CN114277031A - hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation - Google Patents
hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation Download PDFInfo
- Publication number
- CN114277031A CN114277031A CN202210090118.2A CN202210090118A CN114277031A CN 114277031 A CN114277031 A CN 114277031A CN 202210090118 A CN202210090118 A CN 202210090118A CN 114277031 A CN114277031 A CN 114277031A
- Authority
- CN
- China
- Prior art keywords
- circ
- hsa
- glioma
- circular rna
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation, belonging to the field of cancer diagnosis. The nucleotide sequence of hsa _ circ _0006420 circular RNA is shown in SEQ ID NO. 1. The invention obtains a new hsa _ circ _0006420 circular RNA gene, the expression of hsa _ circ _0006420 circular RNA in glioma tumor tissues and blood samples of patients is obviously increased, and the gene can be applied to glioma diagnosis, response after temozolomide treatment and survival period prediction of patients.
Description
Technical Field
The invention belongs to the technical field of cancer diagnosis, and particularly relates to hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation.
Background
Brain glioma is the most frequent brain tumor disease of adults, and accounts for 40.49 percent of intracranial tumors. From the time of diagnosis, the average life span of brain glioma patients does not exceed five years. At present, the diagnosis and treatment methods of glioma are in the continuous improvement stage, but the survival rate of glioma patients is not obviously improved. Glioma diagnosis is still in an empirical stage based on clinical, pathological and imaging information, and once diagnosed, most of them are in middle and advanced stages, and the survival rate after surgery is not optimistic. Therefore, the search of early diagnosis markers of glioma for carrying out 'early discovery and early treatment' on patients, the improvement of the life cycle of glioma patients and the corresponding selection of reasonable subsequent treatment schemes are research tasks to be solved urgently in the field of neuroscience.
The circRNA is an important member of a non-coding RNA family discovered in recent years, forms a cyclic structure without polarity and poly A tail, has higher nuclease stability due to the closed ring structure of the circRNA molecule, is not influenced by RNA exonuclease and is not easy to degrade, so that the circRNA becomes a novel biomarker for clinical application and has great advantages. High throughput sequencing and bioinformatics methods revealed extensive expression of circRNA in eukaryotes. Most of the circrnas were found to be involved in the development of some tumors, and are abnormally expressed in tissue-specific manner under pathological conditions. Research finds that the circRNA plays a key role in the development of tumor, and the action mechanism mainly comprises the following aspects: (1) the circRNA is used as an adsorbate (span) of miRNA, and the expression of target genes and downstream channels of the miRNA is regulated and controlled by adsorbing the miRNA, so that the generation and development of glioma are influenced; (2) circRNA functions by translation into peptide fragments or proteins; (3) these properties make circRNA an important target and potential marker for tumor diagnosis and treatment by mediating the transcriptional regulation of parent gene mRNA through the binding of parent gene (host gene) DNA sequences.
Disclosure of Invention
Aiming at the defects of the existing glioma diagnosis, the invention provides a new target for glioma diagnosis and prognosis evaluation, namely hsa _ circ _0006420 circular RNA gene, and provides new application of the target, in particular application in detection reagents, glioma diagnosis, treatment effect of tumor drugs on glioma and glioma prognosis evaluation.
The invention is realized by the following technical scheme:
in a first aspect, the invention provides an hsa _ circ _0006420 circular RNA gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.
The hsa _ circ _0006420 circular RNA molecule is formed by connecting the 2 nd exon and the 3 rd exon of AEBP2 gene in an initial position (the total length of the AEBP2 gene is 79,021nt, and the total length of the circular RNA of hsa _ circ _0006420 is as follows:
CATAAGCAGTACTATAATGGATGTAGACAGCACAATTTCCAGTGGGCGTTCAACTCCAGCAATGATGAATGGACAAGGAAGCACTACTTCTTCAAGCAAAAATATTGCCTATAATTGTTGTTGGGACCAGTGCCAGGCTTGCTTCAACTCTAGCCCAGATCTGGCAGATCACATCCGTTCCATACATGTAGATGGTCAGCGAGGAGGGGTATTTGTTTGCTTATGGAAAGGTTGTAAAGTATATAACACTCCATCTACCAGTCAAAGTTGGTTACAAAGGCATATGCTGACACACAGTGGAGACAAACCTTTCAAG(SEQ ID NO.1)
in a second aspect, the invention provides a detection primer for detecting hsa _ circ _0006420 circular RNA genes, wherein the nucleotide sequence of the detection primer is shown in SEQ ID NO. 2-3, and the detection primer can be used for preparing a glioma diagnosis or prognosis evaluation kit.
The nucleotide sequence of the forward Primer (Primer F) is TCTGGCAGATCACATCCGTT (SEQ ID NO. 2);
the nucleotide sequence of the reverse Primer (Primer R) was GAACGCCCACTGGAAATTGT (SEQ ID NO. 3).
In a specific application, the primer also comprises a forward primer and a reverse primer of internal reference GAPDH:
internal reference GAPDH Primer F: GGAGCGAGATCCCTCCAAAAT (SEQ ID NO. 4);
internal reference GAPDH Primer R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO. 5).
In a third aspect, the invention provides an application of the hsa _ circ _0006420 circular RNA gene as a molecular marker in preparing a kit for diagnosing glioma.
In a fourth aspect, the invention provides a use of a reagent for detecting hsa _ circ _0006420 circular RNA gene in the preparation of a kit for glioma diagnosis or prognosis evaluation.
Further, in a preferred embodiment of the invention, the reagent for detecting the hsa _ circ _0006420 circular RNA gene is selected from the group consisting of: a probe and a gene chip with detection specificity to hsa _ circ _0006420 circular RNA gene or a detection primer shown in SEQ ID NO. 2-3;
further, in a preferred embodiment of the present invention, the kit further comprises an RNA extraction reagent, a reverse transcription reaction system and a fluorescent quantitative PCR reagent.
Wherein, the RNA extraction reagent is trizol reagent;
the reverse transcription reaction system for reverse transcription of RNA into cDNA is as follows:
the reaction conditions of the reverse transcription reaction system are as follows: 37 deg.C, 10min, 42 deg.C, 20min, 85 deg.C, 5min, 4 deg.C, 2 min.
The fluorescent quantitative PCR reagent comprises:
| cDNA | 1μL |
| upstream primer (10. mu.M) | 0.2μL |
| Downstream primer (10. mu.M) | 0.2μL |
| 2X PCR Master Mix | 10μL |
| RNA free ddH2O | Make up to 20. mu.L |
Preferably, the fluorescent quantitative PCR reaction conditions are: denaturation at 95 ℃ for 5 min; 95 ℃ for 10 seconds, 60 ℃ for 35 seconds; 35 cycles.
In a fifth aspect, the invention provides a kit for glioma diagnosis or glioma prognosis evaluation, wherein the kit comprises detection primers shown as SEQ ID No. 2-3.
Further, in a preferred embodiment of the present invention, the kit further comprises a fluorescent quantitative PCR reagent.
Further, in a preferred embodiment of the present invention, the total amount of the fluorescent quantitative PCR reagent of 20 μ L comprises: mu.L of cDNA, 0.2. mu.L, 10. mu.M of detection primer shown as SEQ ID NO.2, 0.2. mu.L, 10. mu.M of detection primer shown as SEQ ID NO.3, and 10. mu.L of 2 XPCR Master Mix.
In a sixth aspect, the invention provides an application of a reagent for detecting hsa _ circ _0006420 circular RNA gene in preparing a kit for evaluating the treatment effect of an anti-tumor drug on glioma;
preferably, the anti-tumor drug is temozolomide.
Compared with the prior art, the invention at least has the following technical effects:
the inventor researches to find that the hsa _ circ _0006420 circular RNA gene has differential expression in glioma tumor tissues and cancer-adjacent tissue samples, and the expression of hsa _ circ _0006420 circular RNA in glioma tumor tissues and patient blood samples is remarkably increased compared with normal tissues through fluorescent quantitative PCR. Thus, the hsa _ circ _0006420 circular RNA gene was shown to be a diagnostic marker for glioma. The expression level of hsa _ circ _0006420 can be used for early diagnosis of glioma; in particular, hsa _ circ _0006420 was shown to predict patient prognosis and the efficacy of temozolomide treatment. These results indicate that hsa _ circ _0006420 can be applied to glioma diagnosis, post-temozolomide treatment response, and patient survival prediction.
Drawings
FIG. 1 is a diagram showing the identification of hsa _ circ _0006420 circular RNA in example 1;
FIG. 2 is a graph of the significant increase in expression of hsa _ circ _0006420 circular RNA in glioma tissues and in patient plasma in example 2;
FIG. 3 is a graph of hsa _ circ _0006420 circular RNA used in the diagnosis of glioma in example 2;
FIG. 4 is a graph of the predicted response of the hsa _ circ _0006420 circular RNA to temozolomide treatment in patients with glioma in example 3;
FIG. 5 is the use of hsa _ circ _0006420 circular RNA in example 4 for prognostic performance in glioma patients.
Detailed Description
Embodiments of the present invention will be described in detail with reference to the following examples, but those skilled in the art will understand that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the present invention, and that the specific conditions not specified in the examples are carried out according to conventional conditions or conditions suggested by the manufacturer, and that the reagents or equipment used are not specified by the manufacturer, and are all conventional products available through commercial purchase.
The following describes in detail specific embodiments of the present invention. It should be understood that the detailed description and specific examples, while indicating the present invention, are given by way of illustration and explanation only, not limitation.
Example 1 identification of hsa _ circ _0006420
RNA extraction (Trizol method)
(1) Adding 1ml trizol into tumor tissue and plasma;
(2) adding 200 μ L chloroform, shaking vigorously for 10 s, and standing at room temperature for 10 min;
(3) centrifuging at 4 deg.C for 10min at 12,000g, separating the solution into three layers, dissolving RNA in the water phase, and transferring the water phase to another new RNase free EP tube;
(4) adding isopropanol with the volume of 1 time, and fully and uniformly mixing by vortex;
(5) centrifuging at 4 deg.C for 15min at 12,000g, collecting RNA precipitate at the bottom of the tube, and discarding the supernatant;
(6) adding 1ml of 75% ethanol, slightly inverting by hand, centrifuging at 12,000g for 5min, and discarding the supernatant;
(7) air dried at room temperature, and 20. mu.L of DEPC water was added to dissolve the precipitate.
2. Genomic DNA removal
Removing the residual genome DNA in the total RNA, adopting DNA digestive enzyme, and adopting a specific reaction system and conditions as follows, wherein the total volume of the reaction solution is 10 mu L, and the reaction solution comprises the following components:
| RNA | 6μL(3μg) |
| DNase I | 1μL |
| 10X buffer | 1μL |
| RNA free H2O | 2μL |
after digesting the reaction solution at 37 ℃ for 40min, inactivating the DNA digestive enzyme at 85 ℃ for 3 min.
Reverse transcription of RNA into CDNA
The reaction system and conditions for reverse transcription of RNA into cDNA are as follows:
| total RNA | 2μg |
| Random primer | 0.5μL |
| 2X RT Mix | 5μL |
| RT Enzyme Mix | 1μL |
| RNA free ddH2O | Make up to 10. mu.L |
The reaction conditions are as follows: 10min at 37 ℃, 20min at 42 ℃, 5min at 85 ℃ and 2min at 4 ℃.
4. Design of reverse amplification PCR primer amplification hsa _ circ _0006420 interface and flanking sequence DNA sequencing verification
Designing and identifying reverse PCR amplification primers according to a part of reference sequences provided in a circular base database, wherein the sequences of the primers for amplifying the interface and flanking sequences of hsa _ circ _0006420 are as follows:
the size of the part of the sequence of the primer amplified circular RNA hsa _ circ _0006420 is 316 p; and (3) amplifying partial sequences on both sides of a circularization interface of the circular RNA hsa _ circ _0006420 by using cDNA as a template through PCR, separating by using nucleic acid agarose with the concentration of 1.5%, and verifying by DNA sequencing after a PCR product is purified. The results showed that the circular RNA hsa _ circ _0006420 molecule is a circular RNA molecule formed by joining the 2 nd and 3 rd exons of AEBP2 gene in head-to-head relation (the total length of the AEBP2 gene is 79,021nt, which consists of 9 exons) (FIG. 1). The full-length sequence of RNA hsa _ circ _0006420 is:
CATAAGCAGTACTATAATGGATGTAGACAGCACAATTTCCAGTGGGCGTTCAACTCCAGCAATGATGAATGGACAAGGAAGCACTACTTCTTCAAGCAAAAATATTGCCTATAATTGTTGTTGGGACCAGTGCCAGGCTTGCTTCAACTCTAGCCCAGATCTGGCAGATCACATCCGTTCCATACATGTAGATGGTCAGCGAGGAGGGGTATTTGTTTGCTTATGGAAAGGTTGTAAAGTATATAACACTCCATCTACCAGTCAAAGTTGGTTACAAAGGCATATGCTGACACACAGTGGAGACAAACCTTTCAAG(SEQ ID NO.1)。
example 2
Fluorescent quantitative PCR detection of hsa _ circ _0006420 for glioma diagnosis
The method for detecting the expression condition of the circular RNA hsa _ circ _0006420 molecule in tissues and blood plasma by fluorescent quantitative PCR amplification comprises the following steps: extracting total RNA according to the method described in example 1, removing residual genomic DNA from the extracted RNA with DNase, and reverse-transcribing the RNA into cDNA; and finally, detecting by adopting fluorescent quantitative PCR amplification, wherein the primer sequence of the fluorescent quantitative PCR is shown as SEQ ID No. 2-5. The size of the amplified circular hsa _ circ _0006420 circularized interface region sequence was 200 bp.
The reaction system and the reaction conditions for detecting the expression condition of the circular RNA hsa _ circ _0006420 molecule in tissues and blood plasma by fluorescent quantitative PCR amplification are as follows:
| cDNA | 1μL |
| upstream primer (10. mu.M) | 0.2μL |
| Downstream primer (10. mu.M) | 0.2μL |
| 2X PCR Master Mix | 10μL |
| RNA free ddH2O | Make up to 20. mu.L |
The fluorescent quantitative PCR reaction conditions are as follows: denaturation at 95 ℃ for 5 min; 10 seconds at 95 ℃ and 35 seconds at 60 ℃; 35 cycles. Fluorescent quantitative PCR was used to detect the expression of circular RNA hsa _ circ _0006420 in tissues and plasma.
As a result, hsa _ circ _0006420 was found to be significantly elevated in glioma tissues and plasma of glioma patients (fig. 2), and had good prognosis of glioma: AUC 0.8048 (tissue) and 0.8160 (plasma) (fig. 3), indicating that hsa _ circ _0006420 can be used as a prognostic marker for glioma diagnosis.
Example 3
Fluorogenic quantitative PCR detection of hsa _ circ _0006420 for temozolomide treatment prediction for gliomas
Patients with glioma who received temozolomide treatment were enrolled and plasma samples (5 ml of blood per patient, 1.5ml total plasma left after centrifugation) were first collected and cryopreserved in a freezer at-80 ℃. Clinical follow-up followed the patient's response to temozolomide treatment and divided into a response group (R, response group, stable or partially stable disease) and a non-response group (NR, non-response group, disease progression) according to the treatment effect. After matching clinical baseline parameters such as age, gender, etc. to exclude the effect of other clinical parameters, 25 plasma samples from each of the response (R) and non-response (NR) groups were subjected to fluorescent quantitative PCR assays and a comparison of the difference in expression and statistical analysis of the two groups of hsa _ circ _0006420 was performed.
The primer of the fluorescent quantitative PCR is designed based on the mature sequence of the circular RNA hsa _ circ _0006420 in the embodiment 2, the plasma sample of a glioma patient after receiving temozolomide is detected, the expression of hsa _ circ _0006420 between temozolomide response and non-response is analyzed, and the prediction effect of the response of temozolomide treatment is predicted, and as a result, the expression of hsa _ circ _0006420 in a temozolomide treatment non-response group is remarkably improved and the prediction effect is better: AUC 0.7664 (fig. 4).
Example 4
Fluorescent quantitative PCR detection of hsa _ circ _0006420 for prognosis prediction of glioma patients
Plasma samples (5 ml of blood per patient and 1.5ml of plasma left after centrifugal stratification) were collected from glioma patients and frozen at-80 ℃ in a refrigerator, primers for fluorescent quantitative PCR were designed based on the mature sequence of hsa _ circ _0006420 described in this example 2, plasma samples from glioma patients were tested, patient survival status was followed clinically for a long period, expression of hsa _ circ _0006420 as a prognostic marker for glioma patients was analyzed based on the expression level of hsa _ circ _0006420, the risk Ratio (Hazard Ratio) was calculated from the Kaplan-Meier survival curve and Log rank, and statistical analysis was performed to evaluate the performance of hsa _ circ _0006420 for prognosis prediction of glioma.
As a result, patients with hsa _ circ _ 0006420-high expressing gliomas had a significantly worse prognosis (fig. 5), logRank HR 2.039 and P0.0046. The fluorescent quantitative PCR detection method of the present invention can ideally detect the expression of the circular RNA hsa _ circ _0006420 in an organism.
In conclusion, the hsa _ circ _0006420 circular RNA provided by the invention has obviously increased expression in glioma tumor tissues of glioma patients and blood samples of patients. The inventor discovers that the expression of hsa _ circ _0006420 in a temozolomide treatment non-response group is obviously improved through fluorescent quantitative PCR, and the prediction effect is good; meanwhile, the fluorescent quantitative PCR detection method can be used for ideally detecting the expression condition of the circular RNA hsa _ circ _0006420 in organisms, and the prognosis of glioma patients with high expression of hsa _ circ _0006420 is remarkably poor. These results indicate that hsa _ circ _0006420 can be applied to glioma diagnosis, post-temozolomide treatment response, and patient survival prediction.
Finally, it should be noted that: the above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Shanghai Nuren biological medicine science and technology Co., Ltd
<120> hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 316
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cataagcagt actataatgg atgtagacag cacaatttcc agtgggcgtt caactccagc 60
aatgatgaat ggacaaggaa gcactacttc ttcaagcaaa aatattgcct ataattgttg 120
ttgggaccag tgccaggctt gcttcaactc tagcccagat ctggcagatc acatccgttc 180
catacatgta gatggtcagc gaggaggggt atttgtttgc ttatggaaag gttgtaaagt 240
atataacact ccatctacca gtcaaagttg gttacaaagg catatgctga cacacagtgg 300
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggagcgagat ccctccaaaa t 21
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggctgttgtc atacttctca tgg 23
Claims (10)
1. An hsa _ circ _0006420 circular RNA gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.
2. A detection primer for detecting hsa _ circ _0006420 circular RNA genes is characterized in that the nucleotide sequence of the detection primer is shown in SEQ ID NO. 2-3, and the detection primer can be used for preparing a glioma diagnosis or prognosis evaluation kit.
3. The application of hsa _ circ _0006420 circular RNA gene as molecular marker in preparing reagent kit for diagnosing glioma.
4. The application of a reagent for detecting the hsa _ circ _0006420 circular RNA gene in preparing a kit for glioma diagnosis or prognosis evaluation.
5. The use of claim 4, wherein the reagent for detecting the circular RNA gene of hsa _ circ _0006420 is selected from the group consisting of: a probe and a gene chip with detection specificity to hsa _ circ _0006420 circular RNA gene or a detection primer shown in SEQ ID NO. 2-3.
6. The use of claim 4, wherein the kit further comprises an RNA extraction reagent, a reverse transcription reaction system and a fluorescent quantitative PCR reagent.
7. A kit for glioma diagnosis or glioma prognostic evaluation, comprising the detection primer according to claim 2.
8. The kit for glioma diagnosis or glioma prognostic assessment according to claim 7, characterized in that it further comprises a fluorescent quantitative PCR reagent.
9. The kit for glioma diagnosis or glioma prognostic evaluation according to claim 8, wherein the fluorescent quantitative PCR reagents in a total amount of 20 μ Ι _ comprise: mu.L of cDNA, 0.2. mu.L, 10. mu.M of detection primer shown as SEQ ID NO.2, 0.2. mu.L, 10. mu.M of detection primer shown as SEQ ID NO.3, and 10. mu.L of 2 XPCR Master Mix.
10. The application of a reagent for detecting the hsa _ circ _0006420 circular RNA gene in preparing a kit for evaluating the treatment effect of an anti-tumor medicament on glioma;
preferably, the anti-tumor drug is temozolomide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210090118.2A CN114277031A (en) | 2022-01-25 | 2022-01-25 | hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210090118.2A CN114277031A (en) | 2022-01-25 | 2022-01-25 | hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114277031A true CN114277031A (en) | 2022-04-05 |
Family
ID=80881505
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210090118.2A Pending CN114277031A (en) | 2022-01-25 | 2022-01-25 | hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114277031A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114774422A (en) * | 2022-05-31 | 2022-07-22 | 中南大学 | siRNA structure for inhibiting circRNA0006420 gene expression, medicament and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120046346A1 (en) * | 2010-04-16 | 2012-02-23 | Immune Disease Institute, Inc. | Sustained polypeptide expression from synthetic, modified rnas and uses thereof |
| CN107619869A (en) * | 2017-10-27 | 2018-01-23 | 中南大学湘雅医院 | Diagnosis of glioma and prognostic marker circ16:85633914 | 85634132 and application |
| CN107937532A (en) * | 2017-12-28 | 2018-04-20 | 中南大学湘雅医院 | Diagnosis of glioma marker hsa_circ_0021827 and application |
| CN114317539A (en) * | 2022-01-12 | 2022-04-12 | 上海卡序生物医药科技有限公司 | hsa _ circ _0001137 circular RNA and application thereof in cancer diagnosis and treatment |
-
2022
- 2022-01-25 CN CN202210090118.2A patent/CN114277031A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120046346A1 (en) * | 2010-04-16 | 2012-02-23 | Immune Disease Institute, Inc. | Sustained polypeptide expression from synthetic, modified rnas and uses thereof |
| CN107619869A (en) * | 2017-10-27 | 2018-01-23 | 中南大学湘雅医院 | Diagnosis of glioma and prognostic marker circ16:85633914 | 85634132 and application |
| CN107937532A (en) * | 2017-12-28 | 2018-04-20 | 中南大学湘雅医院 | Diagnosis of glioma marker hsa_circ_0021827 and application |
| CN114317539A (en) * | 2022-01-12 | 2022-04-12 | 上海卡序生物医药科技有限公司 | hsa _ circ _0001137 circular RNA and application thereof in cancer diagnosis and treatment |
Non-Patent Citations (6)
| Title |
|---|
| FEI SHI等: "CircRNA hsa-circ-0014359 promotes glioma progression by regulating miR-153/PI3K signaling", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》, vol. 510, no. 4, pages 614 - 620, XP085603094, DOI: 10.1016/j.bbrc.2019.02.019 * |
| KIM H等: "Homo sapiens AE binding protein 2 (AEBP2), transcript variant 1, mRNA", 《NCBI GENBANK DATABASE》, pages 153207 * |
| PHILIPP G. MAASS等: "A map of human circular RNAs in clinically relevant tissues", 《J MOL MED (BERL)》, vol. 95, no. 11, pages 3 * |
| ZHANG Y等: "Advances in circular RNAs and their role in glioma", 《INTERNATIONAL JOURNAL OF ONCOLOGY》, vol. 57, no. 1, pages 67 - 79 * |
| 李祎等: "Hsa_circ_0128298在肝癌中的表达及其参与肿瘤生长的功能", 《临床检验杂志》, vol. 37, no. 8 * |
| 胡湘;殷晓明;王栋磊;: "环状RNA hsa_circ_0133159在胶质瘤诊断和预后评估中的临床价值", 神经病学与神经康复学杂志, no. 04 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114774422A (en) * | 2022-05-31 | 2022-07-22 | 中南大学 | siRNA structure for inhibiting circRNA0006420 gene expression, medicament and application |
| CN114774422B (en) * | 2022-05-31 | 2023-09-19 | 中南大学 | siRNA structure, drug and application for inhibiting circRNA0006420 gene expression |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7082380B2 (en) | Pancreatic cancer detection kit or device and detection method | |
| KR102581671B1 (en) | Esophageal cancer detection kit or device, and detection method | |
| EP2904118B1 (en) | Urine exosome mrnas and methods of using same to detect diabetic nephropathy | |
| CN112553334A (en) | Colorectal cancer detection kit or device and detection method | |
| CN104981548A (en) | Diagnostic mirna markers for alzheimer | |
| CN104903468A (en) | New diagnostic MiRNA markers for parkinson disease | |
| CN111172287B (en) | Application of exosome lncRNA RN7SL5P as internal reference gene in gastric cancer lncRNA detection | |
| CN111778330B (en) | Colorectal cancer diagnosis biomarker and application thereof | |
| CN102286464B (en) | Uremia long-chain non-coding ribonucleic acid difference expression spectrum model and construction method thereof | |
| WO2018119421A1 (en) | Compositions and methods of using rna fragments | |
| CN110423811A (en) | Sepsis diagnosis marker | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| CN114277031A (en) | hsa _ circ _0006420 circular RNA and application thereof in glioma diagnosis and prognosis evaluation | |
| CN108148908B (en) | Application of molecular marker for diagnosing atherosclerotic renal artery stenosis | |
| CN113999909A (en) | Serum exosome marker for gastric cancer diagnosis, application thereof, amplification primer pair and diagnosis kit | |
| CN105671179B (en) | application of serum microRNA in liver cancer diagnosis and diagnosis kit | |
| CN107583052B (en) | Application of miR-6734-5p in preparation of Luminal type breast cancer diagnostic tool | |
| CN114015767B (en) | Serum circRNA marker for identifying craniosynostosis and application thereof | |
| CN116083579A (en) | circRNA-miRNA-mRNA regulation network for non-small cell lung cancer diagnosis and application thereof | |
| CN115287347A (en) | Asymptomatic mitral valve myxomatosis-like lesion biomarker for dogs and application thereof | |
| CN111304322B (en) | Preparation method of kit for joint detection of esophageal cancer by four novel circRNAs | |
| CN110592220B (en) | Early colorectal cancer diagnosis marker circ3823 and application thereof | |
| CN113584190A (en) | Intestinal flora marker for diagnosing calcium oxalate calculus and application thereof | |
| CN113025707A (en) | Application of biomarker in preparation of product for diagnosing damp-heat spleen-encumbering type 2 diabetes and kit | |
| CN111733226A (en) | Circular RNA marker for detecting Crohn's disease and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |