CN114350830A - Rice SNP marker and application thereof - Google Patents

Abstract

The invention discloses an SNP marker and application thereof. Wherein the SNP marker is SEQ ID NO:1, or the SNP marker is a T or C of the 23 rd base from the 5' end, or the SNP marker is a nucleotide sequence shown in SEQ ID NO:1, the 43 rd base A or G from the 5' end. The SNP marker of the invention is closely related to rice varieties and can be effectively used for qualitative or quantitative detection of rice varieties.

Description

Rice SNP marker and application thereof

Technical Field

The present invention relates to SNP markers and their use.

Background

The rice flower fragrance No. 2 is bred from the Wuyou rice No. 1 in autumn of 2000 by a breeding family field forever. The variety is late in mature period, low in yield, but high in economic benefit, is planted in a large area in Wuchang city in 2004, and is officially named as Wuyou rice No. 4, which is a representative of Wuchang rice. The rice flower fragrance No. 2 not only makes the fragrance of threshed rice attractive, but also enables the rice to smell the leaf fragrance and the rice fragrance when the rice grows in the field.

The five-excellent rice No. 4 has good quality and rich nutrition, the steamed rice has fragrance all over the world, the rice grains are crystal like jade, and the five-excellent rice has the reputation of century tribute rice and is favored by consumers in the market. But the Wuyou rice No. 4 has low yield, low rice yield and higher price. Therefore, there are cases in which other rice having similar grain type appearance is mixed with No. 4 rice of wuyou rice and sold in the market. Therefore, the problem of how to simply, accurately and quickly identify the purity of the Wuyou No. 4 rice is always concerned.

The detection method for generally distinguishing the adulteration of the No. 4 Wuyou rice variety is judged by the experiences of visual appearance observation, chewing taste and the like of an experienced rice expert, and comprises the following steps: firstly, the rice flower has a very special appearance, the rice flower is long and slightly wide at the budding end, and at least eight of 100 rice grains should be in the shape; secondly, from the perspective of rice, the color is not very good, and the rice has brown spots, which are not scorched like other rice; thirdly, the surface cortex of the rice is cracked. However, the method mainly depends on human senses to judge, the accuracy of the result greatly depends on the knowledge level and experience of people, and misjudgment is easy to occur. And the accuracy of judgment is poor through appearance and flavor, so that the quantitative detection of the adulteration of the Wuyou rice No. 4 is more difficult to realize. The grain type is related to the maturity, and the fragrance of the rice is influenced by external environmental factors such as climates of different years, so that the Wuyou rice No. 4 adulteration detection through the sense has certain limitation.

The identification of the rice variety can be carried out by a standard NY/T1433-2014 rice variety identification technical specification SSR marker or an NY/T2745-2015 rice variety identification SNP marker, but the two identification methods are complex and time-consuming, and can only judge whether the rice variety is consistent with the original variety or not, and cannot carry out the quantitative judgment of adulteration.

The rice industry company has clear demand for variety identification when purchasing the Wuyou rice No. 4, and hopes to identify the rice variety by a method which is simple and easy to operate and short in time consumption so as to ensure that the purchased rice is the Wuyou rice No. 4 with high purity. There is still a need in the art for reagents and methods for qualitatively and quantitatively detecting adulteration of the No. 4 Wuyou rice.

Disclosure of Invention

The invention provides an SNP marker which is related to the Wuyou rice No. 4 variety and can be effectively used for detecting the rice variety, and the SNP marker is used for designing a high-efficiency and sensitive Wuyou rice No. 4 rice specific primer and probe to detect the DNA of a sample, thereby realizing the quantitative judgment of the purity of the Wuyou rice No. 4 rice variety and effectively solving the problem of the quantitative identification of other rice varieties mixed in the Wuyou rice No. 4 rice variety.

Specifically, the invention provides an isolated nucleic acid molecule from a rice slender rod gene (SPINDLY gene), which comprises a first SNP marker and an optional second SNP marker, wherein the first SNP marker is located at 27996894 th chromosome 8 of a rice genome and is T or C, and the second SNP marker is located at 27996914 th chromosome 8 of the rice genome and is A or G.

In one or more embodiments, the nucleic acid molecule is a fragment of a rice slender rod gene that is at least 5bp in length. In one or more embodiments, the nucleic acid molecule is at least 10bp, 15bp, 20bp, 30bp, 40bp, 50bp, 60bp, 70bp, 80bp, 90bp, 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1kb in length. In one or more embodiments, the nucleic acid molecule is 10bp-600bp, 50-500bp, 100-400bp, 150-300bp, or 200-250bp in length.

In one or more embodiments, the nucleotide sequence of the nucleic acid molecule comprises at least the nucleotide sequence shown in SEQ ID NO. 1, or at least the nucleotide sequence shown in SEQ ID NO. 8 or 10, or at least the nucleotide sequence shown in SEQ ID NO. 9 or 11.

In one or more embodiments, the nucleotide sequence of the nucleic acid molecule includes SEQ ID NO 12.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 100 th nucleotide from 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 23 th nucleotide from 5' end of an amplification product, which is T or C; the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A or G.

The invention also provides a primer for detecting a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker is positioned at 27996894 th chromosome 8 of the rice genome and is T or C, and the second SNP marker is positioned at 27996914 th chromosome 8 of the rice genome and is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 100 th nucleotide from 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 23 th nucleotide from 5' end of an amplification product, which is T or C; the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A or G.

In one or more embodiments, the primer is selected from the group consisting of: (1) 2 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID NO 8 or 10 or a sequence which is at least 90% identical thereto; (2) 4 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID NO 9 or 11 or a sequence which is at least 90% identical thereto; and (3) mixtures of the sequences described in (1) and (2).

The invention also provides a probe for detecting a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker is positioned at 27996894 th chromosome 8 of the rice genome and is T or C, and the second SNP marker is positioned at 27996914 th chromosome 8 of the rice genome and is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 100 th nucleotide from 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 23 th nucleotide from 5' end of an amplification product, which is T or C; the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A or G.

In one or more embodiments, the probe comprises (1) a probe of oryza pentandra No. 4 that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising the 23 rd base from the 5 'end of SEQ ID No. 8 or the 100 th base from the 5' end of SEQ ID No. 9, and optionally (2) a probe of oryza pentandra No. 4 that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising the 43 th base from the 5 'end of SEQ ID No. 8 or the 130 th base from the 5' end of SEQ ID No. 9.

In one or more embodiments, the probes further comprise (3) a non-Pentium rice No. 4 probe recognizing SEQ ID NO. 10 or 11 or a fragment thereof comprising the 23 rd base from the 5 'end of SEQ ID NO. 10 or comprising the 100 th base from the 5' end of SEQ ID NO. 11, and optionally (4) a non-Pentium rice No. 4 probe recognizing SEQ ID NO. 10 or 11 or a fragment thereof comprising the 43 th base from the 5 'end of SEQ ID NO. 10 or comprising the 120 th base from the 5' end of SEQ ID NO. 11.

In one or more embodiments, the probe recognizes SEQ ID NO 9 or 11 or a fragment thereof comprising the 100 th base and optionally the 120 th base from the 5' end of SEQ ID NO 9 or 11. Illustratively, the probe includes one or more of: (1) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 100 th base from the 5 'end of SEQ ID NO 9 which is T, (2) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 100 th base from the 5' end of SEQ ID NO 11 which is C, a complementary sequence of (3) (1) or (2). Optionally, the probe further comprises one or more of: (1) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 120 th base from the 5 'end of SEQ ID NO 9 which is A, (2) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 120 th base from the 5' end of SEQ ID NO 11 which is A or G, a complementary sequence of (3) (1) or (2). Preferably, the probe has (1) a nucleotide sequence shown in SEQ ID NO:5 or 6 or a sequence that hybridizes under high stringency conditions to any one of SEQ ID NO:8-11 or a mutant thereof having 70% sequence identity thereto, or (2) the complement of (1).

Preferably, the probe that detects the second SNP marker enhances the typing specificity of the HRM detection method.

The invention also provides a kit which contains a reagent for detecting the first SNP marker in the rice genome, wherein the first SNP marker is positioned at 27996894 th chromosome 8 of the rice genome and is T or C.

In one or more embodiments, the first SNP marker is: the 100 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is T or C, or the 23 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is T or C.

In one or more embodiments, the kit comprises a primer for detecting the first SNP marker and optionally a probe for detecting the first SNP marker and optionally a nucleic acid molecule having the first SNP marker.

In one or more embodiments, the kit further comprises a reagent for detecting a second SNP marker in the rice genome, wherein the second SNP marker is located on chromosome 8, position 27996914, of the rice genome and is a or G.

In one or more embodiments, the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A or G.

In one or more embodiments, the kit comprises a primer for detecting the second SNP marker and optionally a probe for detecting the second SNP marker and optionally a nucleic acid molecule having the second SNP marker.

In one or more embodiments, the kit comprises: a primer as described in any embodiment herein, optionally a probe as described in any embodiment herein and optionally a nucleic acid molecule as described in any embodiment herein.

In one or more embodiments, the kit comprises: 2 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID No. 8 or 10 or a sequence which is at least 90% identical thereto or a sequence which is the complement thereof, and optionally a nucleic acid molecule whose nucleotide sequence comprises at least the nucleotide sequence shown in SEQ ID No. 1 or the complement thereof, or at least the nucleotide sequence shown in SEQ ID No. 8 or 10 or the complement thereof, or at least the nucleotide sequence shown in SEQ ID No. 9 or 11 or the complement thereof.

In one or more embodiments, the kit further comprises: 4 and 3 or a sequence hybridizing under stringent conditions to SEQ ID NO 9 or 11 or a sequence having at least 90% identity thereto or a complementary sequence thereof, and optionally a nucleotide sequence of SEQ ID NO 5 or 6 or a sequence hybridizing under stringent conditions to any of SEQ ID NO 8-11 or a mutant having 70% sequence identity thereto or a complementary sequence thereof.

The invention also provides a method for identifying rice varieties, which comprises the steps of (1) detecting a first SNP marker and an optional second SNP marker in a rice genome, wherein the first SNP marker and the second SNP marker are located on the 8 th chromosome of the rice genome, the first SNP marker is located on the 27996894 th position of the 8 th chromosome, the second SNP marker is located on the 27996914 th position of the 8 th chromosome, and (2) identifying the rice varieties according to the first SNP and the optional second SNP, wherein the first SNP is TT and is identified as the number 4 of the Wuyou rice, otherwise, the rice varieties are identified as the number 4 of the non-Wuyou rice, and the second SNP is AA and is identified as the number 4 rice group I of the non-Wuyou rice, and the second SNP is GG and is identified as the number 4 rice group II of the non-Wuyou rice. .

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, adopting SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 23 rd nucleotide from the 5 'end of an amplification product, which is T or C, or taking the rice genome DNA as the template, adopting SEQ ID NO 4 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 100 th nucleotide from the 5' end of the amplification product, which is T or C; the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A or G.

In one or more embodiments, the method further comprises identifying the rice variety based on the detected first SNP, wherein the first SNP for oryza pentandra No. 4 is TT and the first SNP for non-oryza pentandra No. 4 is CC.

In one or more embodiments, the method further comprises identifying the rice variety based on the detected second SNP, wherein the second SNP of non-oryza pentandra No. 4 rice group I is AA and the second SNP of non-oryza pentandra No. 4 rice group II is GG.

In one or more embodiments, the method further comprises identifying the rice variety based on the detected first SNP and second SNP, wherein the first SNP for oryza pentandra No. 4 is TT, the first SNP for non-oryza pentandra No. 4 is CC, the second SNP for non-oryza pentandra No. 4 rice group I is AA, and the second SNP for non-oryza pentandra No. 4 rice group II is GG.

In one or more embodiments, the detection comprises PCR, more preferably, the detection is fluorescent quantitative PCR or HRM detection.

The invention also provides a method for detecting the content or purity of the Wuyou rice No. 4 in a sample, which comprises the step of amplifying the sequences of a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker and the second SNP marker are positioned on the No. 8 chromosome of the rice genome, the first SNP marker is positioned on the No. 8 chromosome 27996894 and is T or C, and the second SNP marker is positioned on the No. 8 chromosome 27996914 and is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 100 th nucleotide from 5 'end of an amplification product, which is T, or taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 23 th nucleotide from 5' end of an amplification product, which is T; the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A.

In one or more embodiments, the method further comprises determining the content or purity of oryza pentandra No. 4 based on the amplification results of the first SNP marker and optionally the second SNP marker. Wherein the amplification result of the first SNP of TT indicates the content or purity of the Wuyou rice No. 4; the amplification result with the first SNP being CC indicates the content or proportion of non-Wuyou rice No. 4. Optionally, the second SNP of oryza pentandra No. 4 does not comprise a G. Optionally, the second SNP is AA indicating non-wuyou rice No. 4 rice group I, GG indicating the content or purity of non-wuyou rice No. 4 rice group II.

In one or more embodiments, the amplification is fluorescent quantitative PCR, and the method further comprises utilizing 2 according to the amplification result^-ΔΔCTThe method determines the content or purity of the Wuyou rice No. 4.

More preferably, said 2^-ΔΔCTThe method comprises the following steps: and comparing the CT value of the probe for identifying the first SNP marker and the optional second SNP marker in the sample with the CT value of an endogenous reference probe, and comparing the comparison result with the delta CT of a control, and determining the content or purity of the Wuyou rice No. 4 by using the obtained delta CT.

Specifically, the method for detecting the content or purity of the Wuyou rice No. 4 in the sample comprises the following steps: and (3) detecting the CT value of the probe for identifying the first SNP marker and the optional second SNP marker and the CT value of the probe for identifying the endogenous reference by fluorescent quantitative PCR, subtracting the two to obtain a sample delta CT, subtracting the delta CT of the sample delta CT from the delta CT of a control to obtain the delta CT, wherein the control is 100 percent of the sample No. 4 of the Wuyou rice or 100 percent of the sample No. 4 of the non-Wuyou rice, and carrying out 2-power on the negative number of the delta CT to obtain a relative content numerical value for quantitatively judging the No. 4 of the Wuyou rice and the sample No. 4 of the non-Wuyou rice in the sample. In one or more embodiments, the probe recognizing the first SNP marker and optionally the second SNP marker has a nucleotide sequence shown in SEQ ID NO. 5 or 6. In one or more embodiments, the probe that recognizes the endogenous reference has the nucleotide sequence set forth in SEQ ID NO. 7.

The invention also provides an application of a reagent for detecting the first SNP marker in the rice genome and an optional reagent for detecting the second SNP marker in the rice genome in identifying rice varieties or detecting the content or purity of the Wuyou rice No. 4 in rice, or an application in preparing a kit for identifying rice varieties or detecting the content or purity of the Wuyou rice No. 4 in rice, wherein the first SNP marker is positioned at the 27996894 th site of the 8 th chromosome of the rice genome and is T or C, and the second SNP marker is positioned at the 27996914 th site of the 8 th chromosome of the rice genome and is A or G.

In one or more embodiments, the rice genome first SNP marker is: taking rice genome DNA as a template, adopting SEQ ID NO. 4 and SEQ ID NO. 3 as primers to carry out PCR amplification to obtain 100 th nucleotide from 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, adopting SEQ ID NO. 2 and SEQ ID NO. 3 as primers to carry out PCR amplification to obtain 23 th nucleotide from 5' end of an amplification product, which is T or C, wherein the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A or G.

In one or more embodiments, the reagent comprises a primer as described in any embodiment herein and optionally a probe as described in any embodiment herein and optionally a nucleic acid molecule as described in any embodiment herein.

In one or more embodiments, the rice variety is identified based on the first SNP detected, wherein the first SNP for oryza pentandra No. 4 is TT and the first SNP for non-oryza pentandra No. 4 is CC.

In one or more embodiments, the rice variety is identified based on the detected second SNP, wherein the second SNP of non-oryza quinquefolia No. 4 rice group I is AA and the second SNP of non-oryza quinquefolia No. 4 rice group II is GG.

In one or more embodiments, the rice variety is identified based on the detected first SNP and second SNP, wherein the first SNP of oryza pentandra No. 4 is TT, the second SNP is AA, the first SNP of non-oryza pentandra No. 4 is CC, the second SNP of non-oryza pentandra No. 4 is AA, and the second SNP of non-oryza pentandra No. 4 is GG.

Drawings

FIG. 1: HRM detection of Wuyou rice No. 4 and non-Wuyou rice No. 4 and detection of a primer probe position diagram by a fluorescence probe method.

FIG. 2: HRM (high-resolution melting) typing map of No. 4 Wuyou rice and No. 4 other non-Wuyou rice.

FIG. 3: quantitative data graphs of different content standard samples of Wuyou rice No. 4 and non-Wuyou rice No. 4. The A diagram sequentially comprises from left to right: 0% of non-Wuyou rice No. 4 standard sample, 5% of non-Wuyou rice No. 4 standard sample, 10% of non-Wuyou rice No. 4 standard sample and 20% of non-Wuyou rice No. 4 standard sample; 50% of non-Wuyou rice No. 4 standard sample, 80% of non-Wuyou rice No. 4 standard sample, 90% of non-Wuyou rice No. 4 standard sample, 95% of non-Wuyou rice No. 4 standard sample and 100% of non-Wuyou rice No. 4 standard sample. The diagram B sequentially comprises from left to right: 100% of the Wuyou rice No. 4 standard sample, 95% of the Wuyou rice No. 4 standard sample, 90% of the Wuyou rice No. 4 standard sample and 80% of the Wuyou rice No. 4 standard sample; 50% of Wuyou rice No. 4 standard sample, 20% of Wuyou rice No. 4 standard sample, 10% of Wuyou rice No. 4 standard sample, 5% of Wuyou rice No. 4 standard sample and 0% of Wuyou rice No. 4 standard sample.

FIG. 4: and (4) carrying out blind sample purity detection on Wuyou rice No. 4. From left to right in sequence: 0% of non-Wuyou rice No. 4 standard sample, 5% of non-Wuyou rice No. 4 standard sample, 50% of non-Wuyou rice No. 4 standard sample, 95% of non-Wuyou rice No. 4 standard sample, 100% of non-Wuyou rice No. 4 standard sample, rice sample 1, rice sample 2 and rice sample 3.

Detailed Description

The inventor compares the difference of the No. 4 Wuyou rice with the specific sequences of other rice varieties by SSR high-throughput sequencing of the No. 4 Wuyou rice variety, judges whether other rice is doped in the No. 4 Wuyou rice variety or not by specific detection of the nucleic acid sequences of the specific sites of the No. 4 Wuyou rice variety and other rice varieties, and introduces an endogenous reference gene and a reference sample to carry out quantitative analysis on adulteration of the No. 4 Wuyou rice.

Specifically, the invention relates to an SNP marker related to a rice variety, a primer and a kit for detecting the SNP marker, application of the SNP marker, the primer and the kit in rice variety detection, and a method for detecting the rice variety.

The inventors found that SNP1 at position 27996894 and SNP2 at position 27996914 of chromosome 8 were related to rice cultivars. Specifically, SNP1 is the 23 rd base T or C from the 5' end of the nucleotide sequence shown in SEQ ID NO. 1; SNP2 is the 43 rd base A or G from the 5' end of the nucleotide sequence shown in SEQ ID NO. 1. The nucleotide sequence shown in SEQ ID NO. 1 is as follows:

TGCCCATGATTCATAACTGTCAYGTTACCTAATTTCAGAACTRTTTGGACAGAAGTGATATCATCAGATC(SEQ ID NO:1)。

herein, SNP (single nucleotide polymorphism) is a type of molecular genetic marker, mainly referring to DNA sequence polymorphism caused by variation of single nucleotide on genome level. SNPs typically exhibit polymorphisms that involve only single base variations, such as transitions, transversions, insertions and deletions.

Herein, a rice variety refers to a rice line that has been bred to have different traits. Wuyou rice No. 4 is also named Daohuaxiang No. 2 herein. The inventor finds that SNP1 of Wuyou rice No. 4 is homozygous TT, and SNP1 of non-Wuyou rice No. 4 is homozygous CC; SNP2 of Wuyou rice No. 4 is homozygous AA, and SNP2 of non-Wuyou rice No. 4 is homozygous GG and AA. Therefore, by detecting the above-mentioned SNP1 or SNP1 and SNP2 in a sample, it is possible to efficiently determine whether the rice variety is Pengyu rice No. 4 or non-Pengyu rice No. 4.

A "sample" as described herein is any type of polynucleotide-containing sample from a subject. Preferably, the sample described herein is derived from or comprises rice plant organs, tissues, cells, nucleic acids or products comprising rice plant organs, tissues, cells, nucleic acids including, but not limited to, rice leaves, roots, stems, flowers, fruits, seeds, cells, DNA, RNA, rice, broken rice, rice bran, rice hulls, processed or unprocessed rice foods such as rice flour, rice noodles. The DNA may be genomic DNA.

The term "nucleic acid" or "polynucleotide" refers to a Deoxyribonucleotide (DNA) or ribonucleotide polymer (RNA) in either single-or double-stranded form, and the complement thereof. Nucleic acids contain synthetic, non-natural or altered nucleotide bases. The nucleotide may be a ribonucleotide, a deoxyribonucleotide, or a modified form thereof. Examples of polynucleotides contemplated herein include single-and double-stranded DNA, single-and double-stranded RNA, and hybrid molecules having a mixture of single-and double-stranded DNA and RNA. The DNA may be the coding strand or the non-coding strand. In one or more embodiments, the sample comprises fragmented genomic DNA. Methods for obtaining genomic DNA and fragmenting are well known in the art.

The basic unit of DNA is deoxyribonucleotide, which is condensed by phosphodiester bond to form a long chain molecule. Each deoxyribonucleotide consists of a phosphate, a deoxyribose, and a base. Bases (bp) of DNA are mainly adenine (A), guanine (G), cytosine (C) and thymine (T). In the double-helix structure of double-stranded DNA, A is hydrogen-bonded to T, and G is hydrogen-bonded to C. The form of DNA includes cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be of any length, such as 50-500bp, 100-400bp, 150-300bp or 200-250 bp.

As used herein, a "primer" refers to a nucleic acid molecule having a specific nucleotide sequence that directs the synthesis at the initiation of nucleotide polymerization. The primer composition comprises one or more primers. The primers are typically two oligonucleotide sequences synthesized by man, one primer complementary to one DNA template strand at one end of the target region and the other primer complementary to the other DNA template strand at the other end of the target region, which functions as the initiation point for nucleotide polymerization. Primers designed artificially in vitro are widely used in Polymerase Chain Reaction (PCR), qPCR, sequencing, probe synthesis, and the like. The primer may be of any length, for example 5-200bp, 10-100bp, 20-800bp or 25-50 bp.

The primer of the invention is used for detecting SNP. The primer may be a nucleic acid molecule recognizing any one of SEQ ID NOS 8-11. In some embodiments, the primer has (1) a nucleotide sequence set forth in any one of SEQ ID NOs: 2-4 or a mutant having at least 70% sequence identity thereto, or (2) the complement of (1). In one or more embodiments, the primers are primer pairs having the sequences shown in SEQ ID NOS: 2 and 3 or SEQ ID NOS: 3 and 4, respectively. In discussing primers, the term "recognition" as used herein means that the primers hybridize to the template sequence under stringent or highly stringent conditions, and the fragments amplified by the pair of primers encompass the 23 rd and/or 43 th bases from the 5 'end of SEQ ID NO. 8 or 10, or the 100 th and/or 120 th bases from the 5' end of SEQ ID NO. 9 or 11. Stringent conditions for hybridization of the nucleic acids described herein are known to those skilled in the art. Preferably, the conditions are such that the sequences are at least about 65%, 70%, 75%, 85%, 90%, 95%, 98% or 99% homologous to each other, typically remaining hybridized to each other. Non-limiting examples of stringent hybridization conditions are hybridization in a high salt buffer containing 6XSSC, 50mM Tris-HCl (pH7.5), 1m MEDTA, 0.02% PVP, 0.02% Ficolll, 0.02% BSA and 500mg/ml denatured salmon sperm DNA at 65 ℃ and optionally washed once or twice in 0.2XSSC, 0.01% BSA at 50 ℃.

The present invention may also employ probes to detect SNPs described herein. A "probe" as used herein is a nucleic acid sequence (DNA or RNA) that recognizes a sequence of interest (complementary to the sequence of interest). The probe is combined with the target gene through molecular hybridization to generate a hybridization signal, thereby displaying the target gene. The probe may include the entire sequence of interest or may be a fragment of the sequence of interest. The probe may be DNA or RNA transcribed therefrom. Typically, the probe carries a detectable label, such as a fluorescent label. Such fluorescent labels include, but are not limited to FAM, CY5, and VIC. Fluorescent labels suitable for use with the probes herein and methods of attaching them to the probes are known in the art.

Herein, the probe includes a probe of oryza pentandra No. 4 that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising the 23 rd base from the 5 'end of SEQ ID No. 8, optionally comprising the 43 th base, or comprising the 100 th base from the 5' end of SEQ ID No. 9, optionally comprising the 120 th base. Optionally, the probe may further comprise a non-Pentium 4 probe recognizing SEQ ID NO 10 or 11 or a fragment thereof comprising the 23 rd base from the 5 'end of SEQ ID NO 10, optionally comprising the 43 th base, or comprising the 100 th base from the 5' end of SEQ ID NO 11, optionally comprising the 120 th base.

In one or more embodiments, the probe comprises (1) a probe of oryza pentandra No. 4 that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising the 23 rd base from the 5 'end of SEQ ID No. 8 or the 100 th base from the 5' end of SEQ ID No. 9, and optionally (2) a probe of oryza pentandra No. 4 that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising the 43 th base from the 5 'end of SEQ ID No. 8 or the 130 th base from the 5' end of SEQ ID No. 9. The probe may further include (3) a non-Pentamic rice No. 4 probe recognizing SEQ ID NO 10 or 11 or a fragment thereof comprising the 23 rd base from the 5 'end of SEQ ID NO 10 or comprising the 100 th base from the 5' end of SEQ ID NO 11, and optionally (4) a non-Pentamic rice No. 4 probe recognizing SEQ ID NO 10 or 11 or a fragment thereof comprising the 43 th base from the 5 'end of SEQ ID NO 10 or comprising the 120 th base from the 5' end of SEQ ID NO 11.

Illustratively, the probe comprises one or more selected from the group consisting of: (1) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 100 th base from the 5 'end of SEQ ID NO 9 which is T, (2) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 100 th base from the 5' end of SEQ ID NO 11 which is C, a complementary sequence of (3) (1) or (2). In another embodiment, the probe further comprises one or more of the following: (1) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 120 th base from the 5 'end of SEQ ID NO 9 which is A, (2) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 120 th base from the 5' end of SEQ ID NO 11 which is A or G, a complementary sequence of (3) (1) or (2). Preferably, the probe has (1) a nucleotide sequence shown in SEQ ID NO:5 or 6 or a mutant having 70% sequence identity thereto, or (2) a complementary sequence of (1). In discussing probes, the term "recognition" as used herein means that the probe hybridizes to the template sequence under stringent or highly stringent conditions and the hybridization encompasses the 23 rd base and/or the 43 th base from the 5 'end of SEQ ID NO. 8 or 10, or encompasses the 100 th base and/or the 120 th base from the 5' end of SEQ ID NO. 9 or 11.

The term "variant" or "mutant" as used herein refers to a polynucleotide that has a nucleic acid sequence altered by insertion, deletion or substitution of one or more nucleotides compared to a reference sequence, while retaining its ability to hybridize to other nucleic acids. A mutant according to any of the embodiments herein comprises a nucleotide sequence having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to a reference sequence (SEQ ID NOS: 1-12 as described herein) and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, BLASTn from NCBI. Mutants also include nucleotide sequences that have one or more mutations (insertions, deletions, or substitutions) in the reference sequence and in the nucleotide sequence, while still retaining the biological activity of the reference sequence. The plurality of mutations typically refers to within 1-10, such as 1-8, 1-5, or 1-3. The substitution may be a substitution between purine nucleotides and pyrimidine nucleotides, or a substitution between purine nucleotides or between pyrimidine nucleotides. The substitution is preferably a conservative substitution. For example, conservative substitutions with nucleotides of similar or analogous properties are not typically made in the art to alter the stability and function of the polynucleotide. Conservative substitutions are, for example, exchanges between purine nucleotides (A and G), exchanges between pyrimidine nucleotides (T or U and C). Thus, substitution of one or more sites with residues from the same in the polynucleotides of the invention will not substantially affect their activity. When referring to mutants having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% sequence identity to a primer (e.g.SEQ ID NO:2-4) or probe (e.g.SEQ ID NO:5-7) according to the invention, preferably such mutants will hybridize under high stringency conditions to the corresponding DNA sequence comprising SEQ ID NO:8, 9, 10 or 11. The high stringency conditions can be hybridization and membrane washing in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃.

In another aspect, the present invention provides a method for detecting a rice variety in a sample, comprising determining or quantifying the rice variety by performing the SNP marker detection described herein on a sample to be detected. The method further comprises: (1) extracting DNA of a sample to be detected; (2) determining or quantifying the genotype of the SNP markers described herein in the DNA using the primers and/or probes described herein; and (3) determining or quantifying the rice variety based on the results of (2). Wherein the rice variety with TT as the first SNP is Wuyou rice No. 4, the Wuyou rice No. 4 can be detected and identified by the conventional method for detecting SNP in the field, such as fluorescent quantitative probe method or HRM high resolution melting curve method, and the process and the used reagent of the method are well known in the field. In addition, since the rice variety in which the second SNP includes G is not oryza quinquefolia No. 4, it is also possible to more accurately classify the non-oryza quinquefolia No. 4 variety by combining the second SNP, for example, using the HRM high-resolution melting curve method. In one embodiment, the non-wuyouth rice No. 4 rice group I, the non-wuyouth rice No. 4 rice group II, and the wuyouth rice can be typed by detecting the first SNP and the second SNP using the HRM high resolution melting curve method, wherein the first SNP is CC and the second SNP is AA. The non-Wuyou rice No. 4 rice group II was characterized in that the first SNP was CC and the second SNP was GG.

In one or more embodiments, non-wuyou rice No. 4 rice group I comprises: seiki japonica 18, sufofeng 47, songjing 22, bei rice 7, tongyiang 518, feuler rice No. 1, longqing rice 3, nanjing 9108 and microballon rice No. 9. In one or more embodiments, non-wuyou rice No. 4 rice group II comprises: liaoxing No. 1, Longyang No. 11, Longyang No. 16, Longdao No. 18, Jihong No. 6, Liuyouxiang, Taiyou 390 and Meixiang No. 2.

Herein, the method for extracting DNA in a sample is not particularly limited, and DNA extraction methods suitable for use herein are well known in the art.

SNP marker detection methods suitable for use herein are well known in the art and include, but are not limited to: sequencing, single strand conformation polymorphism polymerase chain reaction (PCR-SSCP), real-time fluorescence quantitative PCR and high resolution melting curve analysis (HRM), fluorescent probe quantitative PCR, restriction fragment length polymorphism polymerase chain reaction (PCR-restriction fragment length polymorphism, PCR-RFLP), flight time mass spectrum and the like. Other reagents than primers and/or probes are known in the art as may be required in SNP marker detection methods.

According to some embodiments of the present invention, the method for determining or quantifying rice cultivars by detecting the SNP markers described herein in a test sample further comprises: extracting DNA in a sample; performing fluorescent quantitative PCR of DNA by using primers SEQ ID NO. 2 and SEQ ID NO. 3 to obtain an amplification product; performing HRM analysis on the amplification product to obtain the genotype of the SNP marker in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP marker.

According to other embodiments of the present invention, the method for determining or quantifying rice cultivars by detecting the SNP markers described herein in a test sample further comprises: extracting DNA in a sample; carrying out fluorescent quantitative PCR of DNA by using primers SEQ ID NO. 3 and 4, probes SEQ ID NO. 5 and 6, and a reference probe SEQ ID NO. 7; analyzing the PCR result to obtain the genotype of the SNP marker in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP marker.

For example, the method for detecting the content or purity of the Wuyou rice No. 4 in the sample comprises the following steps: and (3) detecting the CT value of the probe for identifying the first SNP marker and the optional second SNP marker and the CT value of the probe for identifying the endogenous reference by fluorescent quantitative PCR, subtracting the two to obtain a sample delta CT, subtracting the delta CT of the sample delta CT from the delta CT of a control to obtain the delta CT, wherein the control is 100 percent of the sample No. 4 of the Wuyou rice or 100 percent of the sample No. 4 of the non-Wuyou rice, and carrying out 2-power on the negative number of the delta CT to obtain a relative content numerical value for quantitatively judging the No. 4 of the Wuyou rice and the sample No. 4 of the non-Wuyou rice in the sample. In one or more embodiments, the probe recognizing the first SNP marker and optionally the second SNP marker has a nucleotide sequence shown in SEQ ID NO. 5 or 6. In one or more embodiments, the probe that recognizes the endogenous reference has the nucleotide sequence set forth in SEQ ID NO. 7.

The invention also provides a kit containing a reagent for detecting the first SNP marker in the rice genome, wherein the first SNP marker in the rice genome is: the 100 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is T or C, or the 23 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is T or C. Optionally, the kit further comprises a reagent for detecting a second SNP marker in the rice genome, wherein the second SNP marker is: the 120 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 3 as the primers is A or G, or the 43 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is A or G. The reagent may be a primer and/or a probe as described in any embodiment herein. Optionally, the kit further comprises a nucleic acid molecule (i.e., amplification product) of the invention, which can be used as an internal standard or positive control. Preferably, the primer is selected from: (1) 2 and 3 or a sequence having at least 90% identity thereto; (2) 4 and 3 or a sequence having at least 90% identity thereto; and (3) mixtures of the sequences described in (1) and (2). The probe is selected from: (1) 5 and 6 or a sequence having at least 90% identity thereto; (2) (1) the complement of said sequence; optionally, the probe further comprises a sequence shown as SEQ ID NO. 7 or a sequence having at least 90% identity thereto, and/or a complementary sequence thereof. Preferably, the probes have fluorescent labels, such as fluorescent labeling by FAM, VIC and CY5, respectively. The kit may further contain various reagents required for performing PCR, such as buffers, enzymes, dNTPs, and the like.

In a preferred embodiment, the kit of the invention comprises: the primer sequences shown in SEQ ID NO 2 and 3. In another preferred embodiment, the kit of the invention comprises: primer sequences shown in SEQ ID NOS 4 and 3; a probe shown as SEQ ID NO. 5, which is fluorescently labeled with FAM; the probe shown as SEQ ID NO. 6, which is labeled by VIC fluorescence; the probe shown as SEQ ID NO. 7, which is fluorescently labeled with CY 5.

The SNP marker and the application thereof have the advantages that:

the method can qualitatively or quantitatively detect the doping amount of other rice varieties in the Wuyou rice No. 4 rice variety. The method quantitatively detects the adulteration of the Wuyou rice No. 4 rice by using a molecular biological method, is suitable for products such as rice seeds, rice flour and the like, quickly extracts DNA from a sample, performs fluorescent quantitative PCR amplification by using a developed high-efficiency and sensitive Wuyou rice No. 4 specific fluorescent probe and primer, and quantitatively analyzes the amplification data by setting an endogenous reference gene and a reference sample, thereby quantitatively judging the purity of the Wuyou rice No. 4. The result is visual and objective, can avoid artificial judgment, the operation is convenient and rapid, the quantitative limit reaches 5 percent, the probability of wrong judgment can be greatly reduced, the influence caused by variety, region, environment and the like is avoided, and the detection is more sensitive and efficient.

The present invention will be illustrated below by way of specific examples. It is to be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. The materials, reagents and methods not specifically described in the examples are not conventional in the art.

Examples

Example 1: materials and methods

1. Material

The Wuyou rice No. 4-rice seeds, other rice variety seeds and the rice samples sold in the market are all provided by Fengyi (Shanghai) biotechnology research and development center limited company.

2. Enzymes and reagents

The enzyme is purchased from Shijikang corporation and Bio-Rad corporation, the reagent is purchased from national medicine group chemical reagent limited corporation, and the fluorescence quantitative PCR instrument is Bio-Rad CFX 96; the primers and probes used in the experiment were synthesized by Shanghai Bioengineering Co.

3. Experimental methods

3.1 extraction of DNA from Rice seeds (Rice-like)

Grinding 20 g of rice seeds (rice samples) by using a grinder, weighing 50mg of powder into a 2mL sample cracking tube, adding 500 mu L of Buffer 1, uniformly mixing by oscillation of a vortex instrument for 30s, incubating for 30min at 52 ℃, and rotating at 1200 rpm; adding 500 μ L Buffer 2, mixing with vortex instrument for 30s, centrifuging the mixture for 5min (12000rpm), sucking 500 μ L supernatant, diluting the obtained DNA solution with sterilized pure water 10 times as template DNA, placing in sample dilution tube, storing at 4 deg.C for a short period, and storing at-20 deg.C for a long period. Or extracting the DNA of the rice seeds or the rice samples according to the operation instruction of the quantitative detection kit for the purity of the Wuyou rice No. 4 rice.

Design of specific primer and probe for No. 4 rice of 3.2 Wuyou rice

Aiming at the specific fragment sequence of the No. 4 rice variety of the Wuyou rice, primer5 is designed to be specific.

HRM high resolution melting curve method detection primers:

DHX-HRM-F1：5’-TGCCCATGATTCATAACTGT-3’(SEQ ID NO:2)；

DHX-HRM-R1：5’-GATCTGATGATATCACTTCTGTCC-3’(SEQ ID NO:3)；

the probe detection method comprises the following primers:

DHX1-wholeF：5’-TGGAACTTACTGGTCATACG-3’(SEQ ID NO:4)；

DHX-HRM-R1：5’-GATCTGATGATATCACTTCTGTCC-3’(SEQ ID NO:3)；

designing a probe:

FDHX-MGB-FAM-P3：5’-FAM–CTGAAATTAGGTAAcgTGACAG–MGB-3’(SEQ ID NO:5)；

DHX-MGB-VIC-P2：5’-VIC–CTGAAATTAGGTAAcaTGACAG–MGB-3’(SEQ ID NO:6)。

DHX-Refgene-cy5-P4：5’-CY5–CAAGTTAGGAACAATGGCATGCAGG–BHQ2-3’(SEQ ID NO:7)。

HRM high resolution melting curve method for detecting primer amplified fragment 70 bp:

wuyou rice No. 4 nucleic acid sequence:

TGCCCATGATTCATAACTGTCATGTTACCTAATTTCAGAACTATTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO:8, FIG. 1)

Other rice nucleic acid sequences:

TGCCCATGATTCATAACTGTCACGTTACCTAATTTCAGAACTA(G) TTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO:10, FIG. 1)

Probe detection method primer amplified fragment 147 bp:

wuyou rice No. 4 nucleic acid sequence:

TGGAACTTACTGGTCATACGGCAAATAACAAGTTAGGAACAATGGCATGCAGGCCTGCTCCTATTCAGGTACCTTTGTGCCCATGATTCATAACTGTCATGTTACCTAATTTCAGAACTATTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO:9, FIG. 1)

Other rice nucleic acid sequences:

TGGAACTTACTGGTCATACGGCAAATAACAAGTTAGGAACAATGGCATGCAGGCCTGCTCCTATTCAGGTACCTTTGTGCCCATGATTCATAACTGTCACGTTACCTAATTTCAGAACTA(G) TTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO:11, FIG. 1)

Example 2: real-time fluorescence quantitative PCR detection of HRM high resolution melting curve method

And (3) carrying out real-time fluorescent quantitative PCR amplification on the DHX-HRM-F1 and the DHX-HRM-R1 by using the extracted DNA as a template and adopting an HRM high-resolution melting curve method to detect the primers. The PCR reaction system was 20. mu.L, in which SsoAdvancedTM was used

Green Supermix 10. mu.L, DHX-HRM-F1 and DHX-HRM-R1 primers (10. mu.M) 0.5. mu.L each, template DNA (50-100 ng/. mu.L) 2. mu.L, sterile water to 20. mu.L. Blank controls were prepared by replacing template DNA with sterile water. Each reaction is repeated three times, and the PCR amplification program adopts a two-step method: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15 seconds, annealing at 60 ℃ for 1 minute, for 45 cycles.

After the real-time fluorescence PCR amplification is finished, directly applying Bio-Rad to the amplification product to read the HRM high-resolution melting curve, wherein the HRM high-resolution melting curve melting process comprises the following steps: 95 ℃ for 1min, 70 ℃ for 1min, then raising the temperature from 70 ℃ to 95 ℃ at the speed of 0.2 ℃/0.1s, collecting the melting curve data, and using the melting curve data in Precision Melt Analysis Software to perform HRM high-resolution melting curve typing.

Taking extracted DNA of different rice variety samples as templates, carrying out real-time fluorescence quantitative PCR amplification on DHX-HRM-F1 and DHX-HRM-R1 by using HRM high-resolution melting curve method detection primers, then reading an HRM high-resolution melting curve, carrying out HRM high-resolution melting curve typing by using Precision Melt Analysis Software, and displaying results (figure 2), wherein the Wuyou No. 4 rice variety has a specific HRM curve and is different from the HRM typing of other rice varieties, and the rice group I of the other varieties with non-rice floral aroma comprises the following rice: seiki japonica 18, sufofeng 47, songjing 22, bei rice 7, tongyiang 518, feierze rice No. 1, longqing rice 3, nanjing 9108 and microballon rice No. 9; other varieties of rice group II include rice: liaoxing No. 1, Longyang No. 11, Longyang No. 16, Longdao No. 18, Jihong No. 6, Liuyouxiang, Taiyou 390 and Meixiang No. 2.

Example 3: probe method real-time fluorescent quantitative PCR detection

Using the extracted DNA as a template, and detecting a primer probe detection method by using a Wuyou rice No. 4 probe method, wherein the primer comprises the following steps: DHX1-wholeF and DHX-HRM-R1, a specific probe DHX-MGB-VIC-P2 of Wuyou rice No. 4 and a specific probe FDHX-MGB-FAM-P3 of non-Wuyou rice No. 4 are subjected to real-time fluorescence PCR detection with an endogenous reference gene DHX-Refgene-cy5-P4 probe. The PCR reaction system was 20. mu.L, 2 XGoldStar Best MasterMix 10. mu.L, DHX 1-whoeF and DHX-HRM-R1 primers (10. mu.M) 0.8. mu.L, DHX-MGB-VIC-P2 probes (10. mu.M) 0.25. mu.L each, FDHX-MGB-FAM-P3 probes (10. mu.M) 0.125. mu.L each, DHX-refer-cy 5-P4 probes (10. mu.M) 0.2. mu.L, template DNA 2. mu.L, sterile water to 20. mu.L. Blank controls were prepared by replacing template DNA with sterile water. Each reaction is repeated three times, and the PCR amplification program adopts a two-step method: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15 s; annealing at 58 ℃ for 45s of extension for 45 cycles.

Firstly, a probe method is subjected to specificity analysis, a Wuyou rice No. 4 specific probe DHX-MGB-VIC-P2 only has an amplification signal in the Wuyou rice No. 4 rice variety, other rice varieties have no amplification signals, a non-Wuyou rice No. 4 probe FDHX-MGB-FAM-P3 has an amplification signal in the non-Wuyou rice No. 4 rice variety, and the Wuyou rice No. 4 probe does not have an amplification signalThe signal is amplified. And analyzing the fluorescent quantitative PCR data, and quantifying the contents of the No. 4 Wuyou rice and the No. 4 non-Wuyou rice in the rice sample respectively. Gene expression data processing Using 2^-ΔΔCTThe method comprises the steps of taking a rice DHX-Refgene-cy5-P4 probe as an endogenous reference gene, subtracting the CT values of the DHX-MGB-VIC-P2 probe and the FDHX-MGB-FAM-P3 probe from the CT value of the DHX-Refgene-cy5-P4 probe in a sample to obtain a value delta CT, subtracting the value delta CT from a reference sample with the content of 100% Wuyou rice No. 4 or 100% non-Wuyou rice No. 4, and carrying out 2-power subtraction on the obtained negative number of the delta CT to obtain a numerical value with relative content, wherein the numerical value is used for quantitative judgment on the content of the rice varieties of Wuyou rice No. 4 and non-Wuyou rice No. 4 in the rice sample respectively.

Performing real-time fluorescent PCR detection on fluorescent quantitative PCR data by using extracted DNA of standard samples with different contents as templates and using primers DHX1-wholeF and DHX-HRM-R1, a specific probe DHX-MGB-VIC-P2 of Wuyou rice No. 4 and a specific probe FDHX-MGB-FAM-P3 of non-Wuyou rice No. 4, and an endogenous reference gene DHX-refer-cy 5-P4, and analyzing the fluorescent quantitative PCR data, wherein the results show (figure 3), 0% of a standard sample of non-Wuyou rice No. 4, 5% of a standard sample of non-Wuyou rice No. 4, 10% of a standard sample of non-Wuyou rice No. 4 and 20% of a standard sample of non-Wuyou rice No. 4; 50% of non-Wuyou rice No. 4 standard samples, 80% of non-Wuyou rice No. 4 standard samples, 90% of non-Wuyou rice No. 4 standard samples, 95% of non-Wuyou rice No. 4 standard samples, 100% of non-Wuyou rice No. 4 standard samples, 9 standard samples are increased progressively according to the content of the non-Wuyou rice No. 4 standard samples, the relative gene expression quantity is also increased progressively, and the content of the sample of the non-Wuyou rice No. 4 can be detected quantitatively by using unknown standard samples (figure 3, A). 100% of the Wuyou rice No. 4 standard sample, 95% of the Wuyou rice No. 4 standard sample, 90% of the Wuyou rice No. 4 standard sample and 80% of the Wuyou rice No. 4 standard sample; the content of the Wuyou rice No. 4 is decreased progressively according to the content of the Wuyou rice No. 4 by 50 percent of the Wuyou rice No. 4 standard sample, 20 percent of the Wuyou rice No. 4 standard sample, 10 percent of the Wuyou rice No. 4 standard sample, 5 percent of the Wuyou rice No. 4 standard sample, 0 percent of the Wuyou rice No. 4 standard sample and 9 standard samples, the relative gene expression quantity also presents a decreasing relation, and the content of the Wuyou rice No. 4 sample can be quantitatively and unknowingly detected by using the standard samples (figure 3, B).

Example 4: wuyou No. 4 blind sample purity detection

Detecting blind samples of 3 Wuyou rice No. 4 configured rice products, performing DNA extraction, fluorescence quantitative PCR amplification and data analysis according to the operational instructions of the Wuyou rice No. 4 rice variety purity detection kit, and displaying the result (figure 4), wherein the content of the Wuyou rice No. 4 in the blind samples is as follows: the content of the rice sample 1 is 100%, the content of the rice sample 2 is 11%, the content of the rice sample 3 is 38%, the detection results of the three blind samples are basically consistent with the mixture ratio, and the mixture ratio is as follows: rice sample 1 was 100% wuyou rice No. 4, rice sample 2 contained 10% wuyou rice No. 4 and rice sample 3 contained 40% wuyou rice No. 4.

And (4) conclusion: the method comprises the steps of quantitatively detecting adulteration of the Wuyou rice No. 4 by using a molecular biological method, quickly extracting DNA from a rice sample, carrying out fluorescent quantitative PCR amplification by using a developed high-efficiency and sensitive Wuyou rice No. 4 specific fluorescent probe and primer, and quantitatively analyzing amplification data by setting an endogenous reference gene and a reference sample, so that the purity of the Wuyou rice No. 4 is quantitatively judged, the result is visual, the operation is convenient and quick, the method is not influenced by varieties, regions, environments and the like, and the detection is more sensitive and efficient.

Sequence listing

<110> Fengyi (Shanghai) Biotechnology research and development center, Inc

<120> rice SNP marker and application thereof

<130> 199044

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 70

<212> DNA

<213> Artificial Sequence

<400> 1

tgcccatgat tcataactgt caygttacct aatttcagaa ctrtttggac agaagtgata 60

tcatcagatc 70

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

tgcccatgat tcataactgt 20

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 3

gatctgatga tatcacttct gtcc 24

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

tggaacttac tggtcatacg 20

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 5

ctgaaattag gtaacgtgac ag 22

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 6

ctgaaattag gtaacatgac ag 22

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 7

caagttagga acaatggcat gcagg 25

<210> 8

<211> 70

<212> DNA

<213> Artificial Sequence

<400> 8

tgcccatgat tcataactgt catgttacct aatttcagaa ctatttggac agaagtgata 60

tcatcagatc 70

<210> 9

<211> 147

<212> DNA

<213> Artificial Sequence

<400> 9

tggaacttac tggtcatacg gcaaataaca agttaggaac aatggcatgc aggcctgctc 60

ctattcaggt acctttgtgc ccatgattca taactgtcat gttacctaat ttcagaacta 120

tttggacaga agtgatatca tcagatc 147

<210> 10

<211> 70

<212> DNA

<213> Artificial Sequence

<400> 10

tgcccatgat tcataactgt cacgttacct aatttcagaa ctrtttggac agaagtgata 60

tcatcagatc 70

<210> 11

<211> 147

<212> DNA

<213> Artificial Sequence

<400> 11

tggaacttac tggtcatacg gcaaataaca agttaggaac aatggcatgc aggcctgctc 60

ctattcaggt acctttgtgc ccatgattca taactgtcac gttacctaat ttcagaactr 120

tttggacaga agtgatatca tcagatc 147

<210> 12

<211> 501

<212> DNA

<213> Artificial Sequence

<400> 12

tttcttcaat tgaaaattat ttaggcagat gccaagaccc ttcgattcaa ggataaggta 60

ttaaaaaagg gtgggttgtg gagagatata tatggtattg atgaaaagaa ggttgctagc 120

ttggtaagag aggacaaagt ggatatactt gtggaactta ctggtcatac ggcaaataac 180

aagttaggaa caatggcatg caggcctgct cctattcagg tacctttgtg cccatgattc 240

ataactgtca tgttacctaa tttcagaact atttggacag aagtgatatc atcagatcat 300

tatgttctga aaccagcttc ttctgatctt gctaacatga ttgcttcctt ttcactctag 360

tcaatgaaac tattcaagtg tctaataata aatgattatc tgactattct actatgtgat 420

tagtgaactg acaggggctt cttttacttg aattgcctgc acaggttaca tggattggct 480

accctaatac aacaggtctg c 501

Claims (10)

1. An isolated nucleic acid molecule from an elongated rice straw gene, comprising a first SNP marker and optionally a second SNP marker, wherein the first SNP marker is located at position 27996894 on chromosome 8 of a rice genome and the second SNP marker is located at position 27996914 on chromosome 8 of the rice genome, and wherein the nucleic acid molecule is a fragment of the elongated rice straw gene.

2. The nucleic acid molecule of claim 1, wherein said nucleic acid molecule is 10bp to 600bp in length; preferably, the nucleotide sequence of the nucleic acid molecule comprises at least the nucleotide sequence shown in SEQ ID NO. 1, or at least the nucleotide sequence shown in SEQ ID NO. 8 or 10, or at least the nucleotide sequence shown in SEQ ID NO. 9 or 11.

3. Primers for the detection of a first SNP marker and optionally a second SNP marker in the genome of rice, wherein the first SNP marker is located at position 27996894 on chromosome 8 of the genome of rice and the second SNP marker is located at position 27996914 on chromosome 8 of the genome of rice,

more preferably, the primer is selected from:

(1) 2 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID NO 8 or 10 or a sequence which is at least 90% identical thereto;

(2) 4 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID NO 9 or 11 or a sequence which is at least 90% identical thereto; and

(3) a mixture of the sequences of (1) and (2).

4. A probe for detecting a first SNP marker and optionally a second SNP marker in the genome of rice, wherein the first SNP marker is located at position 27996894 on chromosome 8, the second SNP marker is located at position 27996914 on chromosome 8,

preferably, the probe for detecting the second SNP marker enhances the typing specificity of the HRM detection method,

more preferably, the probe has (1) a nucleotide sequence shown in SEQ ID NO:5 or 6 or a sequence that hybridizes under stringent conditions to any one of SEQ ID NO:8-11 or a variant having 70% sequence identity thereto, or (2) the complement of (1).

5. A kit comprising a reagent for detecting a first SNP marker in a rice genome, wherein the first SNP marker is located on chromosome 8 at position 27996894 of the rice genome,

preferably, the kit comprises a primer for detecting the first SNP marker and optionally a probe for detecting the first SNP marker and optionally a nucleic acid molecule comprising the first SNP marker.

6. The kit according to claim 5, further comprising a reagent for detecting a second SNP marker in the rice genome, the second SNP marker being located at 27996914 on chromosome 8 of the rice genome,

preferably, the kit comprises a primer for detecting the second SNP marker and optionally a probe for detecting the second SNP marker and optionally a nucleic acid molecule comprising the second SNP marker,

more preferably, the kit comprises: the primer of claim 3 and optionally the probe of claim 4 and optionally the nucleic acid molecule of any one of claims 1-2.

7. A method of identifying a rice variety, said method comprising:

(1) detecting a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker is positioned at 27996894 th chromosome 8 of the rice genome, the second SNP marker is positioned at 27996914 th chromosome 8 of the rice genome,

(2) and identifying the rice variety according to the first SNP and the optional second SNP, wherein the first SNP is TT and is identified as Wu Yong rice No. 4, otherwise, the first SNP is not Wu Yong rice No. 4, optionally, the second SNP is AA and is identified as non-Wu Yong rice No. 4 rice group I, and the second SNP is GG and is identified as non-Wu Yong rice No. 4 rice group II.

8. The method of claim 7, wherein said detecting comprises performing PCR; preferably, the assay is a fluorescent quantitative PCR or HRM assay.

9. The method for detecting the content or purity of the Wuyou rice No. 4 in the sample is characterized by comprising the following steps:

(1) amplifying a sequence containing a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker is located at position 27996894 of the No. 8 chromosome of the rice genome, the second SNP marker is located at position 27996914 of the No. 8 chromosome of the rice genome,

(2) determining the content or purity of the Wuyou rice No. 4 according to the amplification results of the first SNP marker and the optional second SNP marker, wherein the amplification result of the first SNP TT indicates the content or purity of the Wuyou rice No. 4, optionally, the second SNP AA indicates the non-Wuyou rice No. 4 rice group I, GG indicates the content or purity of the non-Wuyou rice No. 4 rice group II, preferably, the amplification is fluorescent quantitative PCR, and the method further comprises utilizing the 2 SNP marker according to the amplification results to determine the content or purity of the non-Wuyou rice No. 4 rice group II^-ΔΔCTThe method determines the content or purity of the Wuyou rice No. 4,

more preferably, said 2^-ΔΔCTThe method comprises the following steps: comparing the CT value of the probe of claim 4 in the sample with the CT value of an endogenous reference probe by using fluorescent quantitative PCR, comparing the comparison result with the delta CT of a control to obtain delta CT, and determining the content or purity of the Wuyou rice No. 4 by using the delta CT.

10. The application of a reagent for detecting a first SNP marker in a rice genome and an optional reagent for detecting a second SNP marker in the rice genome in the identification of rice varieties or the detection of the content or the purity of the number 4 of the Wuyou rice in rice, or the application in the preparation of a kit for identifying rice varieties or the detection of the content or the purity of the number 4 of the Wuyou rice in rice, wherein the first SNP marker is positioned at the 27996894 th site of the 8 th chromosome of the rice genome, the second SNP marker is positioned at the 27996914 th site of the 8 th chromosome of the rice genome,

preferably, the reagent comprises the primer of claim 3 and optionally the probe of claim 4 and optionally the nucleic acid molecule of any one of claims 1-2.

Images