CN114246874B - Use of ruscogenin in preventing coronavirus infection - Google Patents

Use of ruscogenin in preventing coronavirus infection Download PDF

Info

Publication number
CN114246874B
CN114246874B CN202010993920.3A CN202010993920A CN114246874B CN 114246874 B CN114246874 B CN 114246874B CN 202010993920 A CN202010993920 A CN 202010993920A CN 114246874 B CN114246874 B CN 114246874B
Authority
CN
China
Prior art keywords
coronavirus
ruscogenin
application
pangolin
infection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010993920.3A
Other languages
Chinese (zh)
Other versions
CN114246874A (en
Inventor
童贻刚
范华昊
胡运甲
宋立华
安小平
王立钦
秦宏博
洪碧霞
刘文丽
陈杨桢
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing University of Chemical Technology
Original Assignee
Beijing University of Chemical Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing University of Chemical Technology filed Critical Beijing University of Chemical Technology
Priority to CN202010993920.3A priority Critical patent/CN114246874B/en
Publication of CN114246874A publication Critical patent/CN114246874A/en
Application granted granted Critical
Publication of CN114246874B publication Critical patent/CN114246874B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The application discloses an application of ruscogenin in preventing coronavirus infection. The application provides application of lurasigenin or pharmaceutically acceptable salt thereof or a substance taking lurasigenin or pharmaceutically acceptable salt thereof as an active ingredient in any one of the following: preparing a coronavirus-inhibiting product; products are prepared which are capable of preventing diseases caused by coronavirus infection. The application screens out the active medicine ruscogenin with SARS-CoV-2 from three medicine parties. The application has important clinical application value for the prevention of the COVID-19.

Description

Use of ruscogenin in preventing coronavirus infection
Technical Field
The application relates to the field of biological medicines, in particular to application of ruscogenin in prevention of coronavirus infection.
Background
The new viral pneumonia caused by the onset of the end of 2019 was caused by a new strain of coronavirus, which was named 2019 new coronavirus by the early world health organization in 2020 (English shorthand 2019-nCoV), the resulting disease was named COVID-19, and then the International Commission on the taxonomy of viruses was named SARS-CoV-2.
SARS-CoV-2 is a Sarbecovirus subtype of the genus Sarbecovirus of the order of the family of the viruses Nidovirales, coronaviridae, beta Coronaviridae, enveloped, spherical or oval in virus particle, polymorphic, 60-140 nm in diameter, belonging to the single positive strand RNA virus, genome full length 29,903bp. There is no specific drug for novel coronary pneumonia (covd-19) caused by SARS-CoV-2 infection, and development of specific drugs and effective vaccines are critical for inhibiting disease transmission and treatment.
A new coronavirus strain has been isolated and cultured from pangolins by the Beijing university child mussel rigid team, the strain is used for screening the existing 2,406 medicines, a plurality of old medicines which effectively inhibit the coronavirus are found and verified, and partial medicines are compared with a new coronavirus screening model, so that the results of the two models are consistent (Hua-Hao Fan, li-Qin Wang, wen-Li Liu, xiao-Ping An, zhen-Dong Liu, xiao Qi He, li-Hua Song, yi-Gang Tong.repurposing of clinically approved drugs for treatment of coronavirus disease in a 2019-novel coronavirus (2019-nCoV) related coronavirus), and the strain is named GX_P2V/panguain/2017/Gngxi. The result of the literature shows that pangolin coronavirus GX_P2V/pangolin/2017/Guangxi can be used as a substitute model for screening anti-new coronavirus drugs.
The traditional Chinese medicine plays a great potential in the epidemic situation of the COVID-19, and three medicine parties with obvious curative effects such as Jin Huaqing sensitive particles, lianhua qingwen capsules, xuebijing injection, lung-heat clearing and toxin expelling soup, dampness resolving and toxin relieving prescription, lung diffusing and toxin relieving prescription and the like are screened at present. However, the traditional Chinese medicine has complex and various components, and part of the traditional Chinese medicine may also contain toxic and harmful substances, so that the identification of the effective components capable of playing an antiviral role has important significance for preventing and treating the new coronaries.
Disclosure of Invention
The object of the present application is to provide the use of lukesapogenin in the prevention of coronavirus infection.
In a first aspect, the present application claims the use of a Ruscogenin (Ruscogenin) or a pharmaceutically acceptable salt thereof or a substance comprising Ruscogenin or a pharmaceutically acceptable salt thereof as an active ingredient in any of the following:
(A1) Preparing a product for inhibiting coronavirus, or inhibiting coronavirus;
(A2) A product capable of preventing a disease caused by coronavirus infection or preventing a disease caused by coronavirus infection is prepared.
Wherein, the inhibition of coronavirus may be inhibition of coronavirus at the organism level or at the cellular level. The inhibition of coronavirus is inhibition of coronavirus replication.
Further, the inhibition of coronavirus is effected prior to entry of the coronavirus into the host or host cell (i.e., prior to entry into the cell). The ruscogenin is therefore suitable for the preparation of a product for the prevention of diseases caused by coronavirus infection.
Further, the ruscogenin is (25 RS) -ruscogenin.
In the present application, the coronavirus may be SARS-CoV-2 virus or a coronavirus pangolin isolate GX_P2V/pangolin/2017/Guangxi or other similar coronaviruses.
When the coronavirus is SARS-CoV-2 virus, the disease caused by its infection is COVID-19.
In such applications, the product may in particular be a medicament.
In the application, (25 RS) -ruscogenin is derived from Shenmai injection or Shengmai injection in three-medicine three-party.
In a second aspect, the application claims a product.
The active ingredient of the product claimed by the application is ruscogenin or pharmaceutically acceptable salt thereof; the product has any one of the following uses:
(a1) Inhibition of coronavirus;
(a2) Preventing diseases caused by coronavirus infection.
Wherein, the inhibition of coronavirus may be inhibition of coronavirus at the organism level or at the cellular level.
Further, the inhibition of coronavirus is effected prior to entry of the coronavirus into the host or host cell (i.e., prior to entry into the cell). The ruscogenin is therefore suitable for the preparation of a product for the prevention of diseases caused by coronavirus infection.
Further, the ruscogenin is (25 RS) -ruscogenin.
In the present application, the coronavirus may be SARS-CoV-2 virus or a coronavirus pangolin isolate GX_P2V/pangolin/2017/Guangxi or other similar coronaviruses.
When the coronavirus is SARS-CoV-2 virus, the disease caused by its infection is COVID-19.
The product may in particular be a medicament.
The structural formula of the (25 RS) -ruscogenin is shown as a formula I.
The application screens active medicine (25 RS) -ruscogenin with SARS-CoV-2 from three medicine parties based on pangolin coronavirus xCoV (namely, pangolin isolate GX_P2V/pangolin/2017/Guangxi) medicine screening model. The application has important clinical application value for the prevention of the COVID-19.
Drawings
FIG. 1 shows the viral replication inhibition of pangolin coronavirus xCoV by the traditional Chinese medicine monomer (25 RS) -ruscogenin.
FIG. 2 is an EC of (25 RS) -ruscogenin 50 、CC 50 And SI.
FIG. 3 shows the results of the time-of-dosing experiments for (25 RS) -ruscogenin.
Detailed Description
The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The coronavirus pangolin isolates GX_P2V/pangolin/2017/Guangxi used in the examples below have been disclosed in the following two documents:
1.Hua-Hao Fan,Li-Qin Wang,Wen-Li Liu,Xiao-Ping An,Zhen-Dong Liu,Xiao Qi He,Li-Hua Song,Yi-Gang Tong.Repurposing of clinically approved drugs for treatment of coronavirus disease 2019in a 2019-novel coronavirus(2019-nCoV)related coronavirus.
2.Lam,T.T.,Jia,N.,Zhang,Y.et al.Identifying SARS-CoV-2-related coronaviruses in Malayan pangolins.Nature 583,282–285(2020).https://doi.org/10.1038/s41586-020-2169-0。
the GX_P2V/pangolin/2017/Guangxi used in the application is subjected to strain preservation firstly, and then the paper is published, wherein xCov in preservation evidence is the virus GX_P2V/pangolin/2017/Guangxi in document 1 and the virus GX/P2V in document 2.
The xCov is preserved in China general microbiological culture Collection center (CGMCC) with a preservation number of 19295; preservation date: 2020, 2 months, 14 days; address: beijing, chaoyang area, north Chenxi Lu No.1, 3; taxonomic naming: coronavirus.
EXAMPLE 1 screening of drug monomers with anti-SARS-CoV-2 Activity from "three drug Party
1. Experimental method
1. Cell culture and virus culture
Vero E6, an african green monkey kidney cell line, was obtained from the american type culture collection (ATCC, 1586) at 37 ℃, 5% co 2 Is cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS; gibco Invitrogen).
Pangolin isolate xCoV (i.e., gx_p2v/panolin/2017/Guangxi) was propagated in Vero E6 cells and virus titers were determined using plaque assay. All infection experiments were performed in biosafety class 2 (BLS 2) laboratories.
The anti-COVID-19 Chinese medicinal compound library (product number L6720, containing 389 Chinese medicinal monomers separated and purified from three medicines) is a product of Shanghai Tao Su Biochemical technology Co., ltd. The initial concentration of all drugs was 10mM (millimoles per liter).
2. Screening potential anti-novel coronavirus drugs from anti-COVID-19 traditional Chinese medicine compound library by utilizing pangolin coronavirus xCoV (namely GX_P2V/pangolin/2017/Guangxi) with high homology to SARS-CoV-2
Planting 2.5X10 in 96-well cell plate 4 Vero cells were infected 24 hours later with mocv=0.01 (i.e. gx_p2v/pangolin/2017/Guangxi), while 389 chinese monomers were added to each well at a final concentration of 50 μm, cytopathic effect was observed by microscopy on day 2, RNA was extracted from cells and supernatant from cultured wells without obvious cytopathic effect, and viral replication in cells and supernatant and expression of intracellular reference gene GAPDH were determined by qRT-PCR. The inhibition rate of the virus replication reaches more than 90 percent without obvious cytotoxicity, and the virus replication inhibition rate is regarded as a potential anti-new coronavirus drug.
3. Potential antiviral drug EC 50 CC (CC) 50 Measurement
Planting 2.5X10 in 96-well cell plate 4 Vero cells were infected 24 hours later with mocv=0.01 (i.e. gx_p2v/pangolin/2017/Guangxi) while adding thereto the final concentrations of 50 μm, 25 μm, 12.5 μm, 6.25 μm, 3.125 μm, 1.5625 μm, 0.78125 μm and 0.390625 μm of the traditional Chinese medicine monomers, respectively, and on day 3, cytopathic effect was observed by microscopy, RNA was extracted from cells and supernatant from the culture well without obvious cytopathic effect, and viral replication in cells and supernatant and expression of the intracellular reference gene GAPDH was determined by qRT-PCR.
EC 50 The drug concentration can effectively inhibit 50% of cell-infected viruses, and the smaller the value, the better the inhibiting effect on viruses is indicated.
CC 50 Is the drug concentration at which 50% of the cells are diseased, the higher the value is, the lower the toxicity to the cells.
SI: selectivity index of CC 50 And EC (EC) 50 The larger the number the higher the likelihood of drug formation.
4. Time of dosing experiment
Seed 2.5X10 cells in 24-well cell plates 5 Vero cells were infected 24 hours later with mocv with moi=0.01 (i.e. gx_p2v/panolin/2017/Guangxi), and potential active drug was added thereto at 25 μm concentration at full infection cycle (at the time of virus addition and after 2 hours of virus addition), before cell entry (at the time of virus addition), after cell entry (after 2 hours of virus addition), cytopathic effect was observed under a microscope on day 3, RNA was extracted from cells and supernatant from cultured wells without obvious cytopathic effect, and virus replication in cells and supernatant and expression of GAPDH gene in cells were determined by qRT-PCR.
5. Viral RNA extraction and real-time quantitative RT-PCR (qRT-PCR)
According to the manufacturer's instructions, axyPrep was used TM Body fluid virus DNA/RNA miniprep kit (Axygen, product number AP-MN-BF-VNA-250) and AxyPrep TM A multipurpose Total RNA miniprep kit (Axygene, product number AP-MN-MS-RNA-250G) collects cell culture supernatant and Vero cells for RNA extraction. Reverse transcription was performed using HifairII 1 strand cDNA synthesis kit with gDNase (Shanghai Chemie Biotechnology Co., ltd., product No. 11121ES 60), qPCR was performed using Hieff-qPCR-SYBR-Green-Master Mix (Shanghai Santa Biotechnology Co., ltd., cat., product No. 11202ES 08) or a two-step Taqman probe detection qRT-PCR system (Applied-Biosystem), and sequence information of the primers used is shown in Table 1. After sequencing confirmation, PCR products were inserted into T-vector by beijing, borreliaceae biotechnology limited to generate standard plasmids. The standard curve was obtained by measuring plasmid serial dilutions (10 3 -10 9 ) Further, the virus copy number can be calculated by using Ct value obtained by qRT-PCR through a standard curve.
The SYBR-Green method amplification procedure is as follows: 95℃for 5min,40 cycles, 95℃for 10s,55℃for 20s and 72℃for 31s.
Taqman method: 50 ℃ 2min,95 ℃ 10min,40 cycles, 95 ℃ 10s,60 ℃ 1min. Data were analyzed using GraphPad-Prism 8.3.0 software.
Table 1 primer sequences used in the study
Primer name Sequence (5 '-3')
xCoV-F GGTGATTGCCTTGGTGATATTG
xCoV-R GCAAGTAGTGCAGAAGTGTATTG
xCoV-P TCTGTGAGCAAAGGCGGTAGAACC(5’-FAM，3’-TAMRA)
GAPDH-F AGCCTCAAGATCATCAGCAATG
GAPDH-R ATGGACTGTGGTCATGAGTCCTT
GAPDH-P CCAACTGCTTAGCACCCCTGGCC(5’-FAM，3’-TAMRA)
2. Experimental results
Detection by real-time quantitative PCR technique revealed that 50. Mu.M of (25 RS) -ruscogenin had a viral replication inhibition of 99.77% after 48 hours of infection of cells with xCoV (i.e., GX_P2V/panglin/2017/Guangxi) at a multiplicity of 0.01 (FIG. 1).
(25 RS) -Rust cocoa soapEC of aglycone 50 、CC 50 And SI of 11.70 mu M respectively,>50μM、>4.27 (FIG. 2).
Time of dosing experiments showed that (25 RS) -ruscogenin acted mainly in the pre-cellular stage (before virus enters cells) (fig. 3).
3. Discussion of the application
In the present application, the inventors performed screening for anti-coronavirus active agents in the SARS-CoV-2 associated coronavirus, i.e., pangolin coronavirus xCoV (i.e., GX_P2V/pangolin/2017/Guangxi) model. Based on the results of previous laboratory studies, xCoV (i.e., gx_p2v/panglin/2017/guanxi) was found to produce very pronounced cytopathic effects in mammalian cells Vero (african green monkey kidney cells) after infection. Based on this feature, the inventors used xCoV (i.e., gx_p2v/pandolin/2017/Guangxi) to infect Vero cells in 96-well cell culture plates at a previous stage, while adding drug monomers (389 traditional Chinese medicine monomers) isolated from "three drug parties" to each cell culture well, and screened for potential active drugs that inhibit viral replication. On day 2, cytopathy is observed under a microscope, and as a result, (25 RS) -ruscogenin is found to be obvious in inhibiting virus infected cells, and can be used as a potential antiviral drug. Further, it was found by real-time fluorescent quantitative PCR detection that 50. Mu.M of (25 RS) -ruscogenin showed a viral replication inhibition of 99.77% after 48 hours of infection of cells with xCoV at a multiplicity of 0.01. Since xCoV is highly homologous to current SARS-CoV-2 and the receptor of xCoV-infected cells is consistent with SARS-CoV-2, if the drug inhibits xCoV-infected cells, it also inhibits SARS-CoV-2 infection (ref: hua-Hao Fan, li-Qin Wang, wen-Li Liu, xiao-Ping An, zhen-Dong Liu, xiao Qi, li-Hua Song, yi-Gang Tong. Repurposing of clinically approved drugs for treatment of coronavirus disease in a 2019-novel coronavirus (2019-nCoV) related coronavir.).
Meanwhile, to further verify the effect of (25 RS) -ruscogenin, its EC was determined 50 And CC 50 . (25 RS) -Russian sapogenin EC 50 、CC 50 And SI of 11.70 mu M respectively,>50μM、>4.27. These results indicate [ ]25 RS) -ruscogenin has better antiviral activity and lower toxic and side effects, and has potential clinical application value.
Finally, the duration of action of (25 RS) -ruscogenin was investigated. (25 RS) -ruscogenin acts mainly in the pre-cellular phase of the virus. This result further strongly demonstrates the potential antiviral activity of (25 RS) -ruscogenin.
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (5)

1. Use of ruscogenin or a pharmaceutically acceptable salt thereof or a substance comprising ruscogenin or a pharmaceutically acceptable salt thereof as an active ingredient in any of the following:
(A1) Preparing a coronavirus-inhibiting product;
(A2) Preparing a product capable of preventing diseases caused by coronavirus infection;
the only active ingredient of the product is ruscogenin or pharmaceutically acceptable salt thereof;
the coronavirus is SARS-CoV-2 virus or coronavirus pangolin isolate GX_P2V/pangolin/2017/Guangxi.
2. The use according to claim 1, characterized in that: the inhibition of coronavirus is effected prior to entry of the coronavirus into the host or host cell.
3. The use according to claim 1, characterized in that: the ruscogenin is 25 RS-ruscogenin.
4. The use according to claim 1, characterized in that: the disease caused by the coronavirus infection is covd-19.
5. Use according to any one of claims 1-4, characterized in that: the product is a medicament.
CN202010993920.3A 2020-09-21 2020-09-21 Use of ruscogenin in preventing coronavirus infection Active CN114246874B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010993920.3A CN114246874B (en) 2020-09-21 2020-09-21 Use of ruscogenin in preventing coronavirus infection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010993920.3A CN114246874B (en) 2020-09-21 2020-09-21 Use of ruscogenin in preventing coronavirus infection

Publications (2)

Publication Number Publication Date
CN114246874A CN114246874A (en) 2022-03-29
CN114246874B true CN114246874B (en) 2023-08-29

Family

ID=80788225

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010993920.3A Active CN114246874B (en) 2020-09-21 2020-09-21 Use of ruscogenin in preventing coronavirus infection

Country Status (1)

Country Link
CN (1) CN114246874B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111658663A (en) * 2020-07-23 2020-09-15 五邑大学 Application of liriope spicata saponin B in preparation of medicine for treating skin inflammation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111658663A (en) * 2020-07-23 2020-09-15 五邑大学 Application of liriope spicata saponin B in preparation of medicine for treating skin inflammation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
韩利文等.参麦注射液治疗新型冠状病毒肺炎（COVID-19）合并冠心病的网络药理分子机制探析.中草药.2020,第51卷(第09期),2334-2344. *

Also Published As

Publication number Publication date
CN114246874A (en) 2022-03-29

Similar Documents

Publication Publication Date Title
JP2019048863A (en) Application of alphavirus in preparation of antitumor drugs
CN113082049B (en) New application of potassium iodide or composition containing potassium iodide in preparation of drugs for treating African swine fever
EP3189856A1 (en) Method for inhibiting ebola virus via mirna
Ho et al. In vitro and in vivo studies of a potent capsid-binding inhibitor of enterovirus 71
CN112587663B (en) Application of long-chain non-coding RNA-lncIVRL in prevention and treatment of influenza A virus infection
CN113398219A (en) Application of exocarpium citri rubrum extract for preparing medicine for inhibiting human coronavirus infection
CN114246847B (en) Application of chalcone compounds in treatment of coronavirus infection
CN112336708B (en) Application of tiralatrock in treating coxsackie virus infection
CN106880630B (en) Retro-2cyclAnd use of related derivatives
CN114246874B (en) Use of ruscogenin in preventing coronavirus infection
CN106038695B (en) Use of avocado extract, avocadol B and (2R,4R) -1,2, 4-trihydroxyheptadeca-16-alkyne, and health food containing avocado extract
CN114246853B (en) Use of isoferulic acid in preparation of products for preventing and treating coronavirus infection
CN109568350B (en) Coxsackie virus for treating tumors
Baxt et al. Mechanisms of vesicular stomatitis virus-induced cytopathic effects: I. Early morphologic changes induced by infectious and defective-interfering particles
CN112315962B (en) Application of mycophenolic acid in treating and preventing coxsackie virus infection
Wang et al. Infectious bursal disease virus replication is inhibited by avain T cell chemoattractant chemokine CCL19
CN114246858A (en) Application of artemisinin compound in treatment and prevention of coronavirus infection
CN114246859A (en) Application of andrographolide in preparing product for treating coronavirus infection
Dapurkar et al. A patent perspective on chikungunya
CN106619591B (en) The purposes and pharmaceutical composition of oxetacaine in medicine preparation
CN112294795B (en) Application of artemether in treating and preventing coxsackie virus infection
CN115350181B (en) Application of small molecular compound in preparation of antiviral infection medicines
CN110693896B (en) Enterovirus small molecule inhibitor and application thereof
CN114908062B (en) Use of mefloquine hydrochloride or mefloquine in preparing medicine for treating coronavirus infectious diseases
Rana et al. Overview of an emerging coronavirus infection, covid-19: current status of vaccine development and therapeutics

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant