CN114369597B - Universal probe detection chip and application thereof - Google Patents

Abstract

The invention discloses a universal probe detection chip and application thereof, wherein the probe of the chip is an artificial DNA sequence, the length of the chip is 24-28nt, the GC content is 45-65%, the chip comprises 10 detection sites, and the probe of each site has a base difference every 5-10 bases. The detection chip is a universal detection chip, and detection sites can be added without the need of remanufacturing the chip. The chip is used for SNP detection of drug genes.

Description

Universal probe detection chip and application thereof

Technical Field

The invention relates to the field of molecular biology detection, in particular to a universal probe detection chip and application thereof, and is particularly used for detection of anti-leukemia accurate drug genes and a kit.

Background

Acute Lymphoblastic Leukemia (ALL) is the leading cause of death in children, accounting for 70% -85% of ALL childhood leukemias. Currently, large doses of methotrexate (HD-MTX) are the primary drug for ALL extramedullary lesions and systemic consolidation therapy. The higher the administration concentration of methotrexate, the more remarkable the inhibition of cell division, the longer the higher the blood concentration maintenance time, the stronger the effect on cells in the logarithmic proliferation phase, and the higher the incidence of adverse reactions of the same drug. Therefore, HD-MTX exerts a good antitumor effect and also produces serious toxicity to all rapidly dividing normal cells.

Methotrexate (MTX), thioguanine, 6-mercaptopurine, etc. have been used clinically for over 70 years. Practice proves that MTX has reliable curative effect in some blood tumors and autoimmune diseases, but has strong toxic and side effects, and needs individual medication. The cause of the huge individuation difference in drug treatment is that genetic factors are important factors influencing the drug response difference besides the aspects of traditional pathology, physiology, sex, age, height, weight, compliance and the like. Among them, gene polymorphism of drug metabolizing enzymes, transporters, receptors and other drug action targets is an important cause of drug effects and toxic individual differences.

The development of the genome of the drug is still in the rapid development process, and new gene polymorphism is found to be related to adverse reaction or drug effect every few years, and meanwhile, the evidence of different grades is changed, and the original 2B is changed into 2A or even 1A. Therefore, a detection chip of a medicine genome which is just designed often appears, and after clinical tests are carried out for one or two years, the guideline of the medicine genome is found to be updated, and new detection sites are added, so that the detection chip which is designed before is out of the market and is out of date.

In the traditional Chinese SNP detection chip, all the mutation type and wild type probes of the loci to be detected are spotted on the chip, the two probes are generally different by only one base, a large amount of optimization is required for the amplification product to ensure the specificity, so that the amplification product containing 10 loci can be correctly detected, and once the loci are added, the whole chip is required to be spotted again, and the whole reaction system is required to be futured again. The original chip is discarded.

Aiming at the problems, the invention designs a universal detection chip, probes on the chip are universal sequences, and the difference between any two probes is at least 3 bases so as to fully avoid nonspecific hybridization. And the same chip can be applied to detection of different SNP loci.

Disclosure of Invention

The invention aims to provide a general detection chip, and aims to solve the technical problem that detection sites can be added without the need of manufacturing new probe chips again by adopting the detection chip.

To achieve the object of the present invention, the following embodiments are provided:

in one embodiment, the universal probe detection chip comprises probes, wherein the probes take an artificial DNA sequence 5'GGCTCCTGGACTAAAGTTCTTGGGCTC 3' (SEQ ID NO: 1) as a positive sequence, the positive sequence is taken as a template, and a difference base is designed every 5-10 bases from 5', so that at least 10-site wild type probes and mutant probes are obtained.

In the above embodiment, the wild-type probe and the mutant-type probe of the present invention are designed to have a different base at intervals of 6, 10 and 8 bases in sequence from 5' using the positive sequence as a template, and specifically the sequences of the 10-site wild-type probe and the mutant-type probe (from 5' -3 ') are as follows:

site 1-wild-type GGgTCCTGGACTAtAGTTCTTGcGCTC,

mutant GGCaCCTGGACTAAtGTTCTTGGcCTC;

site 2-wild-type GGCTgCTGGACTAAAcTTCTTGGGgTC,

mutant GGCTCgTGGACTAAAGaTCTTGGGCaC;

site 3-wild-type GGCTCCaGGACTAAAGTaCTTGGGCTg,

mutant cGCTCCTcGACTAAAGTTgTTGGGCTC;

site 4-wild-type GcCTCCTGcACTAAAGTTCaTGGGCTC,

mutant GGaTCCTGGtCTAAAGTTCTcGGGCTC;

site 5-wild-type GGCgCCTGGAgTAAAGTTCTTcGGCTC,

mutant GGCTaCTGGACgAAAGTTCTTGtGCTC;

site 6-wild-type GGCTCaTGGACTgAAGTTCTTGGtCTC,

mutant GGCTCCgGGACTAgAGTTCTTGGGaTC;

site 7-wild-type GGCTCCTaGACTAAcGTTCTTGGGCgC,

mutant GGCTCCTGtACTAAAtTTCTTGGGCTa;

site 8-wild-type tGCTCCTGGgCTAAAGcTCTTGGGCTC,

mutant GtCTCCTGGAaTAAAGTgCTTGGGCTC;

site 9-wild-type GGaTCCTGGACgAAAGTTaTTGGGCTC,

mutant GGCgCCTGGACTgAAGTTCgTGGGCTC;

site 10-wild-type GGCTtCTGGACTAgAGTTCTTaGGCTC,

mutant GGCTCgTGGACTAAAcTTCTTGGcCTC.

The mutant sequence and the wild sequence are designed on the basis of the positive sequence, namely, the lower case letters in the sequences.

Preferably, the detection chip of the present invention further comprises a step of adding 15 to 20C bases before the mutant sequence, the wild-type sequence and the positive sequence of the probe.

The probe detection chip of the invention further comprises a glass slide, the probes are spotted on the glass slide, wherein the mutant probes and the wild probes respectively have 10 sites, and the positive probes are quality control sites. The slide is an amino modified slide.

In a specific embodiment, the probe detection chip of the invention uses positive probes to sample 3 quality control sites, each quality control site has 3 repeated points, uses mutant probes and wild type probes to sample 10 detection sites respectively, each detection site has 3 repeated points, and the detection sites of the mutant probes are parallel to the detection sites of the wild type probes and form a matrix. The probe is diluted with a TE buffer without ribozyme before spotting, then mixed with a 2X hybridization solution, and hybridized at a preheating temperature after spotting, preferably 42 ℃.

The invention also provides a detection method of the drug gene SNP, which comprises the following steps:

1) Extracting peripheral blood of a human body, and extracting whole-gene DNA;

2) Designing a primer of a drug gene to be detected through software, connecting a mutation probe or a wild type probe in front of the upper primer, and amplifying the DNA in the process 1);

3) Dripping the amplification solution into the detection sites and the quality control points of the probe detection chip for hybridization;

4) The hybridization results of each sample were analyzed to confirm the mutant SNPs.

The invention provides an application of a detection chip in manufacturing a kit for detecting SNP of a drug gene.

The use of the invention as described above, the drug gene is a drug gene for the treatment of leukemia, preferably a drug gene comprising TPMT x 3C, NUDT, SLCO1B1 and/or MTHFR.

In some preferred embodiments, the method for preparing the probe detection chip of the present invention comprises the steps of:

1. design of universal probe

Firstly, designing a probe aiming at detection of 10 sites, wherein the probe sequence is a pure artificial sequence, the length is 24-28nt, and the GC content is 45-65%; the artificial sequence was blast aligned in NCBI nucleic acid database, and the DNA sequence was not retrieved. The DNA sequence probe designed by the inventor meets the following conditions: unlike the genomes of known species in the world, particularly preferred is an optimal DNA sequence probe having the DNA sequence shown in SEQ ID NO 1: 5'GGCTCCTGGACTAAAGTTCTTGGGCTC 3'.

Next, the sequence was redesigned, and a base difference was designed every 6 to 10 bases, specifically, every 6, 10, 8 bases from the 5' of the DNA sequence shown in SEQ ID NO1, and a wild type probe and a mutant probe were designed to detect 10 sites, as shown in table 1 below:

TABLE 1 probe sequences for detecting 10 sites

As shown in the above table, the lower case letters are different bases in the sequence, and any two probes at different sites have a difference of 6 bases, and have a difference of at least 3 bases from the positive quality control probe.

The 21 probes shown in Table 1, including 1 positive control, and 20 probes for detecting 10 sites (10 corresponding to each of the wild type probe and the mutant type probe), were each added with 15-20C before each sequence to form a long arm, and then synthesized by Shanghai Biotechnology Co., ltd. Diluted to 67nM concentration with TE buffer without ribozyme.

The 67nM probe diluted as described above was mixed in an equal volume with a 2X hybridization solution (50% formamide, 719 mM NaCl, 100. Mu. EDTA,0.2% SDS) and then spotted into a chip (dot pitch 250. Mu.m, dot diameter 100. Mu.m, chip amino-modified glass slide, supplied by Beijing Boao Biotechnology) using an OmniGrid Acent high throughput chip spotter. The humidity was kept at 50% overnight, and then the chips were prehybridized in 42℃preheated prehybridization solution (20 XSSC 100ml,10%SDS 4ml,10%BSA 40ml, water 276ml without ribozyme and 420ml total) for 40 minutes, immediately washed with water for 2 minutes, isopropanol for 2 minutes, and spin-dried with a slide centrifuge at 800rpm to obtain detection chips. The spotting schematic diagram is shown in fig. 1, and the out-of-band boxes in fig. 1 are positive quality control, which is used for quality control of the whole hybridization process, and is positioned at three corners and is also used for subsequent chip orientation positioning. The open circles represent wild-type probes, 15 spots in a row, each probe repeated 3 times, 5 probes in each row. There are two rows of 10 probes. Black circles represent mutant probes, 15 spots in a row, each probe repeated 3 times, 5 probes in each row, and 10 probes in a total of two rows.

Drawings

FIG. 1 is a schematic diagram of a sample application matrix of a detection chip;

FIG. 2 is a graph showing the results of the chip test of sample A of example 1;

FIG. 3 is a graph showing the results of the chip test of sample B of example 1;

FIG. 4 is a graph showing the results of the chip test of sample A of example 2;

FIG. 5 is a graph showing the results of the chip test of sample B of example 2.

Detailed Description

The following examples are representative for further illustration and understanding of the essence of the present invention, but do not limit the scope of the present invention in any way.

Example 1 Universal Probe detection chip for detecting drug Gene SNP for leukemia treatment

1) For drugs against leukemia treatment, 6-mercaptopurine, azathioprine, thioguanine, methotrexate were searched in pharmsgkb, FDA and chinese guidelines, respectively, to find the following corresponding sites and corresponding types, and the results are shown in table 2.

Table 2 shows the selected gene to be detected and SNP site

Table 2 contains 4 sites of 4 genes, and the primers related to the DNA sequences of the 4 genes are shown in Table 3 below:

table 3 primer sequences of 4 genes designed

In Table 3, the 5' of the upstream primer is increased by a sequence identical to the probe sequence on the chip. The wild type differs from the mutant primer by the end base sequence. Cy3 modification is carried out on the 5' end of the downstream primer, and the mutant type is the same as the wild type downstream primer. Primer sequences were all synthesized by Shanghai Biotechnology Co. All primers, as well as positive probes, were diluted to 10nM and stored as working concentration at-20 ℃.

2) Obtaining a sample to be tested

1ml of human peripheral blood was collected, and then the whole blood genomic DNA was extracted by Qiagen blood DNA extract kit and stored at-20℃for later use.

3) The genotypes of the 4 sites were detected by conventional sanger sequencing as shown in table 4 below (sanger sequencing is conventional technique, sequencing process and specific sequencing results are omitted).

TABLE 4 genotypes of human samples

4) All primers in Table 3 were PCR amplified; the method comprises the following specific steps: in 25. Mu.l of the PCR reaction system, 2.5. Mu.l of a 0 XPCR buffer (containing 15mM of Mg ions), 2.0. Mu.l of dNTP (10 mM), 0.5. Mu.l of Taq DNA polymerase (2U/ml), 0.5. Mu.l of each of the upstream and downstream primers (20 pmol/. Mu.l), 1. Mu.l of a genomic DNA extract of the sample to be tested, and water were added to make up 25. Mu.l. PCR cycle parameters: pre-denaturation at 94 ℃ for 5 min; denaturation at 94℃for 30 seconds, annealing at 60℃for 30 seconds, elongation at 72℃for 25 seconds, for a total of 35 cycles. Obtaining the amplified product. Each sample was amplified with the primers in table 3 to obtain CYP2C19 x 2, CYP2C19 x 3, CYP2C19 x 17, FKBP5, four site mutant and wild type, total of 8 PCR products, mixed in equal ratio at 10 μl/PCR product, and purified using the purification kit of qiagen to obtain purified amplification product mixture.

5) The chip was covered with a cover plate, and the obtained purified amplification product mixture was mixed with 10ul of positive control probe, and then with 2 XSSC (250. Mu.l of 20 XSSC; 250 μl of deionized formamide; 10 μl of 10% SDS) was mixed, denatured at 98℃for 2 min, and then rapidly placed on ice. After 5 minutes, the solution was removed, centrifuged slightly, and then aspirated with a pipette gun, and added from the wells on the coverslip, the solution was spread over the probe array area with tension. Each sample was applied to a chip matrix and hybridized for 2h at 58 degrees. Then, each of eluate 1 (2 XSSC, 0.1% SDS, pre-heating at 42 ℃), eluate 2 (0.5 XSSC, 0.01% SDS, pre-heating at 42 ℃) and eluate 3 (0.06 XSSC) was washed for 5 minutes. Spin-drying with slide centrifuge at 800 rpm.

6) Detection and analysis of hybridization results

The chip is scanned by an Agilent G2505B scanner, and the results are analyzed by bioinformatics software such as genemix, wherein (average signal value-average background signal)/average background signal is more than 5 times positive, and the result judgment standard is that: wherein only the wild type probe is positive, which indicates that the genetic locus of the test sample is wild type; only positive mutant probes indicate that the gene locus of the detection sample is mutant, and both positive probes indicate that the gene locus of the detection sample is heterozygous. The experiment is effective when the three positive probes at the three corners are in a detection state in 9 points, and if any point (signal value-average background signal)/average background signal in the 9 points is less than 5, the experiment is considered to fail and needs to be reworked.

The detection result of sample a is shown in fig. 2. In fig. 2, the signals of 9 positive spots in the three boxes are strong, indicating that the test is effective. Secondly, the 1 st, 2 nd and 4 th sites, only the wild type is positive, the 3 rd site, the wild type and the mutant type are positive, which indicates that the TPMT site of the sample is AA homozygote type, NUDT15 is CC homozygote type, SLCO1B1 is CT heterozygote type and MTHFR site is CC homozygote type.

The detection result of the sample B is shown in fig. 3, and 9 positive points in three frames in the figure have strong signals, which indicate that the detection is effective in the experiment. Secondly, the 1 st and 2 nd sites are positive only for the wild type, the 3 rd and 4 th sites are positive for the wild type and the mutant type, which indicates that the TPMT site of the sample is AA homozygote type, NUDT15 is CC homozygote type, SLCO1B1 is CT heterozygote type and MTHFR site is CT heterozygote type.

Example 2

1) The new methotrexate drug has the site of MTRR 66A > G mutation and the evidence grade of 2B after literature update aiming at the drug for treating leukemia. The probe detection chip is used for detection, and the prepared gene chip is used for finishing upgrading without any change. The genotypes at 5 sites were detected.

2) On the basis of Table 3, a pair of primers was added, see Table 5:

TABLE 5 primers for MTRR Gene

In Table 5, the upstream primer is added 5' to the sequence corresponding to the probe sequence on the chip. The wild type differs from the mutant primer by the end base sequence. Cy3 modification is carried out on the 5' end of the downstream primer, and the mutant type is the same as the wild type downstream primer. Primer sequences were all synthesized by Shanghai Biotechnology Co. All primers, as well as positive probes, were diluted to 10nM and used as working concentration, -20℃for storage.

3) The sample to be tested, which is still a human peripheral blood DNA sample of embodiment 1, is added with a site based on the original sample, and the sanger sequencing result is shown in Table 6.

TABLE 6 genotype of test samples

4) PCR amplification, increasing MTRR on the basis of example 1: 66A > G wild type and mutant type two-tube PCR products, amplification conditions were the same as in example 1, and finally 10-tube PCR products were mixed in an equal ratio of 10ul/PCR product, and purified using a purification kit of qiagen to obtain a purified amplification product mixture.

5) Subsequent steps of hybridization, washing and scanning, wherein the judgment standard is the same as that of the embodiment 1, and the detection results of the following two samples are obtained:

the detection result of sample a is shown in fig. 4. The signals of 9 positive points in the three boxes in the figure are strong, and the detection is indicated to be effective in the experiment. Secondly, the 1 st, 2 nd, 4 th and 5 th sites, only the wild type is positive, the 3 rd site, the wild type and the mutant type are positive, which indicates that the TPMT site of the sample is AA homozygous, NUDT15 is CC homozygous, SLCO1B1 is CT heterozygous, MTHFR site is CC homozygous, and MTRR site is AA homozygous.

The detection result of sample B is shown in fig. 5. The signals of 9 positive points in the three frames in the figure are strong, and the detection is indicated to be effective in the experiment. Secondly, the 1 st, 2 nd and 5 th sites, only the wild type is positive, the 3 rd and 4 th sites, the wild type and the mutant type are positive, which indicates that the TPMT site of the sample is AA homozygous, NUDT15 is CC homozygous, SLCO1B1 is CT heterozygous, MTHFR site is CT heterozygous, and MTRR site is AA homozygous.

The detection result is completely consistent with the sanger detection result.

The invention has the biggest innovation point that a chip of a universal probe is prepared, and the chip can support detection of any site in 10 sites. The invention can support the change or increase of sites without any change to the chip, thus being beneficial to the standardization and mass production of the chip, the difference of at least 3 bases between any two probes can greatly improve the specificity, the hybridization is not easy to occur at the temperature of 58 ℃, and meanwhile, only one end of the correctly amplified PCR product can be hybridized with the chip, and the other end of the correctly amplified PCR product has fluorescence, and can not be washed out to emit light correctly. Other nonspecific amplifications either do not hybridize or do not fluoresce and are therefore undetectable. Therefore, the invention does not need to do asymmetric PCR. The conventional gene chip, such as patent 201310533648.8, is characterized in that the specific primer and probe for CYP2C9 and VKORC1 gene chip detection is directly spotted on the chip by mutant and wild probes, only one base difference is needed, nonspecific hybridization is easy to cause, meanwhile, asymmetric PCR is needed to be performed to ensure that the maximum single strand for hybridization is needed, the greatest problem is that random upgrade cannot be performed, and once the locus is changed or one locus is added, hybridization conditions are needed to be developed and searched from new, and the chip is manufactured again.

Finally, it should also be noted that the above embodiments are merely representative of a few specific embodiments of the present invention. Obviously, the invention is not limited to the above embodiments, but many variations are possible. All modifications which can be directly derived or envisioned by one of ordinary skill in the art from the disclosure of the present invention, such as making the detection chip for 20-site detection, and changing the fluorescent modification to other biotin labels, FAM fluorescent labels, etc., are considered to be within the scope of the present invention.

<110> Chongqing dean medical test center Co., ltd

<120> a universal probe detection chip and application thereof

<160> 21

<210> 1

<211> 27

<212> DNA

<213> Synthesis

<400> 1

GGCTCCTGGA CTAAAGTTCT TGGGCTC 27

<210> 2

<211> 27

<212> DNA

<213> Synthesis

<400> 2

GGgTCCTGGA CTAtAGTTCT TGcGCTC 27

<210> 3

<211> 27

<212> DNA

<213> Synthesis

<400> 3

GGCaCCTGGA CTAAtGTTCT TGGcCTC 27

<210> 4

<211> 27

<212> DNA

<213> Synthesis

<400> 4

GGCTgCTGGA CTAAAcTTCT TGGGgTC 27

<210> 5

<211> 27

<212> DNA

<213> Synthesis

<400> 5

GGCTCgTGGA CTAAAGaTCT TGGGCaC 27

<210> 6

<211> 27

<212> DNA

<213> Synthesis

<400> 6

GGCTCCaGGA CTAAAGTaCT TGGGCTg 27

<210> 7

<211> 27

<212> DNA

<213> Synthesis

<400> 7

cGCTCCTcGA CTAAAGTTgT TGGGCTC 27

<210> 8

<211> 27

<212> DNA

<213> Synthesis

<400> 8

GcCTCCTGcA CTAAAGTTCa TGGGCTC 27

<210> 9

<211> 27

<212> DNA

<213> Synthesis

<400> 9

GGaTCCTGGt CTAAAGTTCT cGGGCTC 27

<210> 10

<211> 27

<212> DNA

<213> Synthesis

<400> 10

GGCgCCTGGA gTAAAGTTCT TcGGCTC 27

<210> 11

<211> 27

<212> DNA

<213> Synthesis

<400> 11

GGCTaCTGGA CgAAAGTTCT TGtGCTC 27

<210> 12

<211> 27

<212> DNA

<213> Synthesis

<400> 12

GGCTCaTGGA CTgAAGTTCT TGGtCTC 27

<210> 13

<211> 27

<212> DNA

<213> Synthesis

<400> 13

GGCTCCgGGA CTAgAGTTCT TGGGaTC 27

<210> 14

<211> 27

<212> DNA

<213> Synthesis

<400> 14

GGCTCCTaGA CTAAcGTTCT TGGGCgC 27

<210> 15

<211> 27

<212> DNA

<213> Synthesis

<400> 15

GGCTCCTGtA CTAAAtTTCT TGGGCTa 27

<210> 16

<211> 27

<212> DNA

<213> Synthesis

<400> 16

tGCTCCTGGg CTAAAGcTCT TGGGCTC 27

<210> 17

<211> 27

<212> DNA

<213> Synthesis

<400> 17

GtCTCCTGGA aTAAAGTgCT TGGGCTC 27

<210> 18

<211> 27

<212> DNA

<213> Synthesis

<400> 18

GGaTCCTGGA CgAAAGTTaT TGGGCTC 27

<210> 19

<211> 27

<212> DNA

<213> Synthesis

<400> 19

GGCgCCTGGA CTgAAGTTCg TGGGCTC 27

<210> 20

<211> 27

<212> DNA

<213> Synthesis

<400> 20

GGCTtCTGGA CTAgAGTTCT TaGGCTC 27

<210> 21

<211> 27

<212> DNA

<213> Synthesis

<400> 21

GGCTCgTGGA CTAAAcTTCT TGGcCTC 27

Claims (7)

1. A universal probe detection chip comprises probes, wherein the probes take an artificial DNA sequence 5'GGCTCCTGGACTAAAGTTCTTGGGCTC 3' (SEQ ID NO: 1) as a positive sequence probe, the positive sequence is taken as a template, a difference base is designed every 6-10 bases from 5' to obtain a wild type probe and a mutant type probe with at least 10 detection sites,

the sequences 5'-3' of the wild type probe and the mutant probe are as follows:

site 1-wild-type GGgTCCTGGACTAtAGTTCTTGcGCTC,

mutant GGCaCCTGGACTAAtGTTCTTGGcCTC;

site 2-wild-type GGCTgCTGGACTAAAcTTCTTGGGgTC,

mutant GGCTCgTGGACTAAAGaTCTTGGGCaC;

site 3-wild-type GGCTCCaGGACTAAAGTaCTTGGGCTg,

mutant cGCTCCTcGACTAAAGTTgTTGGGCTC;

site 4-wild-type GcCTCCTGcACTAAAGTTCaTGGGCTC,

mutant GGaTCCTGGtCTAAAGTTCTcGGGCTC;

site 5-wild-type GGCgCCTGGAgTAAAGTTCTTcGGCTC,

mutant GGCTaCTGGACgAAAGTTCTTGtGCTC;

site 6-wild-type GGCTCaTGGACTgAAGTTCTTGGtCTC,

mutant GGCTCCgGGACTAgAGTTCTTGGGaTC;

site 7-wild-type GGCTCCTaGACTAAcGTTCTTGGGCgC,

mutant GGCTCCTGtACTAAAtTTCTTGGGCTa;

site 8-wild-type tGCTCCTGGgCTAAAGcTCTTGGGCTC,

mutant GtCTCCTGGAaTAAAGTgCTTGGGCTC;

site 9-wild-type GGaTCCTGGACgAAAGTTaTTGGGCTC,

mutant GGCgCCTGGACTgAAGTTCgTGGGCTC;

site 10-wild-type GGCTtCTGGACTAgAGTTCTTaGGCTC,

mutant GGCTCgTGGACTAAAcTTCTTGGcCTC.

2. The test chip of claim 1, further comprising 15-20 additional C's in front of the mutant, wild-type, and positive sequences of the probe.

3. The test chip of claim 1, further comprising a glass slide, wherein the probes are spotted on the glass slide, wherein the mutant probe and the wild type probe have 10 test sites, respectively, and the positive sequence probe is a quality control site.

4. The test chip of claim 3, wherein the positive probe samples 3 quality control sites, each quality control site has 3 repeated spots, the mutant probe samples 10 test sites and the wild type probe samples 10 test sites, each test site repeats 3 spots, and the mutant probe test sites and the wild type probe test sites form a parallel matrix.

5. The assay chip of any one of claims 1-4, wherein the probes are diluted with a nuclease-free TE buffer prior to spotting, and mixed with a 2X hybridization solution, and subjected to prehybridization after spotting.

6. A method of detecting a SNP in a drug gene, comprising:

1) Extracting peripheral blood of a human body, and extracting whole-gene DNA;

2) Designing a primer of a drug gene to be detected through software, connecting a mutation probe or a wild type probe in front of the upper primer, and amplifying the DNA in the process 1);

3) Dripping the amplified product into a detection site and a quality control point on a detection chip for hybridization;

4) Analyzing the hybridization result of each sample, confirming the mutation SNP,

the drug gene is a drug gene for treating leukemia, in particular to a drug gene of TPMT 3C, NUDT, SLCO1B1 and/or MTHFR,

the method is a non-disease diagnostic method.

7. Use of the detection chip according to claims 1-5 for the manufacture of a kit for detecting SNPs of drug genes, in particular of TPMT x 3C, NUDT, SLCO1B1 and/or MTHFR, for the treatment of leukemia drug genes.