CN114350793A - Application of exosome miRNA in preparation of chronic pain-depression co-morbid diagnosis product - Google Patents

Abstract

The invention discloses application of exosome miRNA in preparation of a chronic pain-depression comorbid diagnosis product, wherein the exosome miRNA is a plasma exosome miR-351-5 p. The invention also discloses a chronic pain-depression comorbidity diagnosis kit, which comprises a reagent for detecting the exosome miR-351-5p, wherein the reagent comprises miR-351-5p reverse transcription primers, PCR detection upstream and downstream primers, a reverse transcription primer sequence, a PCR detection upstream primer sequence and a PCR detection downstream primer sequence. The marker is different from the traditional biomarker, the exosome miR-351-5p in blood is stable, minimally invasive, easy to detect and accurate in quantification, can greatly improve the sensitivity and specificity of chronic pain-depression co-disease diagnosis, and can provide a treatment basis for a clinician to quickly master the illness state of a patient and adopt a more personalized analgesia scheme as soon as possible.

Description

Application of exosome miRNA in preparation of chronic pain-depression co-morbid diagnosis product

Technical Field

The invention discloses application of exosome miRNA in preparation of a chronic pain-depression comorbid diagnosis product, belonging to the field of biological medicine.

Background

Pain is an unpleasant sensory and emotional experience with actual or potential tissue damage, or a similar experience. Chronic pain refers to pain that persists or recurs for more than three months. According to epidemiological investigation, the incidence rate of chronic pain in China is about 36 percent on average; in addition, the incidence of chronic pain increases with age. In view of this, chronic pain has become one of the ubiquitous health problems in modern society. Various factors such as biology and society can affect chronic pain, and psychological factors have a key role in the generation, development and outcome of chronic pain. The clinical manifestations of pain not only can lead to the reduction of the life quality of patients and poor health, but also can obviously lead to the lowering of the mood of patients, and the pain perception is further aggravated by negative emotions such as anxiety, depression and the like. The six factors that lead to the failure of chronic pain management are primarily psychosocial factors, including: pain leads to functional disability and stress, which in turn exacerbates pain, creating a vicious circle; second, unhealthy lifestyle, lack of social support, depressive psychosis, and history of drug abuse can all contribute to the transition from acute pain to chronic pain. The results of the survey show that 20% to 50% of chronic pain patients are accompanied by depressive manifestations. Depression, a mental disorder disease, is clinically manifested by depressed mood, anhedonia, loss of interest, avoidance of social activities, and the like; of note, chronic pain is the most common accompanying physical discomfort symptoms in depressive disorders following sleep disorders and decreased appetite. The symptoms of depression are closely related to the onset and severity of chronic pain, while the current mechanisms that induce depression are not well defined. In recent years, some results have been obtained in the study of the pathogenesis of chronic pain, but the clinical analgesic effect is expected to be improved significantly and purposefully, and the most important reason is that depression is caused. The chronic pain patients with depression not only aggravate clinical symptoms, but also greatly increase the difficulty of effectively relieving pain. Therefore, the early intervention on patients with chronic pain and depression symptoms can effectively improve the treatment effect, so that the search for a new diagnosis target of the co-morbid disease is significant.

The occurrence of chronic pain and depression is influenced by a plurality of factors, and the relative susceptibility of individuals to the two diseases can be different due to living environment, immune inflammation, genetic factors and the like. Chronic pain has an overlapping component with depression in many risk factors, of which genetic factors are of particular importance. A3266 female twin survey study showed 86% genetic association between depression and chronic pain. The modification of genetic materials such as histone, DNA and the like is involved in the occurrence and development of chronic pain and depression. microRNA (miRNA) is a non-coding microRNA of 18-22 nucleotides in length that functions as a post-transcriptional regulator of gene expression. Through the target combination with the non-coding region at the 3' end of the target gene, the expression level of the gene is controlled by inhibiting the translation of the gene or inducing the degradation of mRNA after transcription. In recent years, research on exosome miRNA is relatively extensive, and the main signal source of miRNA in human peripheral blood is exosome. Exosomes (exosomes) are lipid bilayer vesicles 40-100nm in diameter that can carry a variety of biomolecules including DNA, mRNA, miRNA, and proteins to exert bioregulatory effects between cells. It has been shown that the exosome surface markers CD9, CD63 and TSG101 are all expressed in the plasma of depressed patients. Recent research also shows that exosome miRNA participates in regulation of HPA axis of depression and regulation of signal pathways such as brain-derived neurotrophic factor (BDNF), Wnt/beta-catenin and the like, regulates occurrence and development of depression, and is a potential biomarker for diagnosis and treatment of depression. Separating exosome miRNA in peripheral blood of a patient with chronic pain, identifying a marker miRNA of a patient susceptible to depression, and treating depression symptoms as soon as possible to improve the treatment effect of chronic pain.

Disclosure of Invention

The invention aims to provide application of an exosome miRNA in preparation of a chronic pain-depression co-morbid diagnosis product or auxiliary diagnosis, wherein the miRNA is a plasma exosome miR-351-5p, and the sequences of the plasma exosome miR-351-5p are shown as SEQ ID No.1 (human source) and SEQ ID No.2 (murine source).

SEQ ID No.1：mmu-miR-351-5p:UCCCUGAGGAGCCCUUUGAGCCUG

SEQ ID No.2：rno-miR-351-5p:UCCCUGAGGAGCCCUUUGAGCCUGA

The invention also provides a chronic pain-depression co-morbid diagnosis kit, which is a reagent for detecting the exosome miR-351-5p and comprises any reagent used in a method for detecting the existence or the expression level of the miR-351-5 p. The method for detecting the existence or the expression level of the exosome miR-351-5p adopts but is not limited to the following steps: relative quantitative RT-PCR, absolute quantitative PCR, digital PCR.

The reagent comprises: reverse transcription primers of miR-351-5p and upstream and downstream primers for PCR detection. The sequence of the reverse transcription primer is shown as SEQ ID No. 3. The PCR detection upstream primer sequence of miR-351-5p is shown as SEQ ID No.4, and the PCR detection downstream primer sequence of miR-362 is shown as SEQ ID No. 5.

SEQ ID No.3：

mmu-miR-351-5p(RT):GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGCTCA

SEQ ID No.4：mmu-miR-351-5p(F):CGTTCCCTGAGGAGCCCTT

SEQ ID No.5：General mmu-miR(R)ATCCAGTGCAGGGTCCGAGG

The kit further comprises reagents for isolating the exosomes, reagents for lysing the exosomes, and reagents for isolating the exosomes include any reagents used in a method capable of isolating exosomes.

Methods for isolating exosomes include, but are not limited to, ultracentrifugation, precipitation, size exclusion chromatography, affinity separation, immunomagnetic bead, ultrafiltration, and the like.

The step of evaluating chronic pain-depression comorbidity of the diagnostic product comprises the following steps:

(1) isolating exosomes from the body fluid;

(2) detecting the expression level of exosome miR-351-5 p;

(3) and diagnosing the patients with chronic pain and depression according to the expression level of the exosome miR-351-5 p.

The invention screens miRNAs with differential expression in a depression susceptible group and a depression non-susceptible group of rats of a sciatic nerve branch injury (SNI) chronic pain model established in the early stage by technologies such as plasma ultracentrifugation, high-throughput sequencing and the like, wherein the expression of miRNA-351-5p in the depression susceptible group is obviously reduced compared with that in the non-susceptible group. The miRNA is suggested to be related to the occurrence of depression in an SNI chronic pain model and is expected to become one of early diagnosis indexes of the co-morbid condition.

In the invention, the applicant uses SPSS and R languages to perform statistical analysis on the result. The statistical analysis of the measurement data is carried out by adopting t test and variance; p <0.05 was considered statistically significant. The histogram is done by GraphPad mapping software and the heatmap is done by R language software.

The advantages and beneficial effects are as follows:

the marker provided by the invention is different from the traditional biomarker, the exosome miR-351-5p in blood is stable, minimally invasive, easy to detect and accurate in quantification, can greatly improve the sensitivity and specificity of chronic pain-depression co-disease diagnosis, and can provide a treatment basis for a clinician to quickly master the illness state of a patient and adopt a more personalized analgesia scheme as soon as possible.

Drawings

FIG. 1 is a graph of cluster analysis performed by the SNI surgery group according to the experimental results of sugar water preference;

FIG. 2 is a bar graph of the carbohydrate preference test for sham, susceptible and non-susceptible groups, P <0.05, with the susceptible group statistically significant compared to the other two groups;

FIG. 3 is a Brownian motion view and a particle size distribution curve view of exosomes in rat plasma samples;

FIG. 4 shows the Western Blot results of exosome surface-specific markers TSG101 and CD 63;

FIG. 5 shows exosomes observed under an electron microscope;

FIG. 6 is a bar graph of differential miRNAs screened among sham, susceptible and non-susceptible groups (up-regulated to the up-regulated number of miRNAs with significant differences, down-regulated to the down-regulated number of miRNAs with significant differences);

fig. 7 is a volcano plot of differential mirnas in the susceptible group and the non-susceptible group and the sham group, respectively (circles are non-differential mirnas, triangles are up-regulated significantly differential mirnas, squares are down-regulated significantly differential mirnas);

FIG. 8 is a graph of cluster analysis of differentially expressed miRNAs in the susceptible group and the sham and non-susceptible groups, respectively (light color indicates high expression and dark color indicates low expression);

figure 9 is a bar graph of the difference in expression of miRNA-351-5P in exosomes in sham, susceptible and non-susceptible groups, with P <0.05, and the susceptible group was statistically significant compared to the other two groups.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and the described embodiments are only a part of the embodiments of the present invention, but not all of the embodiments.

Example 1: differences of social and behavioral experiments of sciatic nerve branch injury model depression susceptible mice and non-susceptible mice

1.1 Experimental animals

Male Sprague Dawley rats (SD rats, 180-. SD rats were randomly divided into two groups before the experiment: sham (sham) and Surgery (SNI).

1.2 Depression susceptible group non-susceptible group rat modeling process

The experiment used 180-230g male adult SD rats to construct the sciatic nerve branch injury (SNI) model. General anesthesia was performed with 10% chloral hydrate (3mgl/kg) at the time of surgery, and skin and muscle were incised in the middle of the thigh of the left hind leg of the rat, exposing the sciatic nerve and its three branches. The common peroneal nerve and the tibial nerve were ligated with 4.0 suture and cut, the sural nerve was left intact, and the skin was sutured with 4.0 suture. Rats in the sham group received the same procedure but all nerves were intact. After surgery, the sham surgery group and the SNI surgery group were subjected to a behavioral test of sugar water preference, depression-like behaviors of two groups of rats were evaluated according to the results of the behavioral test, and the SNI surgery group was divided into a refractory group (susceptable) and a non-refractory group (resilient) according to the results of the behavioral test, as shown in fig. 1.

1.3 social behavioural test

Licking the sugar water can cause the pleasure experience of the rat, so that the rat feels excited, and the sugar water preference degree can be used for evaluating the pleasure deficiency of the rat. On the 19 th day of the experiment, two bottles of common drinking water are given to the rats, 1% sucrose water is also given to the rats after 24 hours, the rats are adapted for 24 hours, food drinking prohibition is forbidden for 3 hours, one bottle of common water and one bottle of 1% sucrose water are placed in a cage, weighing is carried out after 4 hours, and the sugar water preference degree, namely SPT (sugar water consumption/(sugar water consumption + common water consumption)) is calculated. The results are shown in FIG. 2, in which the sugar water consumption of the susceptible group was significantly lower than that of the non-susceptible group and the sham operated group.

Example 2: preparation of exosomes

2.1 extraction of exosomes

Fixing rat, soaking tail with warm water of 50 deg.C for 2min, treating blood vessel congestion, sterilizing cotton ball, wiping off rat tail, cutting off tail tip with 5-10mm scissors, massaging tail tip from tail root, and collecting 1.5-2ml blood.

Exosomes were extracted from rat Plasma using the miRCURY Exosome Serum/Plasma Kit instructions from Qiagen: the blood samples were transferred to 1.7mL blood into 2mL microcentrifuge tubes, 17. mu.l thrombin (500U/mL) was added, mixed and incubated for 5 minutes at room temperature. The sample was centrifuged at 10000g for 5 minutes to remove cell debris from the sample and the supernatant was transferred back to a 2ml microcentrifuge tube. 560. mu.l of precipitation buffer A was added to the supernatant, the tube was closed, placed on a vortex shaker for 5 seconds and after shaking was complete, incubated at 4 ℃ for 60 min. After the incubation was completed, the sample was centrifuged at 500g for 5min at 20 ℃, the supernatant was removed, the above centrifugation operation was repeated again, and the supernatant was removed as much as possible. Adding 240 mul of resuspension liquid, placing on a vortex oscillator for full resuspension, and finally obtaining the exosome resuspension liquid containing-300 mul. The purified exosome is subpackaged in 50-100 mu l and stored in a low-temperature refrigerator at-80 ℃ for subsequent experiments.

2.2 identification of exosomes

The particle size of the plasma exosomes was analyzed by Nanoparticle Tracking Analysis (NTA), which gave a particle size range of 30-150nm, and the Analysis results are shown in fig. 3. And detecting the exosome surface specific marker by using Western Blot. The result of Western Blot detection shows that plasma exosomes in the taken rat blood sample all express TSG101 and CD63, and the result is shown in FIG. 4. In addition, electron microscopy results are shown in fig. 5, with clear capture of exosome structures in the sample.

Example 3: analysis of exosome miRNA-351-5p expression level

3.1 extraction and banking of exosome RNA

(1)Ligate 3’adapter

a. Mu.l of RNA (1. mu.g) and 1. mu.l of RNA 3' Adapter were mixed well and blown up 6 times. b. The mixture was put on a PCR instrument at 70 ℃ for 2min and immediately taken out and put on ice. c. Mu.l of the mixing reagent (2. mu.l Ligation buffer + 1. mu.l RNase inhibitor + 1. mu. l T4RNA Ligase2, deletion mutant) was added thereto, mixed well and applied to a PCR instrument at 28 ℃ for 1 hour. d. Adding 1 μ l of Stop Solution, mixing, placing on PCR instrument at 28 deg.C for 15min, taking out, and placing on ice.

(2)Ligate 5’adapter

a. Mu.l of RNA 5 'Adapter was loaded in a new 0.2ml tube, loaded on a PCR apparatus at 70 ℃ for 2min, immediately taken out and then placed on ice b. 3. mu.l of the mixture (1. mu.l of RNA 5' Adapter + 1. mu.l of 10mM ATP Mix + 1. mu. l T4RNA Ligase) was added to the reaction solution in "(1) d", mixed well, loaded on a PCR apparatus at 28 ℃ for 1h, taken out and immediately placed on ice.

(3)Reverse transcribe and amplify

a. Mu.l of 5 'and 3' adapter-ligated RNA and 1. mu.l of RT Primer were mixed in a new 0.2ml centrifuge tube, placed on a PCR instrument at 70 ℃ for 2min, and immediately placed on ice after removal. b. Add 5.5. mu.l of the mixture (2. mu.l of 5 XFirst Strand Buffer + 0.5. mu.l of 12.5mM dNTPmix + 1. mu.l of 100mM DTT + 1. mu.l of RNase inhibitor + 1. mu.l of SuperScript II Reverse Transcriptase), mix well, go to PCR apparatus at 50 ℃ for 1h

(4)Perform PCR Amplification

a. Add 35.5. mu.l of the mixture (8.5. mu.l Ultra Pure Water + 25. mu.l PCR Mix + 2. mu.l RNA PCR Primer) and 2. mu.l RNA PCR Primer Index to the reaction mixture, load the mixture on a PCR instrument at 98 ℃ for 30 s; circulating for 15 times at 98 deg.C for 10s, 60 deg.C for 30s, and 72 deg.C for 15 s; and storing at 72 ℃ for 10min and at 4 ℃. b. After the reaction, 1. mu.l of the reaction mixture was diluted appropriately and examined for quality with a High Sensitivity DNA Chip.

(5) Purify cDNA construction (RNA gel electrophoresis)

a. Assembling the electrophoresis, spotting the DNA Loading Dye with Custom RNA Ladder, High Resolution Ladder and cDNA Constructt respectively, running electrophoresis: 145V, 1h

(6)Recover Purified Construct

a. Cutting gel and recovering 147nt and 157nt bands b. sleeving a gel breaker tube on a 2ml collecting tube, putting the recovered band, centrifuging at room temperature 20000g for 2min, allowing the gel to be completely centrifuged to the 2ml collecting tube c, adding 300 μ l of Ultra Pure Water into the collecting tube, standing overnight for gel d. transferring the solution gel into a 5 μm filter, and centrifuging at 600g for 10 s.

e. After mixing with the mixture (2. mu.l Glycogen + 30. mu.l 3M NaOAc + 2. mu.l 0.1X Pellet Paint + 975. mu.l 100% ethanol), the mixture was left at-80 ℃ for 20-30min, centrifuged at 4 ℃ 20000g for 20min, the supernatant was discarded, 500. mu.l 70% ethanol was added, centrifuged at room temperature 20000g for 20min, the supernatant was discarded, air-dried for 15min, 12. mu.l 10mM Tris-HCL was added, and the mixture was resuspended at pH 8.5.

(7) Library quality inspection

a. Add 1. mu.l sample to the Aglient 2100 chip b. confirm the length and mass of the library from the results

3.2 analysis of Small RNA sequencing results

Small RNA sequencing yielded the original reads in the format fastq. The linker sequence of the original reads was removed using cutadapt and sequences less than 15bp and greater than 41bp were removed using fastx _ toolkit (version 0.0.13) software. The reads containing N bases were then filtered out using the NGSQCTToolkit (version 2.3.2) to obtain high quality clean reads for subsequent analysis.

Counting the length of clean reads, and preliminarily evaluating the distribution condition of the small RNA of the sample. Clean reads are aligned according to the reference gene sequence of the rat, and the percentage of the reads aligned to the genome is counted. Using blastn software to compare clean reads with Rfam (version 10.0) database, extracting the result that E-value is less than or equal to 0.01, and annotating rRNA, snRNA and snoRNA, tRNA and the like, and filtering and clearing the sequences to remove reads with the length of less than 15bp and more than 41 bp. The repeated sequences were then removed using the RepeatMasker software. New miRNA predictions were made using Mirdeep2 software and the secondary structure of mirnas was predicted using RNAfold software. Carrying out expression quantity statistics on the identified sequences of the known mature miRNA and the newly predicted miRNA, wherein the expression quantity of the miRNA is calculated by adopting TPM (Transcript per mileon) to calculate a measurement index (the TPM is the number of reads aligned by each miRNA/the number of total aligned reads in the sample is 10)⁶And the miRNA expression index is formed by pairing sequences in parts per million).

For samples with no biological replicates, p value was calculated using the Audic _ Claverie formula. And screening miRNA with p value <0.05 and TPM difference multiple > 2.

The results are shown in fig. 6-fig. 9, the miRNA expression of rat exosomes of the sham operation group, the susceptible mice and the non-susceptible group are different, and the mi-351-5p expression amount of rat exosomes of the susceptible group is found to be significantly reduced compared with that of the sham operation group and the non-susceptible group.

The above description of examples is only intended to illustrate the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the principles of the invention, and it is intended that such changes and modifications also fall within the scope of the appended claims.

Sequence listing

<110> Jiangsu province national hospital (the first subsidiary hospital of Nanjing medical university)

Application of exosome miRNA in preparation of chronic pain-depression co-morbid diagnosis product

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3

<212> RNA

<213> UCCCUGAGGAGCCCUUUGAGCCUG (Gene sequence of miR-351-5 p)

<400> 1

<210> 2

<211> 3

<212> RNA

<213> UCCCUGAGGAGCCCUUUGAGCCUGA (Gene sequence of miR-351-5 p)

<400> 2

<210> 3

<211> 3

<212> RNA

<213> GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGCTCA (Gene sequence of miR-351-5 pRT)

<400> 3

<210> 4

<211> 3

<212> RNA

<213> CGTTCCCTGAGGAGCCCTT (Gene sequence of miR-351-5 pF)

<400> 4

<210> 5

<211> 3

<212> RNA

<213> ATCCAGTGCAGGGTCCGAGG (Gene sequence of General mmu-miR R)

<400> 5

Claims (4)

1. An application of an exosome miRNA in preparation of a chronic pain-depression co-disease diagnosis product is disclosed, wherein the exosome miRNA is a plasma exosome miR-351-5 p.

2. The use of claim 1, wherein the miR-351-5p sequence is a human: SEQ ID No. 1; mouse source: SEQ ID No. 2.

3. The use according to claim 1, wherein said use comprises use in a kit for diagnosis or assisted diagnosis of chronic pain-depression co-morbidities.

4. A chronic pain-depression co-morbid diagnostic kit is characterized by comprising a reagent for detecting exosome miR-351-5p, wherein the reagent comprises miR-351-5p reverse transcription primers and PCR detection upstream and downstream primers, the sequence of the reverse transcription primers is shown as SEQ ID No.3, the sequence of the PCR detection upstream primer is shown as SEQ ID No.4, and the sequence of the PCR detection downstream primer is shown as SEQ ID No. 5.

Images