | |
| CN110302209B (en) | miR-451a antisense chain inhibitor and application thereof | |
| CN111671742B (en) | Application of sodium valproate in preparation of medicine for treating pneumonia caused by human coronavirus infection | |
| CN112755015A (en) | Application of PT2385 in preparation of medicine for preventing and treating pulmonary hypertension | |
| CN117017976A (en) | Application of thapsigargin in preparation of medicines for resisting porcine hemagglutinating encephalomyelitis virus infection | |
| CN110075131A (en) | Application of the zika virus attenuated strain in treatment glioma | |
| US11617729B2 (en) | Uses of guanidine hydrochloride as a drug for treating cancers/tumors | |
| CN116059276B (en) | Pharmaceutical composition for resisting porcine epidemic diarrhea virus and preparation method and application thereof | |
| CN117137897B (en) | Application of sofalcone in preparation of medicine for preventing/treating psoriasis | |
| CN111166737B (en) | Application of mangiferin | |
| CN117883431A (en) | Application of rui Sha Tuowei in preparation of medicines for resisting porcine hemagglutinating encephalomyelitis virus infection | |
| CN114588167B (en) | Application of ergosterol peroxide in preparation of medicines for inhibiting porcine delta coronavirus | |
| CN109276567B (en) | Application of 7-hydroxycoumarin in preparation of medicine for treating acute kidney injury | |
| CN104173354B (en) | Can treating cancer pharmaceutical compositions | |
| CN114469925A (en) | Medicament and method for antagonizing porcine respiratory and reproductive syndrome virus replication | |
| CN115350181A (en) | Application of small molecule compound in resisting virus infection | |
| CN117653633A (en) | Application of tetrandrine in preparation of medicines for preventing and treating porcine reproductive and respiratory syndrome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |