CN114317794A - Rice SNP marker and application thereof - Google Patents

Abstract

The invention discloses an SNP marker and application thereof. Wherein the SNP marker is SEQ ID NO:1, or the SNP marker is a T or C of a 35 th base from the 5' end, or the SNP marker is a nucleotide sequence shown in SEQ ID NO:1, the 46 th base A or G from the 5' end. The SNP marker of the invention is closely related to rice varieties and can be effectively used for qualitative or quantitative detection of rice varieties.

Description

Rice SNP marker and application thereof

Technical Field

The present invention relates to SNP markers and their use.

Background

Jihong No. 6 is a new rice variety bred by sexual hybridization and backcross in 2004 by Jilin province Quanhe rice variety Limited company, Jiyujing, Nongda 3 and Xiangdao as male parents. Approved by the crop variety approval committee of Jilin province in 2014 1, and approved as Ji examine rice 2014019.

Jihong No. 6 is a rice variety which is excellent in the aspects of yield, quality, resistance and the like and produced in the rice district in Jilin province at present, has extremely high innovation value, reaches the domestic leading level, has obvious advantages particularly in the aspects of taste value, taste, renewability and the like, has the taste of pure rice aroma, and has viscoelasticity and renewability which are obviously higher than those of Jihong No. 6, and is a first new round-grain high-quality rice variety with aroma examined in Jilin province at present. The cultivation of Jihong No. 6 has important significance for improving the quality of Jilin province high-quality rice and promoting the rice brand in Jilin regions.

Jihong No. 6 belongs to fragrant rice, has good quality and rich nutrition, is deeply favored by consumers in the market, has continuously increased demand and higher price, and leads some lawless persons to adulterate other rice with similar grain type appearance into Jihong No. 6 rice by blurring to sell so as to gain the riot interest. Therefore, the simple, accurate and rapid identification of the purity of Jihong No. 6 rice is always a problem.

Generally, methods for distinguishing the Jihong No. 6 are mainly methods for smelling fragrance, chewing mouthfeel and the like, but the methods mainly depend on human senses to judge grain type and fragrance intensity, are poor in accuracy, and are more difficult to realize quantitative detection of the purity of the Jihong No. 6. The identification of the rice variety can be carried out by a standard NY/T1433-2014 rice variety identification technical specification SSR marker or an NY/T2745-2015 rice variety identification SNP marker, but the two identification methods are complex and time-consuming, and can only judge whether the rice variety is consistent with the original variety or not, and cannot carry out the quantitative judgment of adulteration. The rice industry company has clear demand for variety identification when buying Jihong No. 6 rice, and needs to identify rice varieties by a method which is simple and easy to operate and short in time to ensure that the purchased rice is really high-purity Jihong No. 6.

The SSR high-throughput sequencing of the Jihong No. 6 rice variety is compared to obtain a specific sequence of the Jihong No. 6 rice variety which is different from that of other rice varieties, the specificity detection of the nucleic acid sequences of specific sites of the Jihong No. 6 rice variety and other rice varieties is used for judging whether other rice is doped in the Jihong No. 6 rice variety, and endogenous reference genes and reference samples are introduced for quantitative analysis of the adulteration of the Jihong No. 6 rice.

The invention uses molecular biology method to quantitatively detect the adulteration of the Jihong No. 6 rice, quickly extracts DNA from a sample, uses the developed high-efficiency and sensitive Jihong No. 6 specific fluorescent probe and primer to perform fluorescent quantitative PCR amplification, and then performs quantitative analysis on the amplification data, thereby quantitatively judging the purity of the Jihong No. 6 rice. The method has the advantage that the incorporation amount of other rice varieties in the Jihong No. 6 rice variety can be quantitatively detected.

Disclosure of Invention

The invention provides an SNP marker which is related to Jihong No. 6 variety and can be effectively used for detecting rice variety, and the SNP marker is used for designing efficient and sensitive Jihong No. 6 rice specific primers and probes to detect sample DNA, thereby realizing quantitative judgment of the purity of the Jihong No. 6 rice variety and effectively solving the problem of quantitative identification of other rice varieties mixed in the Jihong No. 6 rice variety.

Specifically, the invention provides an isolated nucleic acid molecule from rice, which comprises a first SNP marker and a second SNP marker, wherein the first SNP marker is located at 9124431 th chromosome 4 of a rice genome and is T or C, and the second SNP marker is located at 9124442 th chromosome 4 of the rice genome and is A or G.

In one or more embodiments, the nucleic acid molecule is a fragment of at least 5bp in length. In one or more embodiments, the nucleic acid molecule is at least 10bp, 15bp, 20bp, 30bp, 40bp, 50bp, 60bp, 70bp, 80bp, 90bp, 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1kb in length. In one or more embodiments, the nucleic acid molecule is 10bp-600bp, 50-500bp, 100-400bp, 150-300bp, or 200-250bp in length.

In one or more embodiments, the nucleotide sequence of the nucleic acid molecule comprises at least the nucleotide sequence shown in SEQ ID NO. 1, or at least the nucleotide sequence shown in SEQ ID NO. 8 or 10, or at least the nucleotide sequence shown in SEQ ID NO. 9 or 11.

In one or more embodiments, the nucleotide sequence of the nucleic acid molecule includes SEQ ID NO 15.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 5 as primers to carry out PCR amplification to obtain 35 th nucleotide from the 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 60 th nucleotide from the 5' end of an amplification product, which is T or C; the second SNP marker is: the 46 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 4 and 5 as the primers is A or G, or the 71 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 2 and 3 as the primers is A or G.

The invention also provides a primer for detecting the first SNP marker and the second SNP marker in the rice genome, wherein the first SNP marker is positioned at 9124431 th site of the No. 4 chromosome of the rice genome and is T or C, and the second SNP marker is positioned at 9124442 th site of the No. 4 chromosome of the rice genome and is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 5 as primers to carry out PCR amplification to obtain 35 th nucleotide from the 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 60 th nucleotide from the 5' end of an amplification product, which is T or C; the second SNP marker is: the 46 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 4 and 5 as the primers is A or G, or the 71 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 2 and 3 as the primers is A or G.

In one or more embodiments, the primer is selected from the group consisting of: (1) 2 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID NO 8 or 10 or a sequence which is at least 90% identical thereto; (2) the sequences shown in SEQ ID NO. 4 and 5 or sequences which hybridize under stringent conditions to SEQ ID NO. 9 or 11 or sequences which are at least 90% identical thereto; and (3) mixtures of the sequences described in (1) and (2).

The invention also provides a probe for detecting a first SNP marker and a second SNP marker in the rice genome, wherein the first SNP marker is located at 9124431 th chromosome 4 of the rice genome and is T or C, and the second SNP marker is located at 9124442 th chromosome 4 of the rice genome and is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 5 as primers to carry out PCR amplification to obtain 35 th nucleotide from the 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 60 th nucleotide from the 5' end of an amplification product, which is T or C; the second SNP marker is: the 46 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 4 and 5 as the primers is A or G, or the 71 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 2 and 3 as the primers is A or G.

In one or more embodiments, the probe comprises (1) a gigantic No. 6 probe that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising the 60 th base from the 5 'end of SEQ ID No. 8 or the 35 th base from the 5' end of SEQ ID No. 9, and (2) a gigantic No. 6 probe that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising the 71 th base from the 5 'end of SEQ ID No. 8 or the 46 th base from the 5' end of SEQ ID No. 9.

In one or more embodiments, the probe further comprises (3) a non-gigamacro No. 6 probe that recognizes SEQ ID NO 10 or 11 or a fragment thereof comprising base 60 from the 5 'end of SEQ ID NO 10 or base 35 from the 5' end of SEQ ID NO 11, and optionally (4) a non-gigamacro No. 6 probe that recognizes SEQ ID NO 10 or 11 or a fragment thereof comprising base 71 from the 5 'end of SEQ ID NO 10 or base 46 from the 5' end of SEQ ID NO 11.

In one or more embodiments, the probe recognizes SEQ ID NO 9 or 11 or a fragment thereof comprising the 35 th and 46 th bases from the 5' end of SEQ ID NO 9 or 11. Illustratively, the probe includes one or more of: (1) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 35 th base from the 5 'end of SEQ ID NO 9 which is T, (2) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 46 th base from the 5' end of SEQ ID NO 9 which is A, (3) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 35 th base from the 5 'end of SEQ ID NO 11 which is C, (4) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 46 th base from the 5' end of SEQ ID NO 11 which is G, a complementary sequence of (5) (1) or (2) or (3) or (4). Preferably, the probe has (1) a nucleotide sequence shown in SEQ ID NO. 6 or 7 or a sequence that hybridizes under high stringency conditions to any one of SEQ ID NO. 8-11 or a mutant thereof having 70% sequence identity thereto, or (2) the complement of (1).

The invention also provides a kit which contains a reagent for detecting the first SNP marker in the rice genome, wherein the first SNP marker is positioned at 9124431 th chromosome 4 of the rice genome and is T or C.

In one or more embodiments, the first SNP marker is: the 35 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 5 as the primers is T or C, or the 60 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is T or C.

In one or more embodiments, the kit comprises a primer for detecting the first SNP marker and optionally a probe for detecting the first SNP marker and optionally a nucleic acid molecule having the first SNP marker.

In one or more embodiments, the kit further comprises a reagent for detecting a second SNP marker in the rice genome, wherein the second SNP marker is located on chromosome 4, position 9124442, of the rice genome and is a or G.

In one or more embodiments, the second SNP marker is: the 46 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 4 and 5 as the primers is A or G, or the 71 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 2 and 3 as the primers is A or G.

In one or more embodiments, the kit comprises a primer for detecting the second SNP marker and optionally a probe for detecting the second SNP marker and optionally a nucleic acid molecule having the second SNP marker.

In one or more embodiments, the kit comprises: a primer as described in any embodiment herein, optionally a probe as described in any embodiment herein and optionally a nucleic acid molecule as described in any embodiment herein.

In one or more embodiments, the kit comprises: 2 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID No. 8 or 10 or a sequence which is at least 90% identical thereto or a sequence which is the complement thereof, and optionally a nucleic acid molecule whose nucleotide sequence comprises at least the nucleotide sequence shown in SEQ ID No. 1 or the complement thereof, or at least the nucleotide sequence shown in SEQ ID No. 8 or 10 or the complement thereof, or at least the nucleotide sequence shown in SEQ ID No. 9 or 11 or the complement thereof.

In one or more embodiments, the kit further comprises: 4 and 5 or a sequence which hybridizes under stringent conditions to SEQ ID NO 9 or 11 or to a sequence which is at least 90% identical thereto or to a complementary sequence thereof, and optionally a nucleotide sequence which is shown in SEQ ID NO 5 or 6 or a sequence which hybridizes under stringent conditions to any of SEQ ID NO 8-11 or to a mutant which has 70% sequence identity thereto or to a complementary sequence thereof.

The invention also provides a method for identifying rice varieties, which comprises the step of detecting a first SNP marker and a second SNP marker in a rice genome, wherein the first SNP marker and the second SNP marker are positioned on the No. 4 chromosome of the rice genome, the first SNP marker is positioned on the No. 4 chromosome 9124431 and is T or C, and the second SNP marker is positioned on the No. 4 chromosome 9124442 and is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 60 th nucleotide from the 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 5 as primers to carry out PCR amplification to obtain 35 th nucleotide from the 5' end of an amplification product, which is T or C; the second SNP marker is: the 71 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NOS: 2 and 3 as the primers is A or G, or the 46 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NOS: 4 and 5 as the primers is A or G.

In one or more embodiments, the method further comprises identifying the rice variety based on the detected first SNP and second SNP, wherein the first SNP with gemo 6 is TT, the second SNP is AA, the first SNP without gemo 6 is CC, and the second SNP is GG.

In one or more embodiments, the detection comprises PCR, more preferably, the detection is fluorescent quantitative PCR or HRM detection.

The present invention also provides a method for detecting the amount or purity of Jihong No. 6 in a sample, which comprises the step of amplifying the sequences of a first SNP marker and a second SNP marker in the genome of rice, wherein the first SNP marker and the second SNP marker are located on chromosome 4 of the genome of rice, the first SNP marker is located on chromosome 4, position 9124431, which is T or C, and the second SNP marker is located on chromosome 4, position 9124442, which is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 60 th nucleotide from the 5 'end of an amplification product, which is T, or taking the rice genome DNA as the template, and taking SEQ ID NO 4 and SEQ ID NO 5 as primers to carry out PCR amplification to obtain 35 th nucleotide from the 5' end of the amplification product, which is T; the second SNP marker is: the 71 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NOS: 2 and 3 as the primers is A or G, or the 46 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NOS: 4 and 5 as the primers is A.

In one or more embodiments, the method further comprises determining the content or purity of gemos No. 6 based on the amplification results of the first SNP marker and the second SNP marker. Wherein the amplification result of the first SNP of TT and the second SNP of AA indicates the content or purity of Ji macro No. 6; the amplification results for the first SNP being CC and the second SNP being GG indicate the content or proportion of non-Gilg Macro No. 6.

In one or more embodiments, the amplification is fluorescent quantitative PCR, and the method further comprises utilizing 2 according to the amplification result^-ΔΔCTThe method determines the content or purity of Jihong No. 6.

More preferably, said 2^-ΔΔCTThe method comprises the following steps: and comparing the CT value of the probe for identifying the first SNP marker and the optional second SNP marker in the sample with the CT value of an endogenous reference probe, and comparing the comparison result with the delta CT of a control, and determining the content or purity of the Jihong No. 6 by using the obtained delta CT.

Specifically, the method for detecting the content or purity of the Gicron No. 6 in the sample comprises the following steps: and (3) detecting the CT value of the probe for identifying the first SNP marker and the second SNP marker and the CT value of the probe for identifying the endogenous reference by fluorescent quantitative PCR, subtracting the two to obtain a sample delta CT, subtracting the sample delta CT from the delta CT of a reference to obtain the delta CT, wherein the reference is 100% of the Jihong No. 6 sample or 100% of the non-Jihong No. 6 sample, and carrying out 2-power on the negative number of the delta CT to obtain a relative content value for quantitative judgment of the Jihong No. 6 sample and the non-Jihong No. 6 sample. In one or more embodiments, the probe recognizing the first SNP marker and the second SNP marker has a nucleotide sequence shown by SEQ ID NO. 6 or 7. In one or more embodiments, the probe that recognizes the endogenous reference has the nucleotide sequence set forth in SEQ ID NO. 14.

The invention also provides application of a reagent for detecting the first SNP marker and the second SNP marker in a rice genome in identifying rice varieties or detecting the content or purity of the Gingo 6 in rice, or in preparing a kit for identifying rice varieties or detecting the content or purity of the Gingo 6 in rice, wherein the first SNP marker and the 49124431 second SNP marker are positioned on the No. 4 chromosome of the rice genome, the first SNP marker is positioned on the No. 8 chromosome 9124431 and is T or C, and the second SNP marker is positioned on the No. 8 chromosome 9124442 and is A or G.

In one or more embodiments, the first SNP marker is: taking rice genome DNA as a template, and taking SEQ ID NO 2 and SEQ ID NO 3 as primers to carry out PCR amplification to obtain 60 th nucleotide from the 5 'end of an amplification product, which is T or C, or taking rice genome DNA as a template, and taking SEQ ID NO 4 and SEQ ID NO 5 as primers to carry out PCR amplification to obtain 35 th nucleotide from the 5' end of an amplification product, which is T or C; the second SNP marker is: the 71 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NOS: 2 and 3 as the primers is A or G, or the 46 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NOS: 4 and 5 as the primers is A or G.

In one or more embodiments, the reagent comprises a primer as described in any embodiment herein and optionally a probe as described in any embodiment herein and optionally a nucleic acid molecule as described in any embodiment herein.

In one or more embodiments, the rice variety is identified based on the first SNP and the second SNP detected, wherein the first SNP with gemo 6 is TT, the second SNP is AA, the first SNP without gemo 6 is CC, and the second SNP is GG.

Drawings

FIG. 1: HRM detection of Ji macro No. 6 and non-Ji macro No. 6 and detection of a primer probe position diagram by a fluorescence probe method.

FIG. 2: HRM (high-resolution melting) typing map of Jihong No. 6 and other non-Jihong No. 6 rice varieties.

FIG. 3: and quantitative data graphs of standard samples with different contents of Ji macro No. 6 and non-Ji macro No. 6. The A diagram sequentially comprises from left to right: 0% non-giga macro No. 6 standard, 5% non-giga macro No. 6 standard, 50% non-giga macro No. 6 standard, 95% non-giga macro No. 6 standard, 100% non-giga macro No. 6 standard. The diagram B sequentially comprises from left to right: 100% Jihong No. 6 standard sample, 95% Jihong No. 6 standard sample, 50% Jihong No. 6 standard sample, 5% Jihong No. 6 standard sample, 0% Jihong No. 6 standard sample.

FIG. 4: jihong No. 6 blind sample purity test. From left to right in sequence: 0% non-giga macro No. 6 standard, 5% non-giga macro No. 6 standard, 50% non-giga macro No. 6 standard, 95% non-giga macro No. 6 standard, 100% non-giga macro No. 6 standard, sample 1, sample 2.

Detailed Description

The inventor compares the specific sequence of the Jihong No. 6 rice variety which is distinguished from other rice varieties by SSR high-throughput sequencing of the Jihong No. 6 rice variety, judges whether other rice is doped in the Jihong No. 6 rice or not by the specific detection of the nucleic acid sequences of the Jihong No. 6 rice variety and other rice variety specific sites, and introduces endogenous reference genes and reference samples to carry out quantitative analysis on the adulteration of the Jihong No. 6 rice.

Specifically, the invention relates to an SNP marker related to a rice variety, a primer and a kit for detecting the SNP marker, application of the SNP marker, the primer and the kit in rice variety detection, and a method for detecting the rice variety.

The inventors found that SNP1 at position 9124431 and SNP2 at position 9124442 of chromosome 4 are related to rice cultivars. Specifically, SNP1 is the 35 th base T or C from the 5' end of the nucleotide sequence shown in SEQ ID NO. 1; SNP2 is the 46 th base A or G from the 5' end of the nucleotide sequence shown in SEQ ID NO. 1. The nucleotide sequence shown in SEQ ID NO. 1 is as follows:

CCCATGTTTGGAGATCAATCTCATAGATGCTCTCYTCCCAGTCACRTGCGCGAGCTCGCAACACCTGTCTCGCACTTTCCACA(SEQ ID NO:1)。

herein, SNP (single nucleotide polymorphism) is a type of molecular genetic marker, mainly referring to DNA sequence polymorphism caused by variation of single nucleotide on genome level. SNPs typically exhibit polymorphisms that involve only single base variations, such as transitions, transversions, insertions and deletions.

Herein, a rice variety refers to a rice line that has been bred to have different traits. The inventors found that SNP1 of Jihong No. 6 was homozygous TT, and SNP1 of non-Jihong No. 6 was homozygous CC; SNP2 of Gemini 6 is homozygous AA, and SNP2 of non-Gemini 6 is homozygous GG. Therefore, by detecting the above-mentioned SNP1 or SNP2 or SNP1 and SNP2 in a sample, it is possible to efficiently determine whether a rice variety is Jihong No. 6 or non-Jihong No. 6.

A "sample" as described herein is any type of polynucleotide-containing sample from a subject. Preferably, the sample described herein is derived from or comprises rice plant organs, tissues, cells, nucleic acids or products comprising rice plant organs, tissues, cells, nucleic acids including, but not limited to, rice leaves, roots, stems, flowers, fruits, seeds, cells, DNA, RNA, rice, broken rice, rice bran, rice hulls, processed or unprocessed rice foods such as rice flour, rice noodles. The DNA may be genomic DNA.

The term "nucleic acid" or "polynucleotide" refers to a Deoxyribonucleotide (DNA) or ribonucleotide polymer (RNA) in either single-or double-stranded form, and the complement thereof. Nucleic acids contain synthetic, non-natural or altered nucleotide bases. The nucleotide may be a ribonucleotide, a deoxyribonucleotide, or a modified form thereof. Examples of polynucleotides contemplated herein include single-and double-stranded DNA, single-and double-stranded RNA, and hybrid molecules having a mixture of single-and double-stranded DNA and RNA. The DNA may be the coding strand or the non-coding strand. In one or more embodiments, the sample comprises fragmented genomic DNA. Methods for obtaining genomic DNA and fragmenting are well known in the art.

The basic unit of DNA is deoxyribonucleotide, which is condensed by phosphodiester bond to form a long chain molecule. Each deoxyribonucleotide consists of a phosphate, a deoxyribose, and a base. Bases (bp) of DNA are mainly adenine (A), guanine (G), cytosine (C) and thymine (T). In the double-helix structure of double-stranded DNA, A is hydrogen-bonded to T, and G is hydrogen-bonded to C. The form of DNA includes cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be of any length, such as 50-500bp, 100-400bp, 150-300bp or 200-250 bp.

As used herein, a "primer" refers to a nucleic acid molecule having a specific nucleotide sequence that directs the synthesis at the initiation of nucleotide polymerization. The primer composition comprises one or more primers. The primers are typically two oligonucleotide sequences synthesized by man, one primer complementary to one DNA template strand at one end of the target region and the other primer complementary to the other DNA template strand at the other end of the target region, which functions as the initiation point for nucleotide polymerization. Primers designed artificially in vitro are widely used in Polymerase Chain Reaction (PCR), qPCR, sequencing, probe synthesis, and the like. The primer may be of any length, for example 5-200bp, 10-100bp, 20-800bp or 25-50 bp.

The primer of the invention is used for detecting SNP. The primer may be a nucleic acid molecule recognizing any one of SEQ ID NOS 8-11. In some embodiments, the primer has (1) a nucleotide sequence set forth in any one of SEQ ID NOs: 2-5 or a mutant having at least 70% sequence identity thereto, or (2) the complement of (1). In one or more embodiments, the primers are primer pairs having the sequences shown in SEQ ID NOS: 2 and 3 or SEQ ID NOS: 4 and 5, respectively. In discussing primers, the term "primer" as used herein means that the primer hybridizes to the template sequence under stringent or highly stringent conditions, and the fragment amplified by the pair of primers encompasses the 23 rd base and/or the 43 th base from the 5 'end of SEQ ID NO. 8 or 10, or encompasses the 100 th base and/or the 120 th base from the 5' end of SEQ ID NO. 9 or 11. Stringent conditions for hybridization of the nucleic acids described herein are known to those skilled in the art. Preferably, the conditions are such that the sequences are at least about 65%, 70%, 75%, 85%, 90%, 95%, 98% or 99% homologous to each other, typically remaining hybridized to each other. Non-limiting examples of stringent hybridization conditions are hybridization in a high salt buffer containing 6XSSC, 50mM Tris-HCl (pH7.5), 1m MEDTA, 0.02% PVP, 0.02% Ficolll, 0.02% BSA and 500mg/ml denatured salmon sperm DNA at 65 ℃ and optionally washed once or twice in 0.2XSSC, 0.01% BSA at 50 ℃.

The present invention may also employ probes to detect SNPs described herein. A "probe" as used herein is a nucleic acid sequence (DNA or RNA) that recognizes a sequence of interest (complementary to the sequence of interest). The probe is combined with the target gene through molecular hybridization to generate a hybridization signal, thereby displaying the target gene. The probe may include the entire sequence of interest or may be a fragment of the sequence of interest. The probe may be DNA or RNA transcribed therefrom. Typically, the probe carries a detectable label, such as a fluorescent label. Such fluorescent labels include, but are not limited to FAM, CY5, and VIC. Fluorescent labels suitable for use with the probes herein and methods of attaching them to the probes are known in the art.

Herein, the probe includes a Jihong No. 6 probe recognizing SEQ ID NO 8 or 9 or a fragment thereof comprising the 60 th and 71 th bases from the 5 'end of SEQ ID NO 8, or comprising the 35 th and 46 th bases from the 5' end of SEQ ID NO 9. Optionally, the probe may further comprise a non-giga macro No. 6 probe that recognizes SEQ ID NO 10 or 11 or a fragment thereof comprising the 60 th and 71 th bases from the 5 'end of SEQ ID NO 10, or comprising the 35 th and 46 th bases from the 5' end of SEQ ID NO 11.

In one or more embodiments, the probe comprises (1) a gigantic No. 6 probe that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising base 60 from 5 'of SEQ ID No. 8 or base 35 from 5' of SEQ ID No. 9, and (2) a gigantic No. 6 probe that recognizes SEQ ID No. 8 or 9 or a fragment thereof comprising base 71 from 5 'of SEQ ID No. 8 or base 46 from 5' of SEQ ID No. 9. The probe may further comprise (3) a non-gigamacro 6 probe that recognizes SEQ ID NO 10 or 11 or a fragment thereof comprising the 60 th base from the 5 'end of SEQ ID NO 10 or the 35 th base from the 5' end of SEQ ID NO 11, (4) a non-gigamacro 6 probe that recognizes SEQ ID NO 10 or 11 or a fragment thereof comprising the 71 th base from the 5 'end of SEQ ID NO 10 or the 46 th base from the 5' end of SEQ ID NO 11.

Illustratively, the probe comprises one or more selected from the group consisting of: (1) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 35 th base from the 5 'end of SEQ ID NO 9 which is T, (2) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 35 th base from the 5' end of SEQ ID NO 11 which is C, a complementary sequence of (3) (1) or (2). In another embodiment, the probe further comprises one or more of the following: (1) a probe recognizing SEQ ID NO 9 or a fragment thereof comprising the 46 th base from the 5 'end of SEQ ID NO 9 which is A, (2) a probe recognizing SEQ ID NO 11 or a fragment thereof comprising the 46 th base from the 5' end of SEQ ID NO 11 which is G, a complementary sequence of (3) (1) or (2). Preferably, the probe has (1) the nucleotide sequence shown in SEQ ID NO. 6 or 7 or a mutant having 70% sequence identity thereto, or (2) the complementary sequence of (1). In discussing probes, the term "recognition" as used herein means that the probe hybridizes to the template sequence under stringent or highly stringent conditions and said hybridization encompasses the 60 th and/or 71 th bases from the 5 'end of SEQ ID NO 8 or 10, or encompasses the 35 th and/or 46 th bases from the 5' end of SEQ ID NO 9 or 11.

The term "variant" or "mutant" as used herein refers to a polynucleotide that has a nucleic acid sequence altered by insertion, deletion or substitution of one or more nucleotides compared to a reference sequence, while retaining its ability to hybridize to other nucleic acids. A mutant according to any of the embodiments herein comprises a nucleotide sequence having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to a reference sequence (SEQ ID NOS: 1-12 as described herein) and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, BLASTn from NCBI. Mutants also include nucleotide sequences that have one or more mutations (insertions, deletions, or substitutions) in the reference sequence and in the nucleotide sequence, while still retaining the biological activity of the reference sequence. The plurality of mutations typically refers to within 1-10, such as 1-8, 1-5, or 1-3. The substitution may be a substitution between purine nucleotides and pyrimidine nucleotides, or a substitution between purine nucleotides or between pyrimidine nucleotides. The substitution is preferably a conservative substitution. For example, conservative substitutions with nucleotides of similar or analogous properties are not typically made in the art to alter the stability and function of the polynucleotide. Conservative substitutions are, for example, exchanges between purine nucleotides (A and G), exchanges between pyrimidine nucleotides (T or U and C). Thus, substitution of one or more sites with residues from the same in the polynucleotides of the invention will not substantially affect their activity. When referring to mutants having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% sequence identity to a primer (e.g.SEQ ID NO:2-5) or probe (e.g.SEQ ID NO:6-7) according to the invention, preferably such mutants will hybridize under high stringency conditions to the corresponding DNA sequence comprising SEQ ID NO:8, 9, 10 or 11. The high stringency conditions can be hybridization and membrane washing in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃.

In another aspect, the present invention provides a method for detecting a rice variety in a sample, comprising determining or quantifying the rice variety by performing the SNP marker detection described herein on a sample to be detected. The method further comprises: (1) extracting DNA of a sample to be detected; (2) determining or quantifying the genotype of the SNP markers described herein in the DNA using the primers and/or probes described herein; and (3) determining or quantifying the rice variety based on the results of (2). Wherein the rice variety with the first SNP of TT and the second SNP of AA is Jihong No. 6, the Jihong No. 6 can be detected and identified by the conventional method for detecting SNPs in the field, such as a fluorescence quantitative probe method or an HRM high resolution dissolution curve method, and the processes and the used reagents of the methods are well known in the field.

In one or more embodiments, the group of non-gemo No. 6 rice includes: seiki japonica 18, sufofeng 47, songjing 22, bei rice 7, tongyiang 518, feuler rice No. 1, longqing rice 3, nanjing 9108 and microballon rice No. 9.

Herein, the method for extracting DNA in a sample is not particularly limited, and DNA extraction methods suitable for use herein are well known in the art.

SNP marker detection methods suitable for use herein are well known in the art and include, but are not limited to: sequencing, single strand conformation polymorphism polymerase chain reaction (PCR-SSCP), real-time fluorescence quantitative PCR and high resolution melting curve analysis (HRM), fluorescent probe quantitative PCR, restriction fragment length polymorphism polymerase chain reaction (PCR-restriction fragment length polymorphism, PCR-RFLP), flight time mass spectrum and the like. Other reagents than primers and/or probes are known in the art as may be required in SNP marker detection methods.

According to some embodiments of the present invention, the method for determining or quantifying rice cultivars by detecting the SNP markers described herein in a test sample further comprises: extracting DNA in a sample; performing fluorescent quantitative PCR of DNA by using primers SEQ ID NO. 2 and SEQ ID NO. 3 to obtain an amplification product; performing HRM analysis on the amplification product to obtain the genotype of the SNP marker in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP marker.

According to other embodiments of the present invention, the method for determining or quantifying rice cultivars by detecting the SNP markers described herein in a test sample further comprises: extracting DNA in a sample; carrying out fluorescent quantitative PCR of DNA by using primers SEQ ID NO. 4 and 5, probes SEQ ID NO. 6 and 7, and a reference probe SEQ ID NO. 14; analyzing the PCR result to obtain the genotype of the SNP marker in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP marker.

For example, a method for detecting the level or purity of gemo 6 in a sample comprises: and (3) detecting the CT value of the probe for identifying the first SNP marker and the second SNP marker and the CT value of the probe for identifying the endogenous reference by fluorescent quantitative PCR, subtracting the two to obtain a sample delta CT, subtracting the sample delta CT from the delta CT of a reference to obtain the delta CT, wherein the reference is 100% of the Jihong No. 6 sample or 100% of the non-Jihong No. 6 sample, and carrying out 2-power on the negative number of the delta CT to obtain a relative content value for quantitative judgment of the Jihong No. 6 sample and the non-Jihong No. 6 sample. In one or more embodiments, the probe recognizing the first SNP marker and optionally the second SNP marker has a nucleotide sequence shown in SEQ ID NO. 6 or 7. In one or more embodiments, the probe that recognizes the endogenous reference has the nucleotide sequence set forth in SEQ ID NO. 14.

The invention also provides a kit containing a reagent for detecting the first SNP marker in the rice genome, wherein the first SNP marker in the rice genome is: the 35 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 4 and 5 as the primers is T or C, or the 60 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genomic DNA as the template and the SEQ ID NO's 2 and 3 as the primers is T or C. The kit also contains a reagent for detecting a second SNP marker in the rice genome, wherein the second SNP marker is as follows: the 46 th nucleotide from the 5 'end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 4 and 5 as the primers is A or G, or the 71 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with the rice genome DNA as the template and the SEQ ID NO 2 and 3 as the primers is A or G. The reagent may be a primer and/or a probe as described in any embodiment herein. Optionally, the kit further comprises a nucleic acid molecule (i.e., amplification product) of the invention, which can be used as an internal standard or positive control. Preferably, the primer is selected from: (1) 2 and 3 or a sequence having at least 90% identity thereto; (2) 4 and 5 or a sequence having at least 90% identity thereto; and (3) mixtures of the sequences described in (1) and (2). The probe is selected from: (1) 6 and 7 or a sequence having at least 90% identity thereto; (2) (1) the complement of said sequence. Preferably, the probes have fluorescent labels, such as fluorescent labeling by FAM, VIC and CY5, respectively. The kit may further contain various reagents required for performing PCR, such as buffers, enzymes, dNTPs, and the like.

In a preferred embodiment, the kit of the invention comprises: the primer sequences shown in SEQ ID NO 2 and 3. In another preferred embodiment, the kit of the invention comprises: primer sequences shown in SEQ ID NOS 4 and 5; a probe shown as SEQ ID NO. 6, which is fluorescently labeled with FAM; the probe shown as SEQ ID NO. 7, which is labeled by VIC fluorescence; 14, which is fluorescently labeled with CY 5.

The SNP marker and the application thereof have the advantages that:

the invention can qualitatively or quantitatively detect the doping amount of other rice varieties in the Jihong No. 6 rice variety. The invention utilizes a molecular biology method to quantitatively detect the adulteration of the Jihong No. 6 rice, is suitable for products such as rice seeds, rice flour and the like, quickly extracts DNA from a sample, performs fluorescent quantitative PCR amplification by using a developed high-efficiency and sensitive Jihong No. 6 specific fluorescent probe and primer, and quantitatively analyzes the amplification data by setting an endogenous reference gene and a reference sample, thereby quantitatively judging the purity of the Jihong No. 6 rice. The result is visual and objective, can avoid artificial judgment, the operation is convenient and rapid, the quantitative limit reaches 5 percent, the probability of wrong judgment can be greatly reduced, the influence caused by variety, region, environment and the like is avoided, and the detection is more sensitive and efficient.

The present invention will be illustrated below by way of specific examples. It is to be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. The materials, reagents and methods not specifically described in the examples are not conventional in the art.

Examples

Example 1: materials and methods

1. Material

Jihong No. 6-Rice seeds, other Rice varieties and commercial Rice samples were all provided by Fengyi (Shanghai) Biotechnology research and development center, Inc.

2. Enzymes and reagents

The enzyme is purchased from Shijikang corporation and Bio-Rad corporation, the reagent is purchased from national medicine group chemical reagent limited corporation, and the fluorescence quantitative PCR instrument is Bio-Rad CFX 96; the primers and probes used in the experiment were synthesized by Shanghai Bioengineering Co.

3. Experimental methods

3.1 extraction of DNA from Rice seeds (Rice-like)

Grinding 20 g of rice seeds (rice samples) by using a grinder, weighing 50mg of powder into a 2mL sample cracking tube, adding 500 mu L of Buffer 1, uniformly mixing by oscillation of a vortex instrument for 30s, incubating for 30min at 52 ℃, and rotating at 1200 rpm; adding 500 μ L Buffer 2, mixing with vortex instrument for 30s, centrifuging the mixture for 5min (12000rpm), sucking 500 μ L supernatant, diluting the obtained DNA solution with sterilized pure water 10 times as template DNA, placing in sample dilution tube, storing at 4 deg.C for a short period, and storing at-20 deg.C for a long period. Or extracting the DNA of the rice seeds or the rice samples according to the operation instruction of the Jihong No. 6 rice purity quantitative detection kit.

Design of specific primer and probe for No. 3.2 Jihong No. 6 rice

Aiming at the specific fragment sequence of the Jihong No. 6 rice variety, primer5 is designed to be specific.

HRM high resolution melting curve method detection primers:

JH6-C4-3F：5’-CAGGTCGCTACCGTGGAGAAG-3’(SEQ ID NO:2)；

JH6-HRM-C4-3R：5’-CAGGTGTTGCGAGCTCGCGCA-3’(SEQ ID NO:3)；

the probe detection method comprises the following primers:

JH6-3F3：5’-CCCATGTTTGGAGATCAATCTC-3’(SEQ ID NO:4)；

JH6-C4-3R：5’-TGTGGAAAGTGCGAGACAGGTGT-3’(SEQ ID NO:5)；

designing a probe:

FJH6H-FAM-P1：5’-FAM-ATGCTCTCCTCCCAGTCACGTGC-BHQ1-3’(SEQ ID NO:6)；

JH6H-23VIC-P3：5’-VIC-ATGCTCTCTTCCCAGTCACATGC-BHQ1-3’(SEQ ID NO:7)。

detecting a primer amplification fragment 108bp by using a HRM high-resolution melting curve method:

gemo 6 nucleic acid sequence:

CAGGTCGCTACCGTGGAGAAGGCGGCCCATGTTTGGAGATCAATCTCATAGATGCTCTCTTCCCAGTCACATGCGCGAGCTCGCAACACCTG (SEQ ID NO:8, FIG. 1)

Other rice nucleic acid sequences:

CAGGTCGCTACCGTGGAGAAGGCGGCCCATGTTTGGAGATCAATCTCATAGATGCTCTCCTCCCAGTCACGTGCGCGAGCTCGCAACACCTG (SEQ ID NO:10, FIG. 1)

Probe detection method primer amplified fragment 83 bp:

gemo 6 nucleic acid sequence:

CCCATGTTTGGAGATCAATCTCATAGATGCTCTCTTCCCAGTCACATGCGCGAGCTCGCAACACCTGTCTCGCACTTTCCACA (SEQ ID NO:9, FIG. 1)

Other rice nucleic acid sequences:

CCCATGTTTGGAGATCAATCTCATAGATGCTCTCCTCCCAGTCACGTGCGCGAGCTCGCAACACCTGTCTCGCACTTTCCACA (SEQ ID NO:11, FIG. 1)

Endogenous gene PLD primers:

PLD-F：5’-TGGTGAGCGTTTTGCAGTCT-3’(SEQ ID NO:12)；

PLD-R：5’-CTGATCCACTAGCAGGAGGTCC-3’(SEQ ID NO:13)。

endogenous gene PLD probe:

PLD-CY5-P：5’-CY5-TCCGAGCCGTCCGTGCGTC-BHQ1-3’(SEQ ID NO:14)。

example 2: real-time fluorescence quantitative PCR detection of HRM high resolution melting curve method

The extracted DNA is taken as a template, and real-time fluorescent quantitative PCR amplification is carried out on JH6-C4-3F and JH6-C4-3R by adopting an HRM high-resolution melting curve method detection primer pair. The PCR reaction system was 20. mu.L, in which SsoAdvancedTM was used

Green Supermix 10. mu.L, JH6-C4-3F and JH6-C4-3R primers (concentration 10. mu.M) each 0.5. mu.L, template DNA (concentration 50-100 ng/. mu.L) 2. mu.L, sterile water to make up to 20. mu.L. Blank controls were prepared by replacing template DNA with sterile water. Each reaction is repeated three times, and the PCR amplification program adopts a two-step method: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15 seconds, annealing at 60 ℃ for 1 minute, for 45 cycles.

After the real-time fluorescence PCR amplification is finished, directly applying Bio-Rad to the amplification product to read the HRM high-resolution melting curve, wherein the HRM high-resolution melting curve melting process comprises the following steps: 95 ℃ for 1min, 70 ℃ for 1min, then raising the temperature from 70 ℃ to 95 ℃ at the speed of 0.2 ℃/0.1s, collecting the melting curve data, and using the melting curve data in Precision Melt Analysis Software to perform HRM high-resolution melting curve typing.

The extracted DNA of different rice variety samples is taken as a template, real-time fluorescence quantitative PCR amplification is carried out on JH6-C4-3F and JH6-C4-3R by using HRM high-resolution melting curve method detection primers, then HRM high-resolution melting curve reading is carried out, HRM high-resolution melting curve typing is carried out by Precision Melt Analysis Software, and the result shows (figure 2) that the rice variety Jihong No. 6 has a specific HRM curve, which is different from the HRM typing of other rice varieties, and the rice of other varieties except Jihong No. 6 comprises: seiki japonica 18, sufofeng 47, songjing 22, bei rice 7, tongyiang 518, feuler rice No. 1, longqing rice 3, nanjing 9108, and microballon rice No. 9, and the like.

Example 3: probe method real-time fluorescent quantitative PCR detection

Using the extracted DNA as a template, detecting a primer by using a Jihong No. 6 probe method: JH6-3F3 and JH6-C4-3R, Ji Macro No. 6 specific probes: JH6H-23VIC-P3, and a non-Jihong No. 6 specific probe FJH6H-FAM-P1, and an endogenous reference gene PLD primer PLD-F and PLD-R, and an endogenous reference gene PLD probe PLD-CY 5-P. The PCR reaction system was 20. mu.L, with 2 XGoldStar Best MasterMix 10. mu.L, JH6-3F3 and JH6-C4-3R primers (10. mu.M each) 1. mu.L, PLD-F and PLD-R primers (10. mu.M each) 0.4. mu.L, JH6H-23VIC-P3 and FJH6H-FAM-P1 probes (10. mu.M) 0.25. mu.L, PLD-CY5-P probe (10. mu.M) 0.2. mu.L, template DNA 2. mu.L, sterile water to make up to 20. mu.L. Blank controls were prepared by replacing template DNA with sterile water. Each reaction is repeated three times, and the PCR amplification program adopts a two-step method: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15 s; annealing at 58 ℃ for 45s of extension for 45 cycles.

Firstly, the probe method is subjected to specificity analysis, the specific probe JH6H-23VIC-P3 of Jihong No. 6 only has an amplification signal in the rice variety of Jihong No. 6, and no amplification signal exists in other rice varieties, the probe FJH6H-FAM-P1 of non-Jihong No. 6 has an amplification signal in the rice variety of non-Jihong No. 6, and no amplification signal exists in the Jihong No. 6. And analyzing the fluorescent quantitative PCR data, and quantifying the contents of the rice varieties of Jihong No. 6 and non-Jihong No. 6 in the rice sample respectively. Gene expression data processing Using 2^-ΔΔCTThe method is carried out by taking a rice PLD-CY5-P probe as an endogenous reference gene, subtracting the CT values of the JH6H-23VIC-P3 and FJH6H-FAM-P1 probes in a sample from the CT value of the PLD-CY5-P probe to obtain a value delta CT, subtracting the value delta CT from the delta CT of a reference sample with 100% of content of Jihong No. 6 or 100% of content of non-Jihong No. 6, and carrying out 2-power subtraction on the obtained negative number of the delta CT to obtain a numerical value with relative content, wherein the numerical value is respectively used for quantitative judgment of the content of the Jihong No. 6 and non-Jihong No. 6 rice varieties in the rice sample.

The extracted DNA of standard samples with different contents is taken as a template, primers JH6-3F3 and JH6-C4-3R, a Jihong No. 6 specific probe JH6H-23VIC-P3 and a non-Jihong No. 6 specific probe FJH6H-FAM-P1 are used for carrying out real-time fluorescence PCR detection with an endogenous reference gene PLD-CY5-P probe, and the results show (figure 3), 0% of the non-Jihong No. 6 standard samples, 5% of the non-Jihong No. 6 standard samples, 50% of the non-Jihong No. 6 standard samples, 95% of the non-Jihong No. 6 standard samples, 100% of the non-Jihong No. 6 standard samples and 5 standard samples are increased in content according to the non-Jihong No. 6, the relative gene expression quantity also shows a relationship, and the unknown content of the non-Jihong No. 6 sample can be quantitatively detected by using the standard samples (figure 3A). The content of the relative gene expression level is decreased progressively by 100% Jihong No. 6 standard sample, 95% Jihong No. 6 standard sample, 50% Jihong No. 6 standard sample, 5% Jihong No. 6 standard sample, 0% Jihong No. 6 standard sample, 5 standard samples according to the content of the Jihong No. 6, and the content of the Jihong No. 6 sample of unknown detection sample can be quantified by the standard samples (figure 3B).

Example 4: jihong No. 6 blind sample purity detection

Detecting two configured blind sample samples of the Jihong No. 6 rice products, performing DNA extraction, fluorescence quantitative PCR amplification and data analysis according to the operation instruction of the Jihong No. 6 rice variety purity detection kit, and displaying the result (figure 4), wherein the content of the Jihong No. 6 in the blind sample is as follows: the content of the rice sample 1 is 30%, the content of the rice sample 2 is 60%, the detection results of the two blind samples are basically consistent with the proportion, and the proportion content is as follows: rice sample 1 was 32% gemo 6 and rice sample 2 was 58% gemo 6.

And (4) conclusion: the invention uses molecular biology method to quantitatively detect the adulteration of Jihong No. 6 rice, quickly extracts DNA from rice samples, uses developed high-efficiency and sensitive Jihong No. 6 specific fluorescent probe and primer to carry out fluorescent quantitative PCR amplification, and carries out quantitative analysis on amplification data by setting endogenous reference gene and reference samples, thereby quantitatively judging the purity of Jihong No. 6 rice, and the invention has visual result, convenient and quick operation, is not influenced by variety, region, environment and the like, and has more sensitive and efficient detection.

Sequence listing

<110> Fengyi (Shanghai) Biotechnology research and development center, Inc

<120> rice SNP marker and application thereof

<130> 123

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 83

<212> DNA

<213> Artificial sequence ()

<400> 1

cccatgtttg gagatcaatc tcatagatgc tctcytccca gtcacrtgcg cgagctcgca 60

acacctgtct cgcactttcc aca 83

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 2

caggtcgcta ccgtggagaa g 21

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 3

caggtgttgc gagctcgcgc a 21

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 4

cccatgtttg gagatcaatc tc 22

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 5

tgtggaaagt gcgagacagg tgt 23

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 6

atgctctcct cccagtcacg tgc 23

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 7

atgctctctt cccagtcaca tgc 23

<210> 8

<211> 92

<212> DNA

<213> Artificial sequence ()

<400> 8

caggtcgcta ccgtggagaa ggcggcccat gtttggagat caatctcata gatgctctct 60

tcccagtcac atgcgcgagc tcgcaacacc tg 92

<210> 9

<211> 83

<212> DNA

<213> Artificial sequence ()

<400> 9

cccatgtttg gagatcaatc tcatagatgc tctcttccca gtcacatgcg cgagctcgca 60

acacctgtct cgcactttcc aca 83

<210> 10

<211> 92

<212> DNA

<213> Artificial sequence ()

<400> 10

caggtcgcta ccgtggagaa ggcggcccat gtttggagat caatctcata gatgctctcc 60

tcccagtcac gtgcgcgagc tcgcaacacc tg 92

<210> 11

<211> 83

<212> DNA

<213> Artificial sequence ()

<400> 11

cccatgtttg gagatcaatc tcatagatgc tctcctccca gtcacgtgcg cgagctcgca 60

acacctgtct cgcactttcc aca 83

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 12

tggtgagcgt tttgcagtct 20

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 13

ctgatccact agcaggaggt cc 22

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 14

tccgagccgt ccgtgcgtc 19

Claims (10)

1. An isolated nucleic acid molecule from rice comprising a first SNP marker located on chromosome 4 of the rice genome at position 9124431 and a second SNP marker located on chromosome 4 of the rice genome at position 9124442.

2. The nucleic acid molecule of claim 1, wherein said nucleic acid molecule is 10bp to 600bp in length; preferably, the nucleotide sequence of the nucleic acid molecule comprises at least the nucleotide sequence shown in SEQ ID NO. 1, or at least the nucleotide sequence shown in SEQ ID NO. 8 or 10, or at least the nucleotide sequence shown in SEQ ID NO. 9 or 11.

3. A primer for detecting a first SNP marker and a second SNP marker in a rice genome, wherein the first SNP marker is located at 9124431 th chromosome 4 of the rice genome, the second SNP marker is located at 9124442 th chromosome 4 of the rice genome,

more preferably, the primer is selected from:

(1) 2 and 3 or a sequence which hybridizes under stringent conditions to SEQ ID NO 8 or 10 or a sequence which is at least 90% identical thereto;

(2) the sequences shown in SEQ ID NO. 4 and 5 or sequences which hybridize under stringent conditions to SEQ ID NO. 9 or 11 or sequences which are at least 90% identical thereto; and

(3) a mixture of the sequences of (1) and (2).

4. A probe for detecting a first SNP marker and a second SNP marker in a rice genome, wherein the first SNP marker is located at position 9124431 of chromosome 4 in the rice genome, the second SNP marker is located at position 9124442 of chromosome 4 in the rice genome,

preferably, the probe has (1) a nucleotide sequence shown in SEQ ID NO. 6 or 7 or a sequence that hybridizes under stringent conditions to any one of SEQ ID NO. 8-11 or a variant having 70% sequence identity thereto, or (2) the complement of (1).

5. A kit comprising reagents for detecting a first SNP marker and a second SNP marker in a rice genome, wherein the first SNP marker is located at position 9124431 on chromosome 4 of the rice genome and the second SNP marker is located at position 9124442 on chromosome 4 of the rice genome,

preferably, the kit comprises primers for detecting the first SNP marker and the second SNP marker and optionally a probe for detecting the first SNP marker and optionally a nucleic acid molecule comprising the first SNP marker.

6. The kit according to claim 5, further comprising a reagent for detecting a second SNP marker in the rice genome, the second SNP marker being located at 9124442 on chromosome 4 of the rice genome,

preferably, the kit comprises a primer for detecting the second SNP marker and optionally a probe for detecting the second SNP marker and optionally a nucleic acid molecule comprising the second SNP marker,

more preferably, the kit comprises: the primer of claim 3 and optionally the probe of claim 4 and optionally the nucleic acid molecule of any one of claims 1-2.

7. A method of identifying a rice variety, said method comprising:

(1) detecting a first SNP marker and a second SNP marker in a rice genome, wherein the first SNP marker is located at 9124431 th chromosome 4 of the rice genome, the second SNP marker is located at 9124442 th chromosome 4 of the rice genome,

(2) and identifying the rice variety according to the first SNP and the second SNP, wherein the first SNP is TT, the second SNP is AA, the rice variety is identified as Jihong No. 6, and otherwise, the rice variety is identified as non-Jihong No. 6.

8. The method of claim 7, wherein said detecting comprises performing PCR; preferably, the assay is a fluorescent quantitative PCR or HRM assay.

9. A method for detecting the content or purity of gemo 6 in a sample, comprising:

(1) amplifying a sequence containing a first SNP marker and a second SNP marker in the rice genome, wherein the first SNP marker is located at 9124431 th chromosome 4 of the rice genome, the second SNP marker is located at 9124442 th chromosome 4 of the rice genome,

(2) determining the content or purity of the gemos 6 according to the amplification results of the first SNP marker and the second SNP marker, wherein the amplification result of the first SNP is TT and the amplification result of the second SNP is AA indicates the content or purity of the gemos 6, preferably, the amplification is fluorescence quantitative PCR, and the method further comprises utilizing 2 to determine the content or purity of the gemos 6 according to the amplification results^-ΔΔCTThe method determines the content or purity of Jihong No. 6,

more preferably, said 2^-ΔΔCTThe method comprises the following steps: comparing the CT value of the probe of claim 4 in a sample with the CT value of an endogenous reference probe using fluorescence quantitative PCR and comparing the comparison result with the Δ CT of a control to obtain Δ Δ CT, and determining the content or purity of gemo 6 using Δ Δ CT.

10. The application of a reagent for detecting a first SNP marker and a reagent for detecting a second SNP marker in a rice genome in the identification of rice varieties or the detection of the content or the purity of the Gingo 6 in rice or the preparation of a kit for the identification of rice varieties or the detection of the content or the purity of the Gingo 6 in rice, wherein the first SNP marker is positioned at the 9124431 th site of the 4 th chromosome of the rice genome, the second SNP marker is positioned at the 9124442 th site of the 4 th chromosome of the rice genome,

preferably, the reagent comprises the primer of claim 3 and optionally the probe of claim 4 and optionally the nucleic acid molecule of any one of claims 1-2.

Images