CN114350846A

CN114350846A - Primer group and kit for combined detection of multiple pulmonary infection fungi

Info

Publication number: CN114350846A
Application number: CN202210093716.5A
Authority: CN
Inventors: 张祥林; 张劲松; 侯艳雯; 魏鹏; 陈晨; 胡秋萍
Original assignee: Chongqing Pasteur Biomedical Technology Co ltd
Current assignee: Chongqing Pasteur Biomedical Technology Co ltd
Priority date: 2022-01-26
Filing date: 2022-01-26
Publication date: 2022-04-15
Anticipated expiration: 2042-01-26
Also published as: CN114350846B

Abstract

The invention relates to the technical field of biology, in particular to a primer group and a kit for jointly detecting various pulmonary infection fungi. The kit comprises a multiplex PCR reactant, and the multiplex PCR reactant comprises the PCR primer group. The primer group and the kit can jointly detect seven kinds of lung infectious fungi by combining multiplex PCR with a capillary fragment analysis method, and the method has the advantages of simple operation, accurate detection, high flux, high sensitivity and high specificity, obviously shortens the detection time and can realize the detection result within 2-3 hours.

Description

Primer group and kit for combined detection of multiple pulmonary infection fungi

Technical Field

The invention relates to the technical field of biology, in particular to a primer group and a kit for combined detection of various pulmonary infection fungi.

Background

Fungi are widely distributed in the natural environment, are common bacteria planted on the surfaces of human skin and mucosa, and live together with human beings by avoiding the human immune system. However, in the event of an impaired immune system or a breakdown in host barrier, fungi can invade the body, resulting in a lethal infection. Invasive Pulmonary Fungal Infection (IPFI) is a Fungal Infection of the bronchopulmonary area that does not include Fungal parasitism and allergies, and is classified into two types, primary and secondary. In recent years, the incidence of invasive pulmonary fungal infection has gradually increased with the aging population, the use of immunosuppressive agents for organ transplantation, radiotherapy and chemotherapy for tumors, hematopoietic stem cell transplantation, the combined application of ultra-broad-spectrum antibiotics and multiple antibiotics, the use of corticosteroid hormones, various catheter interventional therapies and the like. The fungi commonly responsible for invasive pulmonary fungal infections are primarily Candida, Aspergillus, Cryptococcus, Zygomyces (primarily Mucor), and pneumocystis. Because the pulmonary fungal infection is often non-specific in clinical manifestation, early diagnosis is difficult, and the condition of the disease is easily covered by basic diseases, so misdiagnosis and missed diagnosis are caused, and treatment is delayed. Accurate and timely diagnosis of pulmonary fungal infection relies on laboratory test results.

Common laboratory detection methods for pulmonary fungal infections include: direct microscopy, histopathological examination, fungal culture, serological examination (1, 3-beta-D glucan assay, galactomannan assay, cryptococcus capsular polysaccharide antigen assay, Aspergillus antibody, etc.), imaging examination, molecular biology methods based on nucleic acid detection, and the like. At present, histopathological examination remains the "gold standard" for the diagnosis of fungal infections. But it is difficult for the patient to tolerate as it is an invasive procedure. The result is limited by the accuracy of material selection and low positive rate. The diagnosis result is long in time consumption after a series of experimental processes, and is not beneficial to early diagnosis. Direct microscopy is the most classical method, has the characteristics of rapidness and convenience, but has low positive rate. The traditional fungus culture method needs at least 3-5 days and even longer time, and has low sensitivity and is not beneficial to early diagnosis. The antigen detection has better specificity, but has lower sensitivity and often has false negative. Antibody detection has limited significance for early diagnosis of invasive pulmonary fungal infection. Molecular biological methods, represented by the fluorescent quantitative PCR technique, have gradually become important methods for diagnosing invasive pulmonary fungal infections. Although the fluorescent quantitative PCR has high specificity, sensitivity and timeliness, the following disadvantages exist: (1) the flux is low: limited by fluorescent channels, a single tube can detect only 3 fungi; (2) the cost is high: and multiple fungi are detected simultaneously, so that the cost is high.

Disclosure of Invention

In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a primer set and a kit for combined detection of various pulmonary infection fungi, which are used for solving the problems in the prior art.

In order to achieve the above objects and other related objects, the present invention provides a PCR primer set for combined detection of various pulmonary infectious fungi, wherein the PCR primer set comprises a candida albicans detection primer pair, a candida tropicalis detection primer pair, a candida glabrata detection primer pair, an aspergillus fumigatus detection primer pair, an aspergillus flavus detection primer pair, an aspergillus niger detection primer pair, and a cryptococcus neoformans detection primer pair.

Preferably, the PCR primer set further comprises the following features:

1) candida albicans detection primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2;

2) candida tropicalis detection primer pairs: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.3 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 4;

3) candida glabrata detection primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.5 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 6;

4) aspergillus fumigatus detection primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.7 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 8;

5) aspergillus flavus detection primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.9 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 10;

6) an Aspergillus niger detection primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.11 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 12;

7) novel cryptococcus detection primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.13 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 14.

The invention also provides application of the PCR primer group in preparation of a kit for detecting candida albicans, candida tropicalis, candida glabrata, aspergillus fumigatus, aspergillus flavus, aspergillus niger and cryptococcus neoformans.

The invention also provides a kit for jointly detecting the candida albicans, the candida tropicalis, the candida glabrata, the aspergillus fumigatus, the aspergillus flavus, the aspergillus niger and the cryptococcus neoformans, wherein the kit comprises multiple PCR reactants, and the multiple PCR reactants comprise the PCR primer group.

As mentioned above, the primer group and the kit for combined detection of various pulmonary infection fungi have the following beneficial effects: the method has the advantages of simple operation, accurate detection, high flux, high sensitivity and high specificity, obviously shortens the detection time, and can realize the detection result within 2-3 hours. The human DNA internal reference can ensure the quality control of nucleic acid in the detection process of nucleic acid extraction and PCR amplification, and avoid the problem of false negative caused by the problems of nucleic acid extraction quality and PCR amplification. The combination of the multiplex PCR and the capillary fragment analysis method can realize the single-tube detection of various pulmonary infectious fungi, ensure the detection flux and have lower cost, and is suitable for disease control centers, hospitals and other medical institutions.

Drawings

FIG. 1 is a diagram showing the results of capillary electrophoresis separation of Candida albicans in example 2 of the present invention.

FIG. 2 is a diagram showing the results of capillary electrophoresis separation of Cryptococcus neoformans in example 2 of the present invention.

FIG. 3 is a diagram showing the results of capillary electrophoresis separation of the positive control in example 2 of the present invention.

FIG. 4 shows the results of the specificity analysis in example 3 of the present invention.

FIG. 5 shows the amplification effect of primer set 1 in comparative example 2 of the present invention.

FIG. 6 shows the amplification effect of primer set 2 in comparative example 2 of the present invention.

FIG. 7 shows the amplification effect of primer set 3 in comparative example 2 of the present invention.

Detailed Description

The invention provides a PCR primer group for detecting pulmonary infection fungi, which comprises the following primer pairs:

In the present invention, the cryptococcus neoformans is selected from a cryptococcus neoformans variant and/or a cryptococcus neoformans variant. Cryptococcus neoformans is a yeast with a membrane, which is classified into A, B, C, D four serotypes according to the polysaccharide in the capsule, corresponding to the grubby variant (a), the grubby variant (B and C) and the neogenetic variant (D) of cryptococcus neoformans.

The specific base sequence of the primer pair may be obtained by replacing 1 or more bases with other bases or adding 1 or more bases to the 3 'end or 5' end, as long as the specific recognition regions can be specifically recognized under the conditions for carrying out PCR (preferably, annealing and self-annealing do not occur between primers used in a single reaction vessel). The number of the plurality is, for example, 2 to 3. When 1 or more bases are added to the primer, it is preferable to add the base to the 5' end of the primer.

The identity between a nucleotide sequence obtained by substituting 1 or more nucleotides in a nucleotide sequence specific to the primer set with another nucleotide and a nucleotide sequence before substitution (i.e., a nucleotide sequence represented by the sequence number) may be preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and more preferably 95% or more.

The length of each primer is not particularly limited as long as it can specifically recognize the corresponding specific recognition region and hybridization does not occur between the primers, and is preferably 15 bases or more and 40 bases or less. The lower limit of the length of the primer is more preferably 16 bases or more, still more preferably 17 bases or more, and still more preferably 18 bases or more. More preferably, the upper limit of the length of the primer is 39 bases or less, still more preferably 38 bases or less, and still more preferably 37 bases or less.

The PCR primer group is a multiplex PCR primer group. Each detection primer pair can be packaged independently or can be mixed to prepare a multiplex PCR mixed solution. In the multiplex PCR detection mixture, the amount of each primer pair may be any conventional amount known to those skilled in the art.

Further, the application is the application in the preparation of a kit for jointly detecting candida albicans, candida tropicalis, candida glabrata, aspergillus fumigatus, aspergillus flavus, aspergillus niger and cryptococcus neoformans.

Furthermore, the application is the application in the preparation of a kit for combined detection of pulmonary infection by candida albicans, candida tropicalis, candida glabrata, aspergillus fumigatus, aspergillus flavus, aspergillus niger and cryptococcus neoformans.

The kit of the invention adopts a multiple PCR technology to simultaneously detect the seven pulmonary infectious fungi in a single tube, and can analyze and judge the infection conditions of candida albicans, candida tropicalis, candida glabrata, aspergillus fumigatus, aspergillus flavus, aspergillus niger and cryptococcus neoformans (new variety/gater variety) according to the amplification and detection conditions. The design of the primer is the key of the kit.

Other conventional reagents required for PCR, such as: multi DNA Polymerase. Since such common PCR reagents can be purchased individually or configured by themselves through the market, which reagents need to be assembled into the kit can be configured according to the actual needs of the user, and can also be assembled into the kit in total for convenience.

Further, the multiplex PCR reaction also comprises an internal reference amplification primer pair. In one embodiment, the reference amplification primer pair is a human DNA reference amplification primer pair. The human DNA internal reference amplification primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.15 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 16.

The multiple PCR reactant can be prepared by self or can be obtained by directly mixing a general PCR reaction solution which is sold in the market and does not contain the primer with the primer group. For example, the general PCR reaction solution may be obtained by adding the primer set of the present invention and a reference amplification primer pair to a Multiplex PCR Mix (UDG) of nearshore protein technologies, su. In one embodiment, each primer in the multiplex PCR reaction has a concentration of 100nmol/L to 300nmol/L based on the total volume of the multiplex PCR reaction.

In one embodiment, the kit further comprises a sample genome extraction reagent. The sample genome extraction reagent can be purchased in the market or prepared by the user.

Further, the kit can also contain a positive quality control substance. The positive quality control product is pUC57 plasmid DNA containing different target fungus specific nucleic acid fragments and human DNA internal reference specific nucleic acid fragments. In one embodiment, the nucleotide sequence of the positive quality control material is as shown in SEQ ID NO. 17-SEQ ID NO. 23. Commercially available alone or built on its own according to the prior art.

Further, the kit also contains a negative quality control product. In one embodiment, the negative control is a TE buffer. Commercially available alone or configured by themselves in accordance with the prior art.

The invention also provides a using method of the kit, which comprises the following steps:

(1) extracting sample genome DNA after pretreatment of a sample;

(2) sample adding: respectively adding the sample DNA, the positive quality control substance or the negative quality control substance into the PCR tube filled with the multiple PCR reactants to obtain a corresponding sample reaction tube, a corresponding positive reaction tube or a corresponding negative reaction tube;

(3) and (3) PCR reaction: the reaction tube is arranged on a PCR instrument, and circulation parameters are set for carrying out PCR reaction;

(4) after the PCR reaction was completed, the results were analyzed.

In step (1), the extraction of genomic DNA from a sample is known in the art.

In one embodiment, in step (3), the conditions of the PCR reaction are set to: circulating for 1 time at 50 deg.C for 2 min; circulating for 1 time at 95 ℃ for 2 min; circulating for 35 times at 94 ℃ for 20sec, 60 ℃ for 20sec and 72 ℃ for 30 sec; circulating for 1 time at 72 ℃ for 5 min; cycling at 4 ℃ for 1 time.

The invention also provides application of the kit in preparing a pulmonary infection fungus detection product.

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

EXAMPLE 1 methods of making and Using a kit

Candida albicans detection primer pairs, Candida tropicalis detection primer pairs, Candida glabrata detection primer pairs, Aspergillus fumigatus detection primer pairs, Aspergillus flavus detection primer pairs, Aspergillus niger detection primer pairs and Cryptococcus neoformans (New Zebra variant/gater variant) detection primer pairs are synthesized respectively, and the nucleotide sequences of the primers are shown in the following table 1.

The kit also contains a human DNA internal reference amplification primer pair, and the nucleotide sequence of the primer pair is shown in the following table 1.

The kit also contains a positive quality control product. The positive quality control product is pUC57 plasmid DNA containing target fungus specific nucleic acid fragment and human DNA internal reference specific nucleic acid fragment, and each nucleotide sequence is shown in Table 2.

The kit also contains a negative quality control product. The negative quality control product is TE buffer solution.

The kit also comprises a Multiplex PCR Mix (UDG) (product number E024-YBAB, Suzhou near shore protein science and technology Co., Ltd.), a bacteria and fungus DNA extraction kit (product number T07-100, Shanghai Meiji percolation biological medicine science and technology Co., Ltd.).

TABLE 1

TABLE 2

EXAMPLE 2 evaluation of the detection Effect of the kit

In the embodiment of the invention, a specific use mode of the kit is provided, wherein each detection primer pair and human DNA internal reference amplification primer pair shown in a sequence in table 1 are uniformly mixed with Multiplex PCR Mix (UDG) purchased from Suzhou near shore protein science and technology, Inc. to obtain a Multiplex PCR reactant, and the concentration of each primer in the Multiplex PCR reactant is shown in table 3.

TABLE 3

1. Patient samples (sputum, bronchoalveolar lavage fluid, etc.) were collected according to standard procedures, placed in ice bags immediately after collection, and immediately submitted for examination.

2. And after the sample is pretreated, extracting DNA in the sample together to obtain a DNA sample to be detected.

3. Preparation and detection of PCR reaction system

(1) Setting a typesetting mode according to the detection requirement, adding the multiplex PCR reactant into an 8-tube or 96-well plate according to the typesetting, adding 17.5 mu L of each hole, sequentially adding 2.5 mu L of a negative quality control product (TE buffer solution), a DNA sample to be detected and a positive quality control product (pUC57 plasmid DNA containing a target fungus specific nucleic acid fragment and a human DNA internal reference specific nucleic acid fragment) into the reaction holes, and covering the reaction holes.

(2) Mix well and centrifuge.

(3) And (3) carrying out reaction by using the prepared reagent.

4. Setting PCR program

(1) The PCR program was set up according to the PCR machine instructions and the PCR amplification conditions are shown in Table 4 below.

TABLE 4

(2) After the PCR amplification is finished, the amplification plate/tube is centrifuged briefly, then the tube cap is opened carefully, sealed with mineral oil and detected using a nucleic acid fragment analyzer.

5. Analysis of results

And judging the detection result of the sample by detecting the size of the reaction product fragment. The negative control tube should have no reaction product fragments. Otherwise, the experimental result is invalid and the detection is carried out again. In the positive quality control detection reaction system, a reaction product fragment is respectively contained in the range of 70-77bp and the range shown in the following table 5, otherwise, the result of the experiment is invalid, and the detection is carried out again. For a sample detection reaction system, an internal reference reaction product fragment should exist in the range of 70-77bp, otherwise, the experimental result is invalid, and the detection is carried out again. If the sample detection result is positive, judging the type of the infected fungus according to the signal intensity of the reaction product and the size of the corresponding fragment. The whole detection process is about 2-3 hours.

Referring to the experimental data shown in FIGS. 1-3, the fragment size values for each fungus are shown in Table 5 below.

TABLE 5

Fungal species	Fragment size
		Candida tropicalis	102-113bp
Candida albicans	127-138bp
		Aspergillus fumigatus	196-207bp
Candida glabrata	246-258bp
		Cryptococcus neoformans (New born variety/get variety)	302-312bp
Aspergillus flavus	349-359bp
		Aspergillus niger	405-415bp
Human DNA internal reference	70-77bp

EXAMPLE 3 sensitivity and specificity analysis of the kit

And (3) sensitivity analysis:

all fungal strains were purchased from Guangdong province center for culture Collection of microorganisms and China center for medical culture Collection (Table 6). For determining sensitivity of the kitRespectively diluting nucleic acids of Candida albicans, Candida tropicalis, Candida glabrata, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Cryptococcus neoformans and Cryptococcus neoformans variation with gradient concentration of 1 × 10⁶copies/mL、5×10⁵copies/mL、1×10⁵copies/mL、5×10⁴copies/mL、1×10⁴copies/mL、5×10³copies/mL、1×10³copies/mL、5×10²copies/mL、1×10²3-5 samples are repeated for each gradient dilution, the multiplex PCR amplification and fragment analysis detection are carried out by using the same seven determined fungus virus multiplex PCR detection systems in the example 2 until signals can not be detected, 20 times of repeat detection are carried out for each sample, and the sensitivity is determined by taking the positive detection rate level of 95% as the lowest detection lower Limit (LOD).

The relevant pathogenic strains are as follows:

TABLE 6

The detection sensitivity of the kit of the invention is shown in the following table:

TABLE 7

Detecting the index	LOD(copies/mL)
		Candida albicans	1000
Tropical candidaBacteria	1000
		Candida glabrata	1000
Aspergillus fumigatus	1000
		Aspergillus flavus	1000
Aspergillus niger	1000
		Cryptococcus neoformans variants	5000
Cryptococcus guerbet variants	5000

And (3) specific analysis:

the specificity of the detection method established by the invention mainly shows the specificity of the specific primer. The designed primers are analyzed by primer-blast comparison, have high conservation and specificity and can specifically distinguish seven fungi. In order to determine the specificity of the kit, the following sixteen unrelated pathogenic strains are selected as simulated interference samples, all the pathogenic strains are purchased from Guangdong province microbial strain collection center and Chinese medical strain collection center, different pathogenic strains are detected after extracting nucleic acid, the concentration is 10 ng/mu L, the total nucleic acid of each sample obtained by the steps is mixed with the same amount of human reference plasmid (pUC57) to be used as a template for multiplex PCR amplification and fragment analysis, and the specificity of the primer design of the kit is verified.

The relevant pathogenic strains are as follows:

TABLE 8

As shown in FIG. 4, multiplex PCR and fragment analysis of total nucleic acids of sixteen unrelated pathogens using an equal amount of the human reference plasmid (pUC57) as a template amplified only 76bp of the human reference band, and no other amplified bands. The data show that the detection results of the kit disclosed by the invention on the microorganisms are negative, so that the kit disclosed by the invention is proved to have no cross reaction with other microorganisms, and the strong specificity of the kit for detecting pathogens is embodied.

EXAMPLE 4 application of the kit to clinical specimen testing

A clinical microorganism laboratory culture detection method is selected as a 'reference method', and the embodiment 2 and a generation sequencing technology are applied to detect the clinical samples of sputum and bronchoalveolar lavage fluid. The test detects the sputum and the bronchoalveolar lavage fluid of a suspected/confirmed lung fungal infection patient for 20 samples in total. The results of the sample measurements are shown in Table 9 below.

TABLE 9

According to the detection data, the detection result of the method has higher conformity with the detection result of the culture detection method.

Comparative example 1

Comparative primer sets 1-8 were prepared according to the procedure of example 1, see Table 10 below.

Watch 10

Except that the primers shown by SEQ ID NO.1-2 in the primer set of example 1 were replaced with the primers shown by SEQ ID NO.24-25 to obtain a comparative primer set 1. Comparative primer set 2 was obtained by replacing the primers shown by SEQ ID NO.3 to 4 in the primer set of example 1 with the primers shown by SEQ ID NO.26 to 27. A comparative primer set 3 was obtained by replacing the primers shown by SEQ ID Nos. 5 to 6 in the primer set of example 1 with the primers shown by SEQ ID Nos. 28 to 29. A comparative primer set 4 was obtained by replacing the primers shown by SEQ ID Nos. 7 to 8 in the primer set of example 1 with the primers shown by SEQ ID Nos. 30 to 31. A comparative primer set 5 was obtained by replacing the primers shown by SEQ ID Nos. 9 to 10 in the primer set of example 1 with the primers shown by SEQ ID Nos. 32 to 33. A comparative primer set 6 was obtained by replacing the primers shown by SEQ ID Nos. 11 to 12 in the primer set of example 1 with the primers shown by SEQ ID Nos. 34 to 35. A comparative primer set 7 was obtained by replacing the primers shown by SEQ ID Nos. 13 to 14 in the primer set of example 1 with the primers shown by SEQ ID Nos. 36 to 37. A comparative primer set 8 was obtained by replacing the primers shown by SEQ ID Nos. 15 to 16 in the primer set of example 1 with the primers shown by SEQ ID Nos. 38 to 39.

Minimum detection limit verification the minimum detection limit verification was performed according to the method of example 3. The lowest detection limit of example 3 versus the comparative example is given in table 11 below.

TABLE 11

Detecting the index	Example 3, LOD (copies/mL)	COMPARATIVE EXAMPLE, LOD (copies/mL)
			Candida albicans	1000	1000
Candida tropicalis	1000	5000
			Candida glabrata	1000	5000
Aspergillus fumigatus	1000	1000
			Aspergillus flavus	1000	5000
Aspergillus niger	1000	1000
			Cryptococcus neoformans variants	5000	5000
Cryptococcus guerbet variants	5000	5000

As can be seen from Table 11, the kit disclosed in the present invention has a stronger detection capability for trace amounts of nucleic acids of Candida glabrata, Candida tropicalis and Aspergillus flavus in the sample than the comparative examples.

Specificity verification was performed according to the method of example 3. The results showed that the primer pairs of the comparative examples were negative in all reaction results.

As can be seen from the comparison of example 3 and the comparative example, the present disclosure can detect seven pulmonary infectious fungi at a time, and has high sensitivity, high specificity, lower minimum detection limit and wider coverage.

Comparative example 2

The comparative example takes candida glabrata as an example, and shows a primer which is found in the research and development process and has partial undesirable effects. C, smooth candida primer sequence and screening: for 3 sets of primer combinations, the amplification effect of the primers is firstly screened by using single PCR amplification, the single detection result shows that the amplification efficiency of the primer pair 3 is low, the primer pairs 1 and 2 can basically meet the requirements of subsequent experiments (as shown in figures 5 to 7), and the primers need to be added into a multiplex PCR method for further verification. Adding the primer pairs 1 and 2 into a multiplex PCR system respectively for amplification, wherein the detection results are as follows:

primer set 1

F-1：(SEQ ID NO.40)ACTATTCTTTTGTTCGTTGGGG

R-1：(SEQ ID NO.41)CAATGTGCGTTCAAAGATTCG

Primer set 2

F-2：(SEQ ID NO.42)TCGATGAAGAACGCAGCGAAATGCG

R-2：(SEQ ID NO.43)CGCAAACGAGCAGCAGATTA

Primer set 3

F-3：(SEQ ID NO.44)ACATTGCGCCCTCTGGTA

R-3：(SEQ ID NO.45)CAAAACACTCACTTATCCCTCC

The detection result of adding the primer pair 1 into a multiplex PCR system is as follows: the primer pair 1 causes the amplification efficiency of the candida albicans to become low, and the amplification efficiency of the primer pair may be reduced due to competitive inhibition between the primer pair 1 and the candida albicans primer pair or due to primer dimer, so that the requirement of subsequent detection is influenced. Adding the primer pair 2 into a multiplex PCR system for detection, wherein the detection result is as follows: the amplification efficiency of each primer pair is basically unchanged. Comprehensively considering from multiple aspects, the primer pair 2 is selected as the primer pair of candida glabrata in a multiplex PCR detection system, and the system meets the detection requirement after repeated verification.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the invention set forth herein, as well as variations of the methods of the invention, will be apparent to persons skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> Chongqing Pasteur biomedical science and technology Co., Ltd

<120> primer group and kit for combined detection of multiple pulmonary infection fungi

<160> 45

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgaagaacgc agcgaaatg 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggtttgaggg agaaacgac 19

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgtaggtgaa cctgcggaag gatca 25

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acctctggcg gtaggattg 19

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcgatgaaga acgcagcgaa atgcg 25

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgcaaacgag cagcagatta 20

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctatcgtacc ttgttgcttc ggcgg 25

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

catttcgctg cgttcttcat 20

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caaacgcagt accagaacca g 21

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcaccgaccc aggcaatctt gaggc 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttggctgcac tggaggattc gtcgc 25

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

caaagaggtg tagctggtgg c 21

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tttatctacc catctacacc tgtga 25

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcaaacaccc aaatccaagt c 21

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tatgacaatg aatttggcta cagca 25

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gggtcttatt ccttggaggc 20

<210> 17

<211> 518

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tttccgtagg tgaacctgcg gaaggatcat tactgatttg cttaattgca ccacatgtgt 60

ttttctttga aacaaacttg ctttggcggt gggcccagcc tgccgccaga ggtctaaact 120

tacaaccaat tttttatcaa cttgtcacac cagattatta ctaatagtca aaactttcaa 180

caacggatct cttggttctc gcatcgatga agaacgcagc gaaatgcgat acgtaatatg 240

aattgcagat attcgtgaat catcgaatct ttgaacgcac attgcgccct ctggtattcc 300

ggagggcatg cctgtttgag cgtcgtttct ccctcaaacc gctgggtttg gtgttgagca 360

atacgacttg ggtttgcttg aaagacggta gtggtaaggc gggatcgctt tgacaatggc 420

ttaggtctaa ccaaaaacat tgcttgcggc ggtaacgtcc accacgtata tcttcaaact 480

ttgacctcaa atcaggtagg actacccgct gaacttaa 518

<210> 18

<211> 475

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tggaagttaa aaaagcgtaa caaggtttcc gtaggtgaac ctgcggaagg atcattactg 60

atttgcttaa ttgcaccaca tgtgtttttt attgaacaaa tttctttggt ggcgggagca 120

atcctaccgc cagaggttat aactaaacca aactttttat ttacagtcaa acttgattta 180

ttattacaat agtcaaaact ttcaacaacg gatctcttgg ttctcgcatc gatgaagaac 240

gcagcgaaat gcgatacgta atatgaattg cagatattcg tgaatcatcg aatctttgaa 300

cgcacattgc gccctttggt attccaaagg gcatgcctgt ttgagcgtca tttctccctc 360

aaacccccgg gtttggtgtt gagcaatacg ctaggtttgt ttgaaagaat ttaacgtgga 420

aacttatttt aagcgactta ggtttatcca aaaacgctta ttttgctagt ggcca 475

<210> 19

<211> 578

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

actactattc ttttgttcgt tgggggaaag ctctctttcg ggagggagtt ctcccagtgg 60

atgcaaacac aaacaaatat ttttttaaaa taattcagtc aacacaagat ttcttttagt 120

agaaaacaac ttcaaaactt tcaacaatgg atctcttggt tctcgcatcg atgaagaacg 180

cagcgaaatg cgatacgtaa tgtgaattgc agaattccgt gaatcatcga atctttgaac 240

gcacattgcg ccctctggta ttccgggggg catgcctgtt tgagcgtcat ttccttctca 300

aacacattgt gtttggtagt gagtgatact ctcgtttttg agttaacttg aaattgtagg 360

ccatatcagt atgtgggaca cgagcgcaag cttctctatt aatctgctgc tcgtttgcgc 420

gagcggcggg ggttaatact gtattaggtt ttaccaactc ggtgttgatc tagggaggga 480

taagtgagtg ttttgtgcgt gctgggcaga cagacgtctt taagtttgac ctcaaatcag 540

gtagggttac ccgctgaact taagcatatc aataagcg 578

<210> 20

<211> 589

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctgcggaagg atcattaccg agtgagggcc ctctgggtcc aacctcccac ccgtgtctat 60

cgtaccttgt tgcttcggcg ggcccgccgt ttcgacggcc gccggggagg ccttgcgccc 120

ccgggcccgc gcccgccgaa gaccccaaca tgaacgctgt tctgaaagta tgcagtctga 180

gttgattatc gtaatcagtt aaaactttca acaacggatc tcttggttcc ggcatcgatg 240

aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa tcatcgagtc 300

tttgaacgca cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc 360

tgccctcaag cacggcttgt gtgttgggcc cccgtccccc tctcccgggg gacgggcccg 420

aaaggcagcg gcggcaccgc gtccggtcct cgagcgtatg gggctttgtc acctgctctg 480

taggcccggc cggcgccagc cgacacccaa ctttattttt ctaaggttga cctcggatca 540

ggtagggata cccgctgaac ttaagcatat caataggcca ggagaggaa 589

<210> 21

<211> 701

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

actcaacgct gtgcgccgat acacttctca cactgctact tctacgactc cccccacctc 60

gccattcgct cctcgccatt ttctttccat cgctgatctt acctcaacgg agttcgcaac 120

cctcgtccgt aatgcatctt cacacaaacg aaccatcaag tcgggatcaa tccctcagaa 180

cctgcttggt tctatgaccg gacagactgt agctatgctg ttcagcaaac gcagtaccag 240

aaccaggata tctactgaag gggctgtggt gcgcttggga ggacatccaa tgtttctggg 300

caaggatgat attcaactcg gtgtcaatga gtccttgtat gactctgcgg ttgtaatctc 360

ctccatggtc tcttgtattg tagcccgagt cggcaagcac gctgaggttg cagaccttgc 420

caagcattca accgtgcctg ttatcaacgc tctctgtgac tccttccacc ctctccaggc 480

cattgccgat tttcagacca tctacgaaac atttacacct aaggcccatc gctctgacag 540

tttgggtctg gagggcctca agattgcctg ggtcggtgat gcaaacaacg ttctgttcga 600

catggcaatt gctgctacca agatgggtat tgatatcgcc gttgcgactc cgaagggcta 660

tgagattcct gccccgatgt tggagctcat caagcaggcc a 701

<210> 22

<211> 700

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ccgatattat cacagctact ttgtctaaaa gtgttggctg cactggagga ttcgtcgccg 60

caaatggtat ctgtgcccaa cagcttagac ttcaagatga gctgttatca cacgaagggg 120

cagaatcttt gtccacggta gctcttgtac ggactttaag cctgctgaaa aagacccgtt 180

tgattgagta tcgcatgcgt caattgaagg ccaaagcggg atttgtgctc cagagactca 240

cagaagcagg atgcaaggtc ctctcctctc cagattcagc cattatatgt tttcctgtcg 300

gtgagttgca gtcccactcg agattatttc gaagaacctt catgctcata acacccagga 360

actgttcgac aggcgtcaat gtttcatgca gaggccctca agaggggctt tgccgtagcc 420

tgtggtgtgc caccagctac acctctttgg taagcttcac aaatgttgct taaggaatct 480

gctgacggaa cagggcctgt cgaattcgaa tgtgcgtgtt tgctacgtcc tcctgggctg 540

acatcctgaa tctggtcaac gcaacgatct cagtggcttg caaactaaat atccatggga 600

tcaaacccat ggtattggat gagagctgcc ttccttacga tagtggggag ccgctagatg 660

tagctgcaga gagtgaggcg acagataaag agtttcatga 700

<210> 23

<211> 472

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aaggatcagc agagaatatt ggacttcggg tccatttatc tacccatcta cacctgtgaa 60

ctgtttatgt gcttcggcac gttttacaca aacttctaaa tgtaatgaat gtaatcttat 120

tataacaata ataaaacttt caacaacgga tctcttggct tccacatcga tgaagaacgc 180

agcgaaatgc gataagtaat gtgaattgca gaattcagtg aatcatcgaa tctttgaacg 240

caacttgcgc cctttggtat tccgaagggc atgcctgttt gagagtcatg aaaatctcaa 300

tccctcgggt tttattacct gttggacttg gatttgggtg tttgccgcga cctgcaaagg 360

acgtcggctc gccttaaatg tgttagtggg aaggtgatta cctgtcagcc cggcgtaata 420

agtttcgctg ggcctatggg gtagtcttcg gcttgctgat aacaaccatc tc 472

<210> 24

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tgaagaacgc agcgaaatg 19

<210> 25

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cagcggtttg agggagaaa 19

<210> 26

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gaatcatcga atctttgaac gc 22

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tattgctcaa caccaaaccc 20

<210> 28

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tcgatgaaga acgcagcgaa atgcg 25

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

cgcaaacgag cagcagatta 20

<210> 30

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cccgtgtcta tcgtaccttg t 21

<210> 31

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

tttcgctgcg ttcttcatc 19

<210> 32

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tgtttctggg caaggatga 19

<210> 33

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

gagtcgcaac ggcgatat 18

<210> 34

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

gtcgccgcaa atggtatc 18

<210> 35

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

accaaagagg tgtagctggt g 21

<210> 36

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

acccatctac acctgtgaac tg 22

<210> 37

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

gcggcaaaca cccaaatc 18

<210> 38

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

cattgccctc aacgacca 18

<210> 39

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

ccaccaccct gttgctgta 19

<210> 40

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

actattcttt tgttcgttgg gg 22

<210> 41

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

caatgtgcgt tcaaagattc g 21

<210> 42

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tcgatgaaga acgcagcgaa atgcg 25

<210> 43

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

cgcaaacgag cagcagatta 20

<210> 44

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

acattgcgcc ctctggta 18

<210> 45

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

caaaacactc acttatccct cc 22

Claims

1. The PCR primer group is characterized by comprising a Candida albicans detection primer pair, a Candida tropicalis detection primer pair, a Candida glabrata detection primer pair, an Aspergillus fumigatus detection primer pair, an Aspergillus flavus detection primer pair, an Aspergillus niger detection primer pair and a cryptococcus neoformans detection primer pair.

2. The PCR primer set according to claim 1, wherein the PCR primer set further comprises the following features:

3. Use of the PCR primer set according to claim 1 or 2 for the preparation of a kit for the detection of candida albicans, candida tropicalis, candida glabrata, aspergillus fumigatus, aspergillus flavus, aspergillus niger and cryptococcus neoformans.

4. A kit for combined detection of candida albicans, candida tropicalis, candida glabrata, aspergillus fumigatus, aspergillus flavus, aspergillus niger and cryptococcus neoformans, wherein the kit comprises multiple PCR reactants, and the multiple PCR reactants comprise the PCR primer set according to claim 1 or 2.

5. The kit of claim 4, wherein the Multiplex PCR reaction further comprises Multiplex PCRMix and/or a pair of internal reference amplification primers.

6. The kit according to claim 5, wherein the internal reference amplification primer pair comprises an upstream primer with a nucleotide sequence shown as SEQ ID No.15 and a downstream primer with a nucleotide sequence shown as SEQ ID No. 16.

7. The kit of claim 5, wherein each primer is present in a concentration of 100 to 300nmol/L based on the total volume of the multiplex PCR reaction.

8. The kit of claim 4, wherein the kit further comprises any one or more of a sample genome extraction reagent, a positive quality control substance and a negative quality control substance.

9. The kit according to claim 8, wherein the positive control substance is pUC57 plasmid DNA containing each of the target fungus-specific nucleic acid fragment and the human DNA internal reference-specific nucleic acid fragment, and/or the negative control substance is TE buffer.

10. The kit of claim 9, wherein the nucleotide sequence of the positive quality control product is shown in SEQ ID No.17 to SEQ ID No. 23.