KR101145178B1 - Genetic marker combinations for prognosis on tramadol-induced nausea and vomiting - Google Patents

Abstract

The present invention relates to a combination of CYP2D6 and OPRM1 polymorphism markers for predicting tramadol-related vomiting side effects and a method for predicting tramadol-related side effects using the same, and more specifically, the activity-related genotype of CYP2D6, a major metabolic enzyme of active tramadol, and the 40th amino acid of OPRM1 protein. Certain combination marker groups (EM-GG, IM-AG) of polymorphic A118G (rs1799971), which change the sequence from asparagine to aspartic acid, reduce the risk of vomiting side effects of tramadol by the combination of specific genotypes of the two genes. Significantly associated with, it can be useful for predicting the genetic predisposition of the risk of predose side effects of tramadol-containing drugs.

Description

Genetic marker combinations for prognosis on tramadol-induced nausea and vomiting}

The present invention relates to a combination of tramadol vomiting side effects prognostic markers and a method for predicting the risk of tramadol-related side effects using the same.

Cytochrome P450 (CYP) is a member of enzymes that promote the oxidation of foreign substances and internal substrates such as drugs, carcinogens and environmental pollutants (Nelson et al., Pharmacogenesis 6: 1-42, 1996), clinically It is involved in the metabolism of various useful drugs, and exists in a complex form composed of several isoenzymes in the human body instead of a single form.

The activity of the CYP isozymes shows various differences for each. The differences in enzyme activity are mainly due to various genetic polymorphisms, including Single Nucleotide Polymorphisms (SNPs), and these differences in CYP isozymes are major factors leading to individual differences in blood drug concentrations. In some cases, it may cause serious side effects. Therefore, the evaluation of activity of CYP isozymes is very important and can be applied not only to academic fields such as drug interaction research and genotyping phenotyping but also industrial applications such as drug development (Flockhart DA, Psychopharmacology 9: 43-74, 2000).

In particular, the enzyme expressed in the CYP2D6 gene is only 2% of the total CYP enzyme (Shimada et al., JPET , 270; 414-423, 1994) but is involved in major metabolism of more than 100 drugs, including tramadol. The study of enemy polymorphism has been the longest and longest. The activity of this enzyme is very diverse and is divided into four active types in categories: poor metabolizer (PM), intermediate metabolizer (IM), extensible metabolizer (EM), and ultrarapid metabolizer (UM). Can also be separated (Gaedigk et al., Clin Pharmacol Ther , 83; 234-242, 2008). According to the polymorphism database (http://www.cypalleles.ki.se/cyp2d6.htm) of the Human Cytochrome P450 (CYP) Allele Nomenclature Committee, a total of 78 have been reported for the CYP2D6 genotype. This category of active forms and the most common pharmacogenetic genetic polymorphisms associated with them are widely used in many other literatures. For example, some CYP2D6 genotypes exhibit phenotypes with some decreased enzyme activity, such as CYP2D6 * 4, CYP2D6 * 10, and CYP2D6 * 17 (http://www.cypalleles.ki.se/). . Very few UM and PM types are known to occur in Asian races, including Koreans (less than 2%). In particular, the ratio of CYP2D6 * 10, which is a representative phenotype of some decrease in activity, is known to be very high (Sistonen et al., Pharmacogenet Genomics , 17 (2); 93-101, 2007).

Within the mu-opioid receptor (OPRM1) gene, which is known to be the target of the tramadol's main metabolite M1 and known to control vomiting, the 40-amino acid sequence of the OPRM1 protein is expressed in asparagine aspartate. It is reported that the polymorphic A118G (rs1799971) converts to an acid, and the expression of mRNA is reduced compared to the A allele for the G allele of this polymorphism (Zhang et al., J Biol Chem , 280 (30); 32618-32624, 2005). OPRM1 A118G, a short-term sequencing polymorphism, has been studied until recently, according to recent studies, homozygous-mutant type (GG), homozygous-wild type (AA) and heterozygous-mutant type (heterozygous-mutant type). It is reported that there is a difference in the amount of narcotic analgesics or analgesic response according to GA).

Pharmacological, toxicological and clinical studies of tramadol ((1RS, 2RS)-[(dimethylamino) -methyl] -1 (3-methoxyphenyl) cyclohexanol) show that tramadol is not a complete opioid and non- It has been described that it produces analgesic effects through mechanisms that are not opioid types (Driessen et al., Arch. Pharmacol., 341; R104, 1990). The main target of the opioid analgesic mechanism of tramadol is the mu-opioid receptor, which is associated with the typical side effects of the opioid agonists seen in many clinical outcomes, vomiting-related mechanisms (Gan et al., CNS Drugs, 21; 813; -833, 2007).

However, no association between polymorphic combination of CYP2D6 genetically active type and OPRM1 genotype expressing mu-opioid receptor and tramadol related vomiting side effects has been reported yet.

In this regard, the present inventors have conducted a genetic association study involving the incidence of vomiting adverse events and non-occurring groups, in which a specific combination of CYP2D6 and OPRM1 monobasic polymorphism (EM-GG or IM-AG) was induced by administration of tramadol medication. By reducing the risk of vomiting side effects, the present invention was completed by confirming that the combination of the two gene polymorphisms could be usefully used as a marker for predicting the genetic predisposition of side effects risk before administration of tramadol.

It is an object of the present invention to provide a combination of tramadol and vomiting side effects prognostic markers.

In order to achieve the above object, the present invention

1) separating the nucleic acid sample from the biological sample from the subject;

2) 31st base, 77th base, 100th base, 1611th base, 1661 of the cytochrome P450 2D6 (CYP2D6) gene having the nucleotide sequence shown in SEQ ID NO: 1 in the nucleic acid sample isolated in step 1) Base 1846, base 1850, base 2850, base 2988, base 4180; And identifying the 118th base of the mu-opioid receptor (OPRM1) gene having the nucleotide sequence set forth in SEQ ID NO: 2; And

3) The base of CYP2D6 identified in step 2) is * 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 118th of the OPRM1 gene with any combination selected from the group consisting of 35, * 1 / * 10, * 1 / * 41, * 2 / * 10, * 10 / * 39 and * 43 / * 41 When the allele of G / G is G / G, it provides a method for predicting the risk of tramadol-related vomiting side effects, comprising determining that the risk of tramadol-related vomiting side effects is low.

In addition, the present invention,

1) separating the nucleic acid sample from the biological sample from the subject;

2) 31st base, 77th base, 100th base, 1611th base, 1661 of the cytochrome P450 2D6 (CYP2D6) gene having the nucleotide sequence shown in SEQ ID NO: 1 in the nucleic acid sample isolated in step 1) Base 1846, base 1850, base 2850, base 2988, base 4180; And identifying the 118th base of the mu-opioid receptor (OPRM1) gene having the nucleotide sequence set forth in SEQ ID NO: 2; And

3) The base of CYP2D6 identified in step 2) is * 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * If there is any combination selected from the group consisting of 49, * 10 / * 4 and * 10 / * 5, and the 118th allele of the OPRM1 gene is A / G, the risk of tramadol-related vomiting side effects is low. A method of predicting the risk of tramadol-related vomiting side effects comprising the step of determining is provided.

In addition, the present invention is * 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 35, * 1 / * 10, At least one polynucleotide or complementary polynucleotide thereof hybridizing with any one of * 1 / * 41, * 2 / * 10, * 10 / * 39, or * 43 / * 41, set forth in SEQ ID NO: 2 Provided is a microarray chip for predicting the risk of tramadol-related vomiting side effects, including a polynucleotide hybridizing with the G / G of the 118th base of the OPRM1 gene having the nucleotide sequence of the present invention, or a polymorphic polynucleotide thereof.

In addition, the present invention is * 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * 49, * 10 / * 4 or a combination of the haplotypes shown in the following table Hybridizing with the A / G of the 118th base of the OPRM1 gene, which contains at least one of each polynucleotide or its complementary polynucleotide hybridizing with any one of * 10 / * 5, and having the nucleotide sequence set forth in SEQ ID NO: 2 Provided is a microarray chip for predicting the risk of tramadol-related vomiting side effects, comprising a polynucleotide or a complementary polynucleotide thereof.

In addition, the present invention provides a kit for predicting the risk of tramadol-related vomiting side effects, including the microarray chip.

In addition, the present invention is * 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 35, * 1 / * 10, Of an OPRM1 gene comprising one or more primer pairs to amplify any one of * 1 / * 41, * 2 / * 10, * 10 / * 39, or * 43 / * 41 and having the nucleotide sequence set forth in SEQ ID NO: 2 Provided is a kit for predicting the risk of tramadol-related vomiting side effects, comprising a primer pair that amplifies G / G of the 118th base.

In addition, the present invention is * 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * 49, * 10 / * 4 or a combination of the haplotypes shown in the following table Tramadol-related, comprising one or more primer pairs to amplify any one of * 10 / * 5 and comprising a pair of primers to amplify the A / G of the 118th base of the OPRM1 gene having the nucleotide sequence set forth in SEQ ID NO: 2 Provides a kit for predicting the risk of vomiting side effects.

In addition,

1) separating genomic DNA from a biological sample derived from the subject;

2) labeling the target sites of the CYP2D6 and OPRM1 genes with fluorescent materials while amplifying the polymerase chain reaction (PCR);

3) hybridizing the PCR reaction product labeled with the fluorescent material of step 2) with the microarray chip;

4) analyzing the reacted microarray chip;

5) confirming the hybridization in the analyzed data; And

6) When hybridization is confirmed, a method for predicting the risk of tramadol-related vomiting side effects, comprising determining that the risk of tramadol-related vomiting side effects is low.

In addition,

1) separating RNA from a biological sample from the subject;

2) performing reverse transcript polymerase chain reaction (RT-PCR) on the RNA of step 1) using a kit comprising the primer pair above;

3) confirming the gene expression of the PCR reaction product of step 2); And

4) When the gene expression is confirmed, it provides a method for predicting the risk of tramadol-related vomiting side effects, comprising determining that the risk of tramadol-related vomiting side effects is low.

The marker combining the CYP2D6 activity genotype and ORPM1 A118G polymorphism has a more significant relationship with the risk of vomiting side effects after tramadol dosing than the two types of genes, respectively. This can be useful for setting criteria.

1 is a diagram showing the incidence of vomiting side effects of the CYP2D6 and ORPM1 genotype combination group for each combination group.

Hereinafter, terms used in the present invention will be described.

Single Nucleotide Polymorphism (SNP) is the most frequent polymorph present in the human genome at a rate of about 0.1% (about 1 base to about 1000 bases). In other words, this monobasic polymorphism means a state in which, for example, the wild type is a GC base pair by replacing one base of the genomic gene with another base, whereas the polymorphism is an AT base pair. In addition, there exist cases where each allele of the double-stranded chromosome is polymorphic (homozygous polymorphism) and when one side is wild type and the other is polymorphic (heterozygote polymorphism). Such a single base variation may cause synthesis (nonsense variation) of incomplete protein due to codon mutation (synthesis of missed amino acid) or termination codon. Therefore, it is evident that the presence or absence of monobasic polymorphism is related to various diseases, and the importance of accurately determining the presence or absence of monobasic polymorphism (SNP typing) for the purpose of diagnosis or genetic therapy is strongly recognized. In addition, this monobasic polymorphism is also a useful polymorphic marker when searching for genes related to disease-prone properties or drug reactivity, and attracts attention as important genetic information for tailor-made medicine.

Hereinafter, the present invention will be described in detail.

The present invention

1) separating the nucleic acid sample from the biological sample from the subject;

2) 31st base, 77th base, 100th base, 1611th base, 1661 of the cytochrome P450 2D6 (CYP2D6) gene having the nucleotide sequence shown in SEQ ID NO: 1 in the nucleic acid sample isolated in step 1) Base 1846, base 1850, base 2850, base 2988, base 4180; And identifying the 118th base of the mu-opioid receptor (OPRM1) gene having the nucleotide sequence set forth in SEQ ID NO: 2, providing a method for predicting the risk of tramadol-related vomiting side effects.

The base of CYP2D6 identified in step 2) is * 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 35, 118th allele of OPRM1 gene with any combination selected from the group consisting of * 1 / * 10, * 1 / * 41, * 2 / * 10, * 10 / * 39 and * 43 / * 41 If the genotype is G / G, it can be determined that the risk of tramadol-related vomiting side effects is low.

The base of CYP2D6 identified in step 2) is * 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * 49, If any combination is selected from the group consisting of * 10 / * 4 and * 10 / * 5 and the 118th allele of the OPRM1 gene is A / G, the risk of tramadol-related vomiting side effects is low. Can be.

In the above method, the method of separating the nucleic acid from the biological sample of the subject may be through a method known in the art. For example, it can be done by directly purifying DNA from tissue or cells or by specifically amplifying and isolating specific regions using amplification methods such as PCR. The DNA is meant to include not only DNA but also cDNA synthesized from mRNA.

In this method, the determination of the nucleotide sequence of the isolated nucleic acid can be made by various methods known in the art. For example, a nucleotide of a polymorphic site is determined by the dideoxy method by hybridizing the probe or complementary probes comprising the sequence of the SNP site or through the determination of the nucleotide sequence of the nucleic acid with the DNA and measuring the degree of hybridization obtained therefrom. Methods for determining sequences may be used. The degree of hybridization may be achieved by, for example, labeling a detectable label on the target DNA to specifically detect only the hybridized target DNA, but other electrical signal detection methods may be used. Specifically, allele-specific probe hybridization, allele-specific amplification, sequencing, 5 'nuclease digestion, To a method selected from the group consisting of molecular beacon assay, oligonucleotide ligation assay, size analysis, and single-stranded conformation polymorphism. Can be performed by

The biological sample is preferably any one selected from the group consisting of blood, tissue, cells, serum, plasma, saliva, sputum, and urine, and more preferably, but not limited to blood.

Of the total 78 CYP2D6 genotypes reported to date (http://www.cypalleles.ki.se/cyp2d6.htm), the present inventors analyzed 39 genotypes in which the degree of enzymatic activity of genotypes was reported and after tramadol treatment. The relationship between the risk of vomiting and side effects was analyzed through a related study on the side-effect group.

First, the CYP2D6 gene fragment was derived from the pseudogenes CYP2D7 and CYP2D8P, which had similar sequences near the CYP2D6 gene, in 160 genomic DNAs of the osteoarthritis patients who completed the tramadol dosing treatment to analyze 39 genotypes. In order to isolate the presence of the deletion type and the number of replication of the already reported CYP2D6 gene, two-step PCR (Polymerase Chain Reaction) was performed. Subsequently, 35 mononucleotide polymorphisms were identified using the isolated CYP2D6 gene fragment, and only 10 genotypes were found in 154 genomes that were fully analyzed, and 17 genotype / genotype combinations were identified. The genotype / genotype combinations were found to be included in two active forms, both extensive metabolizer (EM) type and intermediate metabolizer (IM) type (see Table 3).

As a result of association analysis with the risk of vomiting side effects after administration of tramadol using the genotype-based predictive active form, the EM type, which is expected to have normal tramadol activity, is 3.4 times higher than the IM type, which is expected to have reduced tramadol activity. There was a risk of vomiting, which indicated that the metabolism of M1 coincided with the direction of vomiting risk based on the mechanism of action of the CYP2D6 enzyme involved in the production of tramadol's major active metabolite M1 (see Table 4).

The present inventors found that the 40th amino acid sequence of the mu-opioid receptor (OPRM1) protein expressed in the vomiting center, which is known to be the target of the main metabolite M1 of tramadol and is responsible for vomiting, is polymorphic A118G from asparagine to aspartic acid. Based on (rs1799971), polymorphism analysis of the OPRM1 gene from 193 subject genomic DNA revealed that GG homozygotes were strongly associated with a reduced risk of vomiting side effects (see Table 4).

Based on the above results, the present inventors have identified the CYP2D6 EM or IM genotype-based predictive active form to determine the association between the activity-related genotype of CYP2D6 and the risk of vomiting side effects of tramadol according to a specific combination of the polymorphism of OPRM1. The combination of the OPRM1 A118G (rs1799971) polymorphism was used to explore the groups with the highest risk of vomiting side effects. As a result, based on the CYP2D6 EM- OPRM1 AA combination group showing the most frequent side effects of vomiting, it was confirmed that the risk was significantly reduced in the EM-GG type or the IM-AG type (see Table 5 and FIG. 1). ).

Therefore, in association with the tramadol-related vomiting risk of side effects, the polymorphic combination marker group of CYP2D6 and OPRM1 (types EM-GG or IM-AG) is more significant than the association of each gene of CYP2D6 or OPRM1. As the relationship can be shown, polymorphic combinatorial markers of CYP2D6 and OPRM1 can be usefully used to predict the occurrence of tramadol-related vomiting side effects prior to administration of a tramadol-containing drug.

The present invention also provides a microarray chip for predicting the risk of tramadol-related vomiting side effects.

The microarray chip has * 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 35, * 1 / * 10, which are combinations of haplotypes shown in the following table. At least one polynucleotide or complementary polynucleotide thereof hybridizing with any one of * 1 / * 41, * 2 / * 10, * 10 / * 39, or * 43 / * 41, set forth in SEQ ID NO: 2 It is preferred to include polynucleotides or hybridized polynucleotides thereof that hybridize with G / G of the 118th base of the OPRM1 gene having the nucleotide sequence of interest.

The microarray chip is a combination of haploids shown in the following table: * 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * 49, * 10 / * 4 or Hybridizing with the A / G of the 118th base of the OPRM1 gene, which contains at least one of each polynucleotide or its complementary polynucleotide hybridizing with any one of * 10 / * 5, and having the nucleotide sequence set forth in SEQ ID NO: 2 It is preferred to include polynucleotides or complementary polynucleotides thereof, but not limited thereto.

Preferably, the polynucleotide or its complementary polynucleotide is a polynucleotide which is a fragment of a site including a target base of the CYP2D6 and OPRM1 genes or a polynucleotide complementary thereto, but is not limited thereto.

The microarray chip of the present invention can be manufactured by methods known to those skilled in the art. The method of manufacturing the microarray is as follows. In order to immobilize the probe on the substrate of the microarray using a probe DNA molecule, a micropipetting method using a piezoelectric method or a method using a pin-shaped spotter may be used. Preferred but not limited to use. The substrate of the microarray is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde (aldehyde). Do not. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto.

Specific combination marker group (EM type-) of polymorphic A118G (rs1799971) that changes the activity-related genotype (EM or IM) of CYP2D6, the major metabolic enzyme of active tramadol, and the 40th amino acid sequence of the OPRM1 protein from asparagine to aspartic acid. Since GG or IM-AG) is significantly associated with a reduced risk of vomiting side effects of tramadol, the combination of polymorphic markers of CYP2D6 and OPRM1 is useful as a microarray chip for predicting the genetic predisposition to the risk of predose side effects of tramadol drugs. Can be used.

The present invention also provides a kit for predicting the occurrence of tramadol-related vomiting side effects, including the microarray chip.

The kit may further include any one selected from the group consisting of streptavidin-alkali dephosphorase conjugate, chemilurorensce and chemiluminescent.

The kit is any one selected from the group of reaction reagents consisting of a buffer solution used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, dNTPs and rNTP (premixed or separated feed), a marker reagent, and a wash buffer solution. It may further include.

The present invention also provides a kit for predicting the risk of tramadol-related vomiting side effects, comprising a primer pair.

The kit is * 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 35, * 1 / * 10, * 1 which are combinations of haplotypes listed in the table below 118th of the OPRM1 gene which contains one or more primer pairs to amplify any one of / * 41, * 2 / * 10, * 10 / * 39 or * 43 / * 41 and has the nucleotide sequence set forth in SEQ ID NO: 2 It is preferred to include a primer pair that amplifies G / G of the base, but is not limited thereto.

The kit is * 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * 49, * 10 / * 4 or * 10 which is a combination of haplotypes listed in the table below / * One or more primer pairs to amplify any one of, and preferably comprises a primer pair to amplify the A / G of the 118th base of the OPRM1 gene having the nucleotide sequence set forth in SEQ ID NO: 2 It doesn't work.

The primer pair is not limited in size and position of binding to the template as long as it can amplify the polymorphic site, which is a target site, and a person skilled in the art can easily design a primer using conventional primer selection software.

The kit may further include any one or more selected from the group of reverse reagents for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), DNA polymerase, and a wash buffer solution. .

Specific combination marker group (EM type-GG or IM type-AG) of polymorphic A118G (rs1799971) that changes the activity-related genotype of CYP2D6, the major metabolic enzyme of active tramadol, and the 40th amino acid sequence of OPRM1 protein from asparagine to aspartic acid Is significantly associated with a reduced risk of vomiting side effects of tramadol, the polymorphic marker combination of CYP2D6 and OPRM1 can be usefully used as a kit for predicting the genetic predisposition of the risk of predose side effects of tramadol drugs.

The present invention also provides a method for predicting the occurrence of tramadol-related vomiting side effects.

Specifically, the method

1) separating genomic DNA from a biological sample derived from the subject;

2) labeling the target sites of the CYP2D6 and OPRM1 genes with fluorescent materials while amplifying the polymerase chain reaction (PCR);

3) hybridizing the PCR reaction product labeled with the fluorescent material of step 2) with the microarray chip;

4) analyzing the reacted microarray chip;

5) confirming the hybridization in the analyzed data; And

6) If hybridization is identified, preferably, but not limited to, determining that the risk of tramadol-related vomiting side effects is low.

In the above method, the risk of step 6) is preferably 10% or less and more preferably 5% or less of tramadol-related vomiting side effects.

In the method, the fluorescent material of step 2) is preferably selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). It is not limited to this.

In the method, the biological sample is preferably any one selected from the group consisting of blood, tissue, cells, serum, plasma, saliva, sputum, and urine, and more preferably, but not limited to blood.

In the method, the subject means all animals such as humans, monkeys, dogs, goats, pigs, or mice.

In addition, the method,

1) separating RNA from a biological sample from the subject;

2) performing reverse transcript polymerase chain reaction (RT-PCR) on the RNA of step 1) using a kit comprising the primer pair above;

3) confirming the gene expression of the PCR reaction product of step 2); And

4) When the gene expression is confirmed, preferably comprising the step of determining that the risk of tramadol-related vomiting side effects is low, but is not limited thereto.

In the above method, the risk of step 4) is preferably 10% or less and more preferably 5% or less of tramadol-related vomiting side effects.

In the method, the biological sample is preferably any one selected from the group consisting of blood, tissue, cells, serum, plasma, saliva, sputum, and urine, and more preferably, but not limited to blood.

In the method, the subject means all animals such as humans, monkeys, dogs, goats, pigs, or mice.

Specific combination marker group (EM type-GG or IM type-AG) of polymorphic A118G (rs1799971) that changes the activity-related genotype of CYP2D6, the major metabolic enzyme of active tramadol, and the 40th amino acid sequence of OPRM1 protein from asparagine to aspartic acid Since the combination of CYP2D6 and OPRM1 polymorphism markers significantly predicts the genetic predisposition of the risk of adverse side effects of tramadol medication, the combination of CYP2D6 and OPRM1 is useful for predicting the incidence of vomiting side effects caused by tramadol. Can be used.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Study subject

The present invention analyzes side effects after tramadol / acetaaminophen administration in Korean osteoarthritis patients group for 2 weeks (Choi et al., Clin Based on Ther , 29 (7); 1381-1389, 2007), a total of 193 genomic DNAs were included in the previous study. The blood of the subject was Hanyang University Hospital, Chung-Ang University Hospital, Kyungpook National University Hospital, Ewha Womans University Hospital, Daegu Catholic University Hospital, Yeungnam University Hospital, Ajou University Hospital, Dong-A University Hospital, Hallym University Hospital. Collected with approval. The main adverse effects reported were vomiting (vomiting and nausea), dizziness, and constipation.They were based on the 54 incidence groups with the highest frequency of vomiting and 106 incidence of no side effects. Association analysis was performed. Specifically, Puregene ^™ in blood samples obtained from the study subjects Genomic DNA was extracted using a DNA purification kit (Gentra, Minneapolis, MN). The extracted DNA was measured using a PicoGreen (Molecular Probes, Eugene, OR) fluorescent dye that specifically quantifies only double-stranded DNA, and then stored at a concentration of 2.510 ng / μl suitable for genotyping.

<2-1> Selection of Gene Polymorphism

Among the 78 CYP2D6 genotypes reported so far in the polymorphic database (http://www.cypalleles.ki.se/cyp2d6.htm) of the Human Cytochrome P450 (CYP) Allele Nomenclature Committee, to date genotypes 39 genotypes ( * 1 , * 2 , * 3 , * 4 , * 5 , * 7 , * 8 , * 9 , * 10 , * 11 , * 12 , * 14 , * 15 , * 17 , * 19 , * 20 , * 21 , * 23 , * 26 , * 27 , * 28 , * 29 , * 30 , * 32 , * 33 , * 34 , * 35 , * 38 , * 39 , * 40 , * 41 , * 42 , * 43 , * 44 , * 49 , * 56 , * 58 , * 59 , * 62 ) were selected for analysis, and OPRM1 A118G polymorphism (rs1799971) was associated with mRNA expression function. Since it was revealed, it was selected as an analysis target.

<2-2> Genotyping Genotyping )

In CYO2D6 gene for the determination of the selection of 39 genotypes in Example <2-1>, CYP2D6 gene and the deletion type 35 polymorphism (19G> A, 31G> A , 77G> A, 100C> T, 124G> A, 138-139insT, 883G> C, 957C> T, 1023C> T, 1611T> A, 1661G> C, 1758G> T, 1846G> A, 1863-1864insTTTCGCCCC, 1943G> A, 1973-1974insG, 2291G> A, 2483G> T, 2539-2542delAACT, 2549delA, 2573-2574insC, 2587-2590delGACT, 2613-2615delAGA, 2850C> T, 2935A> C, 2950G> C, 2988G> A, 3183G> A, 3201C> T, 3259-3260insGT, 3277C> T, 3790C> T, 3853G> A, 4044C> T, 4180G> C) (reference sequences and polymorphic positions for all genotyping based on GenBank M33388). In order to confirm the presence of the copy number of the CYP2D6 gene, PCR was performed using 50-100 ng of genomic DNA. First, to confirm the gene deletion type, as shown in Table 1 below, the previously known Dup1F and DPKlow primer (when 4.8 kb DNA fragment is present in absence of deletion), cyp-13 and cyp-24 primer (in deletion present) 3.5 kb DNA fragments were used, and cyp-17 and cyp-32 primers (3.6 kb fragments were present in the presence of duplicates) were used to determine the number of gene copies (Sheng et al., Acta) . Pharmacol Sin , 28 (2); 279-286, 2007, Johansson et al., Pharmacogenetics , 6 (4); 351-355, 1996, Steen et al., 5 (4); 215-223, 1995). To analyze polymorphisms in the CYP2D6 gene, a 4.8 kb sized CYP2D6 gene fragment was isolated from the surrounding high CYP2D7 and CYP2D8P genes, wherein Dup1F and DPKlow primers were used. After the PCR reaction, only amplified samples were separated using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).

Primer Sequences for CYP2D6 Gene Deletion and Replication Number Analysis Primer Name order DuplF 5'-CCCATTTGGTAGTGAGGCAGGT-3 '(SEQ ID NO: 3) DPKlow 5'-GCCGACTGAGCCCTGGGAGGTAGGTA-3 '(SEQ ID NO: 4) cyp-13 5'-ACCGGGCACCTGTACTCCTCA-3 '(SEQ ID NO: 5) cyp-24 5'-GCATGAGCTAAGGCACCCAGAC-3 '(SEQ ID NO: 6) cyp-17 5'-TCCCCCACTGACCCAACTCT-3 '(SEQ ID NO: 7) cyp-32 5'-CACGTGCAGGGCACCTAGAT-3 '(SEQ ID NO: 8)

Subsequently, genotypes of CYP2D6 and OPRM1 polymorphisms were determined using MassARRAY ^TM using MALDI-TOF mass spectrometry. The system (Sequenom, San Diego, CA) was analyzed. Primers for polymerase chain reaction (PCR) and primer sequences for extension reaction used in the analysis are shown in Table 2 below. Primers used for genotyping were designed using Assay Design 3.1 (Sequenom, San Diego, CA) program.

Primer Sequences for Polymorphism Analysis Polymorphism Amplification_Forward Amplification Prolonged reaction 19G> A ACGTTGGATGTGTCCAGAGGAGCCCATTTG (SEQ ID NO: 9) ACGTTGGATGCGAAGCAGTATGGTGTGTTC (SEQ ID NO: 10) ATGGGGCTAGAAGCACTG (SEQ ID NO: 11) 31G> A GAAGATGGCCACTATCA (SEQ ID NO: 12) 77G> A TAGCGTGCAGCCCAGCGTTGG (SEQ ID NO: 13) 100C> T AACGCTGGGCTGCACGCTAC (SEQ ID NO: 14) 124G> A AGGCCCCCTGCCACTGCCC (SEQ ID NO: 15) 138_139insT TGTTCTGGAAGTCCACATGCAG (SEQ ID NO: 16) 883G> C ACGTTGGATGAAATCTGTCTCTGTCCCCAC (SEQ ID NO: 17) ACGTTGGATGTTGACAAGAGGCCCTGACC (SEQ ID NO: 18) CCCTGACCCTCCCTCTGCA (SEQ ID NO: 19) 957C> T CAGCGCCTCGCGCACGGCC (SEQ ID NO: 20) 1023C> T CCTTGGGAACGCGGCCC (SEQ ID NO: 21) 1611T> A ACGTTGGATGTAATGCCTTCATGGCCACGC (SEQ ID NO: 22) ACGTTGGATGTTCCCAGTTCCCGCTTTGTG (SEQ ID NO: 23) GGCCCATAGCGCGCCAGGA (SEQ ID NO: 24) 1661G> C GCAGAGGCGCTTCTCCGT (SEQ ID NO: 25) 1758G> T TGCCCTTCTGCCCATCACCCAC (SEQ ID NO: 26) 1846G> A ACGTTGGATGACAAAGCGGGAACTGGGAAG (SEQ ID NO: 27) ACGTTGGATGAGAAAGCCCGACTCCTCCTT (SEQ ID NO 28) CGCATCTCCCACCCCCA (SEQ ID NO: 29) 1863__1864ins aaatGACGCCCCTTTCGCCCC (SEQ ID NO: 30) 1943G> A gTAGGTCCAGCAGCCTGAGGAAG (SEQ ID NO: 31) 1973_1974insG CCGACTCCTCCTTCAGTCCC (SEQ ID NO: 32) 2291G> A ACGTTGGATGAGGACTCTGTACCTCCTATC (SEQ ID NO: 33) ACGTTGGATGTCTCAATCCCTCCTGTGCTC (SEQ ID NO: 34) caCAAGTGCCAGCCTCCAC (SEQ ID NO 35) 2483G> T ACGTTGGATGATTCCTCCTGGGACGCTCAA (SEQ ID NO: 36) ACGTTGGATGTCTGGTGTAGGTGCTGAATG (SEQ ID NO: 37) AGCGTAGGACCTTGCCAG (SEQ ID NO: 38) 2539_2542del CCCAGCTGGATGAGCTGCT (SEQ ID NO: 39) 2549delA TGGGTCCCAGGTCATCC (SEQ ID NO: 40) 2573_2574insC CCAGCCCAGCCCCCCCC (SEQ ID NO: 41) 2587_2590del TGCCAGGAAGGCCTCAG (SEQ ID NO: 42) 2613_2615del AGA GGCAGCCACTCTCACCT (SEQ ID NO: 43) 2850C> T ACGTTGGATGTTACAGGATCCTGGTCAAGC (SEQ ID NO: 44) ACGTTGGATGAGAGCAGCTTCAATGATGAG (SEQ ID NO: 45) CTTCAATGATGAGAACCTG (SEQ ID NO: 46) 2935A> C gCCTGCTCATGATCCTAC (SEQ ID NO: 47) 2950G> C TTTCCCAGATGGGCTCA (SEQ ID NO 48) 2988G> A gaCCCCCGCCTGTACCCTT (SEQ ID NO: 49) 3183G> A ACGTTGGATGCAAGAAGGAGTGTCAGGGC (SEQ ID NO: 50) ACGTTGGATGTGTCACGGGATGTCATATGG (SEQ ID NO: 51) CCGCACCTGCCCTATCA (SEQ ID NO: 52) 3201C> T AGCCTGGTCACCCATCTCTGGTC (SEQ ID NO: 53) 3259_3260ins ttgttTCCCCAAAGCGCTGCAC (SEQ ID NO: 54) 3277T> C GCAGCGCTTTGGGGACA (SEQ ID NO: 55) 3790C> T ACGTTGGATGTGCTGAGAAAGGCAGGAAGG (SEQ ID NO: 56) ACGTTGGATGACTAGTTGACAGAGTCCAGC (SEQ ID NO: 57) CTCTCACCCTGCATCTC (SEQ ID NO 58) 3853G> A GAAGGATGAGGCCGTCTGG (SEQ ID NO: 59) 4044C> T ACGTTGGATGACAGCACAAAGCTCATAGGG (SEQ ID NO: 60) ACGTTGGATGTTCCGTGGAGTCTTGCAGG (SEQ ID NO: 61) CCCTCCCCACAGGCCGC (SEQ ID NO: 62) 4180G> C CTTTGCTTTCCTGGTGA (SEQ ID NO: 63)

The PCR reaction was carried out in a 5 μl solution in which 200 nM of the PCR primers of Table 2 were added to 2.5 ng genomic DNA, 1 × buffer, 1 mM MgCl ₂ , 200 uM dNTP mixture, and 0.1 unit HotStart Taq polymerase mixture. The reaction conditions were initial denatured at 94 ° C. for 15 minutes, followed by 45 cycles of 94 ° C. 20 seconds, 56 ° C. 30 seconds, and 72 ° C. for 1 minute, and a final extension step at 72 ° C. for 3 minutes. After the PCR reaction, 0.3 unit of SAP (shrimp alkaline phosphatase) was added and the remaining dNTP was removed by incubation at 37 ° C. for 20 minutes and 85 ° C. for 5 minutes. iPlex extension reaction was carried out by adding 50 uM dNTP terminator mix, 625 nM extension primer mix and 0.5 unit thermo sequenase enzyme to the reaction product. After 30 seconds of initial denaturation at 94 ° C., a short cycle of 94 ° C. 5 seconds, 52 ° C. 5 seconds, and 80 ° C. 5 seconds was repeated 40 times. After 16 μl of distilled water and 3 mg of Clean Resin were added, the final reaction product was transferred to SpectroChip and genotyped by an iPlex mass spectrometer. Subsequently, to analyze the genotype of CYP2D6 , genotype was reconstructed on the same principle as haplotype using PHASE 2.1 program based on the 35 polymorphisms analyzed, and a total of 10 genotypes appeared. It is known that CYP2D6 enzyme activity of tramadol metabolism can be predicted based on the CYP2D6 genotype (Pedersen et al., Clin Pharmacol Ther, 77 (6); 458-467, 2005). Therefore, based on these reports, the combination of normal activity genotype / normal activity genotype, normal activity genotype / reduced activity genotype was defined as EM type, and normal activity genotype / inactivity genotype, reduced activity genotype 2, reduced activity The combination of genotype / inactivity genotype was defined as IM type.

As a result, according to the genotype / genotype analysis, the frequency of * 1 / * 10 , which is a combination of the normal genotype * 1 and * 10 genotype showing reduced activity, was the highest at 34.4%. The frequency and expected activity of each genotype was shown in Table 3 below.

Definition of CYP2D6 genotype frequency and activity CYP2D6
genotype Genotype activity Gun target
(n = 160) Vomiting side effect group
(n = 54) Vomiting Side Effects
U.S. outbreak
(n = 106) Expected activity * 1 / * 1 ○ / ○ 22 6 16 EM * 1 / * 2 ○ / ○ 10 2 8 EM * 1 / * 39 ○ / ○ 3 One 2 EM * 2 / * 2 ○ / ○ 3 0 3 EM * 2 / * 35 ○ / ○ One One 0 EM * 1 / * 10 ○ / △ 55 29 26 EM * 1 / * 41 ○ / △ 3 One 2 EM * 2 / * 10 ○ / △ 9 3 6 EM * 10 / * 39 ○ / △ 2 One One EM * 43 / * 41 ○ / △ One One 0 EM * 1 / * 5 ○ / X One One 0 IM * 2 / * 5 ○ / X 3 One 2 IM * 10 / * 10 △ / △ 23 2 21 IM * 10 / * 41 △ / △ 2 0 2 IM * 10 / * 49 △ / △ 4 2 2 IM * 10 / * 4 △ / X One 0 One IM * 10 / * 5 △ / X 11 2 9 IM * 10 /? △ /? 3 One 2 - ? /? ? /? One 0 One - * 1 / * 10 /? ○ / △ /? One 0 One -

CYP2D6  Active genotypes OPRM1  A118G polymorphic Tramadol  Risk of vomiting side effects after dosing

For statistical analysis, the Hardy-Weinberg equilibrium (HWE) was analyzed using the chi-square independence test, and then logistic regression analysis was used to correct the gender and age differences between the adverse and non-adverse groups. The relationship between the risk of adverse events after tramadol administration and each polymorphism was analyzed. Fisher's comprehensive test was then used to analyze the risk of polymorphic combinations, and the SPSS 15 program was used for all statistical analyzes.

As a result, as shown in Table 4, in the case of IM type, which is expected to decrease the tramadol activity of CYP2D6, the risk of vomiting was 71% lower than that of EM type, which is expected to have normal tramadol activity (Odd Ratio = 0.29, 95% CI). = 0.12-0.69, P = 0.0051). The AA genotype (R40) of OPRM1 A118G showed 84% lower risk of vomiting than the GG genotype (D40) (OR = 0.16, 95% CI = 0.03-0.78, P = 0.024).

Thus, the association between vomiting risk after each genotype of tramadol for both genes was found to be statistically significant. On the other hand, no significant difference was observed for the AG genotype because of its relatively low statistical power (25%).

Association of risk of vomiting side effects of CYP2D6 and ORPM1 genotypes genotype throw up
Side Effect
Outbreak group throw up
Side Effect
Unoccupied group OR
(95% CI) P Statistical Verification Power CYP2D6 Activity (n = 53) (n = 101) EM type 45 (85%) 64 (63%) 1.00 - - IM type  8 (15%) 37 (37%) 0.29 (0.12-0.69) 0.0051 84% OPRM1 A118G (n = 54) (n = 106) A / A 25 (46%) 36 (34%) 1.00 - - A / G 27 (50%) 55 (52%) 0.61 (0.30-1.27) 0.20 25% G / G  2 (4%) 15 (14%) 0.16 (0.03-0.78) 0.024 55%

CYP2D6 EM Of IM  Active and OPRM1 Combination of A118G Polymorphism

The combination of CYP2D6 EM / IM type and OPRM1 A118G polymorphism identified the highest risk group of vomiting after tramadol administration.

As a result, as shown in Table 5 and FIG. 1, the frequency of vomiting in each combination group was 89% lower in the risk of vomiting in the EM type / GG group based on the EM type / AA group with the highest frequency of vomiting. (OR = 0.11, 95% CI = 0.01-0.90, P = 0.020). In the IM / AG group, vomiting risk was the lowest as 95% (OR = 0.05, 95% CI = 0.01-0.43, P = 0.00047). No significant difference was observed in the IM / GG group because of the relatively low statistical power (13%).

Therefore, it was confirmed that the risk of vomiting side effects after tramadol administration of the EM type / GG group and IM type / AG group was the lowest, and the risk of vomiting after tramadol administration in the other combination groups was relatively high.

CYP2D6 And ORPM1 Association analysis of vomiting side effects risk of genotype combination markers throw up
Side effect group
(n = 53) throw up
Side Effect
U.S. outbreak
(n = 101) OR P Statistical
Power CYP2D6 genotype EM type OPRM1
A118G
genotype AA 18 (46.2) 21 (53.8) One AG 26 (44.8) 32 (55.2) 0.95 (0.42-2.14) One 68% GG 1 (8.3) 11 (91.7) 0.11 (0.01-0.90) 0.02 58% IM type OPRM1
A118G
genotype AA 6 (35.3) 11 (64.7) 0.64 (0.20-2.10) 0.562 25% AG 1 (4.3) 22 (95.7) 0.05 (0.01-0.43) 0.00047 51% GG 1 (20.2) 4 (80.0) 0.29 (0.03-2.85) 0.37 13%

As described above, in the combination of CYP2D6 and OPRM1 polymorphism for predicting tramadol-related vomiting side effects of the present invention, the side effects of vomiting induced by tramatol were low, so the combination of the CYP2D6 and OPRM1 polymorphism markers predicted and administered the risk of adverse effects before tramadol administration. It can be usefully used in the development and manufacture of kits for the determination of.

Attach an electronic file to a sequence list

Claims (19)

1) separating the nucleic acid sample from the biological sample from the subject;
2) 31st base, 77th base, 100th base, 1611th base, 1661 of the cytochrome P450 2D6 (CYP2D6) gene having the nucleotide sequence shown in SEQ ID NO: 1 in the nucleic acid sample isolated in step 1) Base 1846, base 1850, base 2850, base 2988, base 4180; And identifying the 118th base of the mu-opioid receptor (OPRM1) gene having the nucleotide sequence set forth in SEQ ID NO: 2; And
3) The base of CYP2D6 identified in step 2) is * 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 118th of the OPRM1 gene with any combination selected from the group consisting of 35, * 1 / * 10, * 1 / * 41, * 2 / * 10, * 10 / * 39 and * 43 / * 41 And determining that the risk of tramadol-related vomiting side effects is low if the allele of is G / G.

1) separating the nucleic acid sample from the biological sample from the subject;
2) 31st base, 77th base, 100th base, 1611th base, 1661 of the cytochrome P450 2D6 (CYP2D6) gene having the nucleotide sequence shown in SEQ ID NO: 1 in the nucleic acid sample isolated in step 1) Base 1846, base 1850, base 2850, base 2988, base 4180; And identifying the 118th base of the mu-opioid receptor (OPRM1) gene having the nucleotide sequence set forth in SEQ ID NO: 2; And
3) The base of CYP2D6 identified in step 2) is * 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * If there is any combination selected from the group consisting of 49, * 10 / * 4 and * 10 / * 5, and the 118th allele of the OPRM1 gene is A / G, the risk of tramadol-related vomiting side effects is low. A method of providing information to predict the risk of tramadol-related vomiting side effects comprising the step of determining.

The method according to claim 1 or 2, wherein step 2) comprises hybridization by microarray, allele-specific probe hybridization, and allele-specific amplification. ), Sequencing, 5 'nuclease digestion, molecular beacon assay, oligonucleotide ligation assay, size analysis And a single-stranded conformation polymorphism.
The method of claim 1 or 2, wherein the biological sample is any one selected from the group consisting of blood, tissue, cells, serum, plasma, saliva, sputum and urine.
* 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 35, * 1 / * 10, * 1 / * 41 which are combinations of haplotypes shown in the following table , At least one of each polynucleotide or a complementary polynucleotide thereof hybridizing with any one of * 2 / * 10, * 10 / * 39 or * 43 / * 41, and having a nucleotide sequence as set forth in SEQ ID NO: 2. A microarray chip for predicting the risk of tramadol-related vomiting side effects, comprising a polynucleotide hybridizing with the G / G of the 118th base of the OPRM1 gene or a polymorphic polynucleotide thereof.

* 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * 49, * 10 / * 4 or * 10 / * 5, which are combinations of haplotypes listed in the table below A polynucleotide comprising at least one of each polynucleotide or a complementary polynucleotide thereof hybridizing with any one thereof, and hybridizing with the A / G of the 118th base of the OPRM1 gene having the nucleotide sequence set forth in SEQ ID NO: 2, or a complement thereof A microarray chip for predicting the risk of tramadol-related vomiting side effects, comprising red polynucleotides.

A kit for predicting the risk of tramadol-related vomiting side effects, comprising the microarray chip of claim 5.
8. The method of claim 7, further comprising any one selected from the group consisting of a streptadin-like phosphatease conjugate, a chemiflurorensce, and a chemiluminescent material. Kit characterized by the above.
8. The method of claim 7, wherein the reaction reagent is selected from the group of buffers used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, dNTPs and rNTPs (premixed or separated feed), labeling reagents, and wash buffers. Kit comprising any one further.
* 1 / * 1, * 1 / * 2, * 1 / * 39, * 2 / * 2, * 2 / * 35, * 1 / * 10, * 1 / * 41 which are combinations of haplotypes shown in the following table G of the 118th base of the OPRM1 gene comprising at least one primer pair that amplifies any one of * 2 / * 10, * 10 / * 39 or * 43 / * 41, and having the nucleotide sequence set forth in SEQ ID NO: 2 A kit for predicting the risk of tramadol-related vomiting side effects, comprising a primer pair that amplifies / G.

* 1 / * 5, * 2 / * 5, * 10 / * 10, * 10 / * 41, * 10 / * 49, * 10 / * 4 or * 10 / * 5, which are combinations of haplotypes listed in the table below Predicting the risk of tramadol-related vomiting side effects comprising at least one primer pair that amplifies any of the above, and comprising a primer pair that amplifies the A / G of the 118th base of the OPRM1 gene having the nucleotide sequence set forth in SEQ ID NO: 2 Kit.

The method according to claim 10 or 11, wherein any one selected from the group of reverse transcriptases for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), DNA polymerase, and a wash buffer solution. Kit comprising the above additionally.
1) separating genomic DNA from a biological sample derived from the subject;
2) labeling the target site of claim 1 of the CYP2D6 and OPRM1 genes with fluorescent materials while amplifying the polymerase chain reaction (PCR);
3) hybridizing the PCR reaction product labeled with the fluorescent material of step 2) with the microarray chip of claim 5 or 6;
4) analyzing the reacted microarray chip;
5) confirming the hybridization in the analyzed data; And
6) A method of providing information to predict the risk of tramadol-related vomiting side effects, comprising determining that the hybridization is confirmed, the risk of tramadol-related vomiting side effects is low.
14. The method of claim 13, wherein the risk of step 6) is that the incidence of tramadol-related vomiting side effects is 10% or less.
The method of claim 13, wherein the fluorescent material of step 2) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). How to.
1) separating RNA from a biological sample from the subject;
2) performing reverse transcript polymerase chain reaction (RT-PCR) using the RNA of step 1) using the kit of claim 10;
3) confirming the gene expression of the PCR reaction product of step 2); And
4) providing information to predict the risk of tramadol-related vomiting side effects, comprising determining that the risk of tramadol-related vomiting side effects is low when gene expression is identified.
17. The method of claim 16, wherein the risk in step 4) is less than 10% incidence of tramadol-related vomiting side effects.
The method of claim 13, wherein the biological sample is any one selected from the group consisting of blood, tissue, cells, serum, plasma, saliva, sputum, and urine.
The method of claim 16, wherein the biological sample is any one selected from the group consisting of blood, tissue, cells, serum, plasma, saliva, sputum, and urine.

Images