CN114350728B - Method for preparing hyaluronic acid oligosaccharide by using enzyme method - Google Patents
Method for preparing hyaluronic acid oligosaccharide by using enzyme method Download PDFInfo
- Publication number
- CN114350728B CN114350728B CN202110937316.3A CN202110937316A CN114350728B CN 114350728 B CN114350728 B CN 114350728B CN 202110937316 A CN202110937316 A CN 202110937316A CN 114350728 B CN114350728 B CN 114350728B
- Authority
- CN
- China
- Prior art keywords
- hyaluronic acid
- hyaluronidase
- oligosaccharide
- lys
- acid oligosaccharide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention provides a method for preparing hyaluronic acid oligosaccharide by an enzymatic method, which comprises the following steps: preparing a hyaluronic acid solution, and adding hyaluronidase into the hyaluronic acid solution to react to obtain hyaluronic acid oligosaccharide, wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID NO. 3. The invention has the following beneficial effects: firstly, the reducing end of the hyaluronic acid oligosaccharide obtained by the invention is N-acetamido glucose, which lays a foundation for researching the structure-activity relationship of the hyaluronic acid oligosaccharide in academia; secondly, the reaction condition of the invention is extremely simple, no requirement is imposed on instruments and equipment, the invention can be implemented at normal temperature and normal pressure, and no pollution waste is produced; finally, the reaction system of the invention is acetic acid-sodium acetate buffer solution, and the high-purity hyaluronic acid oligosaccharide can be obtained through the subsequent simple deproteinization, nanofiltration desalination and spray drying process, and the invention has potential and wide application value in the fields of skin care products, health care products, oligosaccharide medicaments and the like.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to a method for preparing hyaluronic acid oligosaccharide by a high-scale enzyme method.
Background
Hyaluronic Acid (HA) is also called hyaluronic acid, which is a macromolecular viscous polysaccharide formed by alternately connecting beta (1-3) and beta (1-4) glycosidic bonds by taking D-glucuronic acid and N-acetamido glucose as repeated disaccharide units, and is obtained by first extracting from bovine glass bulbus in 1934 by Meyer et al.
Literature studies have shown that HA biological activity is dependent on its molecular weight, with HA in different molecular weight ranges exhibiting different physiological functions. The high molecular weight HA HAs better functions of viscoelasticity, moisture retention, anti-inflammatory, lubrication and the like, and can be applied to the cosmetic industry, ophthalmic operation viscoelastant and intra-articular cavity injection treatment. Compared with high molecular weight HA, hyaluronic acid oligosaccharide HAs the effects of inhibiting tumor diffusion, promoting wound healing, promoting bone and angiogenesis, regulating immunity, etc., and is easy to penetrate into dermis, immune cells and activating agent of cell factor. Therefore, the hyaluronic acid oligosaccharide has wide application prospect in the fields of food health care, cosmetics and clinical medical treatment.
Hyaluronidases are a class of glycosidases that degrade hyaluronic acid and part of glycosaminoglycans. Hyaluronidases are classified into three classes according to their origin, catalytic mechanism and substrate specificity differences: the first class is a microorganism-derived hyaluronan lyase, which cleaves the beta-1, 4 glycosidic bond of hyaluronan by beta racemization (EC 4.2.2.1), the reducing end of the produced oligosaccharide is an unsaturated N-acetamido glucose structure; the second class of representative hyaluronidases (EC 3.2.1.36) is mainly derived from leech salivary glands, belongs to endo-beta-glucuronidase, is capable of hydrolyzing beta-1, 3 glycosidic bonds of hyaluronic acid, and generates oligosaccharide with a glucuronic acid structure at the reducing end; the third type of hyaluronidase is endo-beta-N-acetylglucosaminidase (EC3.2.1.35), mainly derived from testis of mammal and venom of animal, can hydrolyze beta-1, 4 glycosidic bond of hyaluronic acid to generate N-acetylglucosaminide structure with saturated reducing end of oligosaccharide, and has wide substrate spectrum and certain catalytic activity on chondroitin sulfate and dermatan sulfate structure.
The presently disclosed enzymatic processes for preparing hyaluronan oligosaccharides mainly focus on the first class of hyaluronan lyase (patent grant numbers: CN 105055440B, CN 109517012B) and the second class of leech hyaluronidase (patent grant numbers: CN 106399428B, CN 104178539B). The third type of hyaluronidase (endo-beta-N-acetylglucosaminidase) commercialized at present is mainly BTH extracted from bovine testis and part of humanized PH20 enzyme expressed by CHO cell recombination, so that the production cost is very high, and the method cannot be used for industrially preparing hyaluronic acid oligosaccharide. Therefore, there is no report of the preparation of hyaluronic acid oligosaccharides by the enzyme.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention provides an enzymatic method for preparing hyaluronic acid oligosaccharide.
In particular, the invention relates to the following aspects:
1. a method for preparing hyaluronic acid oligosaccharide by an enzymatic method, which comprises the following steps:
preparing a hyaluronic acid solution,
adding hyaluronidase into the hyaluronic acid solution to react to obtain hyaluronic acid oligosaccharide,
wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID NO. 3.
2. The method according to item 1, wherein the initial concentration of the hyaluronic acid in the reaction system composed of the hyaluronidase and the hyaluronic acid solution is 20 to 80g/L.
3. The method according to item 1, wherein the hyaluronic acid has a molecular weight of 1X 10 or more in a reaction system composed of the hyaluronidase and the hyaluronic acid solution 6 Da。
4. The method according to item 1, wherein the concentration of the hyaluronidase in the reaction system comprising the hyaluronidase and the hyaluronic acid solution is 1.5X10 3 -1×10 5 U/mL。
5. The method according to claim 1, wherein the temperature of the reaction is 20 to 65 ℃ and the time of the reaction is 0.5 to 8 hours.
6. The method of claim 1, wherein the hyaluronic acid solution is formulated using 20-100mm acetic acid-sodium acetate buffer at a ph of 4.0-6.5.
7. The method of claim 1, wherein the hyaluronic acid oligosaccharide comprises a hyaluronic acid oligosaccharide having a saturated N-acetylglucosamine at the reducing end.
8. The method of claim 1, wherein the hyaluronic acid oligosaccharide comprises hyaluronic acid tetrasaccharide, hyaluronic acid hexasaccharide, hyaluronic acid octasaccharide, and hyaluronic acid decasaccharide.
9. A hyaluronic acid oligosaccharide composition, characterized in that the hyaluronic acid oligosaccharide composition comprises hyaluronic acid tetraose, hyaluronic acid hexaose, hyaluronic acid octaose and hyaluronic acid decaose.
10. The composition according to item 9, which is prepared by the method according to any one of items 1 to 8.
The invention utilizes recombinant hyaluronidase which hydrolyzes beta-1, 4 glycosidic bonds of hyaluronic acid to directly degrade hyaluronic acid to prepare hyaluronic acid oligosaccharide, and has direct purpose. Firstly, the reducing end of the hyaluronic acid oligosaccharide obtained by the invention is N-acetamido glucose, so that a hyaluronic acid oligosaccharide library prepared by bacterial source hyaluronic acid lyase and leech source hyaluronic acid hydrolase is perfected, and a foundation is laid for academic study of the structure-activity relationship of the hyaluronic acid oligosaccharide; secondly, the reaction condition of the invention is extremely simple, no requirement is required for instruments and equipment, the invention can be implemented at normal temperature and normal pressure, and the enzymolysis process does not need to add any organic reagent, and no pollution waste is produced; finally, the reaction system of the invention is acetic acid-sodium acetate buffer solution, and the high-purity hyaluronic acid oligosaccharide can be obtained through the subsequent simple deproteinization, nanofiltration desalination and spray drying process, and the invention has potential and wide application value in the fields of skin care products, health care products, oligosaccharide medicaments and the like.
Drawings
FIG. 1 is a LCMS-IT-TOF mass spectrum total ion flow peak diagram of hyaluronic acid hydrolysate.
FIG. 2 is an ionic strength diagram of hyaluronic acid tetrasaccharide (HA 4).
FIG. 3 is an ionic strength diagram of hyaluronan hexasaccharide (HA 6).
Fig. 4 is an ionic strength diagram of hyaluronic acid octasaccharide (HA 8).
Fig. 5 is an ionic strength diagram of hyaluronic acid decasaccharide (HA 10).
Detailed Description
The invention will be further illustrated with reference to the following examples, which are to be understood as merely further illustrating and explaining the invention and are not to be construed as limiting the invention.
Unless defined otherwise, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the materials and methods are described herein below. In case of conflict, the present specification, including definitions therein, will control and materials, methods, and examples, will control and be in no way limiting. The invention is further illustrated below in connection with specific examples, which are not intended to limit the scope of the invention.
The hyaluronic acid oligosaccharide (oligosaccharides of HA, oligo-HA) HAs a molecular weight of 10 4 Da or less, and the number of monosaccharide residues is 2 to 25 (generally 4 to 16). oligo-HA belongs to a small molecule polysaccharide, and its properties are very different from those of common HA. Studies show that Oligo-HA HAs biological activities of resisting oxidation, regulating immunity, resisting inflammation, promoting wound healing, promoting angiogenesis, resisting tumor, etc. Particularly, because of the small molecular size, the skin moisturizing gel can penetrate into the stratum corneum of the skin to exert the effects of deep moisturizing and moistening, and can be widely applied to cosmetics.
The invention provides a method for preparing hyaluronic acid oligosaccharide by an enzymatic method, which comprises the following steps: preparing a hyaluronic acid solution, and adding hyaluronidase into the hyaluronic acid solution to react to obtain hyaluronic acid oligosaccharide, wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID NO. 3.
The hyaluronidase used in the invention is hyaluronidase from the mountain rat, the hyaluronidase from the mountain rat belongs to a third class of hyaluronidase, is endo-beta-N-acetylglucosaminidase, can hydrolyze beta-1, 4 glycosidic bonds of hyaluronic acid, and generates N-acetylglucosaminide as a reduction end of a final product. In addition, compared with the second class of leech hyaluronic acid hydrolase substrate spectrum, the enzyme has wider spectrum and certain catalytic activity on chondroitin sulfate and dermatan sulfate structures. Hyaluronidase from Hyaluronan is capable of enriching the variety of hyaluronic acid products, and can have a wider application range besides hyaluronidase catalysis.
The nucleotide sequence of the hyaluronidase is shown as SEQ ID NO.3, and the protein sequence encoded by the hyaluronidase is shown as SEQ ID NO. 4. The nucleotide sequence shown in SEQ ID NO.3 may be used to produce a hyaluronan hydrolase using Pichia pastoris. In a specific embodiment, the method of using pichia pastoris to produce a hyaluronan hydrolase comprises fermentation production of the hyaluronidase using BMMY medium, methanol induction. Wherein the BMMY culture medium comprises yeast extract 10g/L, peptone 20g/L, and K 2 HPO 4 3g/L，KH 2 PO 4 11.8g/L，YNB 3.4g/L，(NH 4 ) 2 SO 4 10g/L, biotin 4X 10 -4 g/L, methanol 10mL/L. In a preferred embodiment, the shake flask fermentation conditions are: the fermentation temperature is 25-30 ℃, 0.5-1% (v/v) methanol is added every 24h in the fermentation process, and the induced expression is carried out for 96h. The hyaluronidase has high expression quantity, and the activity of the hyaluronidase in fermentation supernatant can reach 67970.04U/mL at the end of fermentation.
In a specific embodiment, the initial concentration of hyaluronic acid in the reaction system composed of the hyaluronidase and the hyaluronic acid solution is 20-80g/L, for example, 20g/L, 30g/L, 40g/L, 50g/L, 60g/L, 70g/L, 80g/L. For example, the hyaluronidase is added to the hyaluronic acid solution to form a reaction system of 1L, and the initial content of hyaluronic acid is 20-80g, i.e., the content when no hydrolysis occurs is 20-80g.
The hyaluronic acid solution may be formulated using various aqueous solutions. In a preferred embodiment, the hyaluronic acid solution is formulated using 20-100mM acetic acid-sodium acetate buffer at pH 4.0-6.5. The use of 20-100mM acetic acid-sodium acetate buffer pH 4.0-6.5 to formulate hyaluronic acid can simplify the subsequent purification process of hyaluronic acid oligosaccharides.
In a specific embodiment, in the reaction system comprising the hyaluronidase and the hyaluronic acid solution, the molecular weight of hyaluronic acid is 1×10 or more 6 Da, for example, may be 1X 10 6 Da、1.5×10 6 Da、2×10 6 Da、2.5×10 6 Da、3×10 6 Da, etc. Wherein, the molecular weight herein refers to weight average molecular weight.
In a specific embodiment, the concentration of the hyaluronidase in the reaction system comprising the hyaluronidase and the hyaluronic acid solution is 3×10 3 -1×10 5 U/mL may be, for example, 3X 10 3 U/mL、4×10 3 U/mL、5×10 3 U/mL、6×10 3 U/mL、8×10 3 U/mL、10 4 U/mL、2×10 4 U/mL、4×10 4 U/mL、6×10 4 U/mL、8×10 4 U/mL、10 5 U/mL. Wherein, the definition of the hyaluronidase activity unit (U) is as follows: at pH 5.5 and 38 ℃, 1. Mu.g of enzyme amount required for reducing sugar of glucose reducing equivalent is released from the hyaluronic acid sugar chain per hour.
In one embodiment, the reaction temperature is 20-65℃and the reaction time is 0.5-8 hours.
In a specific embodiment, the hyaluronic acid oligosaccharide comprises a hyaluronic acid oligosaccharide having a saturated N-acetamido glucose at the reducing end. In a preferred embodiment, the hyaluronic acid oligosaccharide having a saturated N-acetylglucosamine at the reducing end comprises hyaluronic acid tetraose, hyaluronic acid hexaose, hyaluronic acid octaose and hyaluronic acid decaose.
Wherein, the detection of the hyaluronic acid oligosaccharide product adopts a hydrolysate structure analysis method. The specific conditions are as follows: product analysis was performed by LCMS-IT-TOF LC-MS (liquid chromatography-mass spectrometry) from Shimadzu corporation using C 18 The chromatographic column, the mobile phase is acetonitrile and water, the flow rate is 0.2mL/min, the acetonitrile concentration is linearly increased to 12%, and the acetonitrile concentration is reduced to 0 after 10 min. Mass spectrometry was performed in negative ion mode, scanning every 10s, m/z ranging from 100-1500. Multistage mass spectrometry was performed under the same operating conditions.
The present invention also provides a hyaluronic acid oligosaccharide composition comprising hyaluronic acid tetrasaccharide, hyaluronic acid hexasaccharide, hyaluronic acid octasaccharide and hyaluronic acid decasaccharide.
Examples
EXAMPLE 1 hyaluronidase Gene (ΔN24HYAL_OM) opt ) Construction of expression System
Chemical synthesis codon optimized hyaluronan hydrolase gene sequence (hyal_om) opt ) The sequence of the polypeptide is shown as SEQ ID NO.1, and the coded amino acid sequence of the polypeptide is shown as SEQ ID NO. 2. Will HYAL_OM opt Cloning the recombinant expression vector pPIC9K between EcoRI and NotI cleavage sites of the Pichia pastoris expression vector pPIC9K to obtain the recombinant expression vector pPIC9K-HYAL_OM opt . Recombinant expression plasmid pPIC9K-HYAL_OM opt Electric transfer into P.pastoris GS115 expression host cell after linearization of SalI fast cutting enzyme, and screening recombinant transformant by geneticin G418 to obtain high copy recombinant Pichia pastoris GS115/pPIC9K-HYAL_OM opt 。
By pPIC9K-HYAL_OM opt The recombinant expression vector is used as a template, a primer is designed, and the gene sequence of the hyaluronidase (HYAL_OM) is cut off opt ) A section of signal peptide sequence at the N end to obtain a high-expression hyaluronic acid hydrolase gene (delta N24 HYAL_OM) opt ) The sequence of the fragment is shown as SEQ ID NO.3, and the coded amino acid sequence is shown as SEQ ID NO. 4.
Wherein the primer sequences are as follows:
upstream primer F:5'-CCGGAATTCATGAAGACACTACGCGGCTC-3' (SEQ ID NO. 5);
the downstream primer R:5'-ATTTGCGGCCGCTCAATGATGATGATGGTGGTGATGAAGGGTGAACTTCTT-3' (SEQ ID NO. 6);
the GAATTC sequence in the upstream primer was an introduced EcoRI restriction site, the GCGGCCGC sequence in the downstream primer was an introduced NotI restriction site, and the reverse complement of the ATGATGATGATGGTGGTG sequence in the downstream primer encoded a6 XHis-tag.
The amplified gene engineering hyaluronidase gene fragment is subjected to EcoRI and NotI double digestion, cloned to a linear expression vector pPIC9K subjected to the same digestion treatment, and converted to E.coil TOP10, and recombinant expression plasmid pPIC 9K-delta N24HYAL_OM is obtained on the premise of ensuring that reading frames are not shifted opt The recombination sequence is correct by DNA sequencing comparison. Recombinant plasmidThe recombinant transformant is transferred into P.pastoris GS115 cells after linearization of restriction enzyme SalI, and is screened by geneticin G418 to obtain recombinant bacteria P.pastoris GS115/pPIC 9K-delta N24HYAL_OM with high copy number hyaluronidase genes opt 。
EXAMPLE 2 expression of hyaluronidase
For the obtained recombinant engineering bacteria P.pastoris GS115/pPIC9K-HYAL_OM opt And P.pastoris GS115/pPIC 9K-. DELTA.N24HYAL_OM opt Respectively carrying out shake flask fermentation culture. The fermentation steps are as follows: the monoclonal cells were inoculated into 40mL of YPD medium (yeast extract 10g/L, peptone 20g/L, glucose 20 g/L) and cultured at 30℃and 200rpm for 24 hours. The cells were inoculated in an amount of 10% into 40mL of BMGY (yeast extract 10g/L, peptone 20g/L, K) 2 HPO 4 3g/L，KH 2 PO 4 11.8g/L，YNB 3.4g/L，(NH 4 ) 2 SO 4 10g/L, biotin 4X 10 -4 g/L, glycerol 10 mL/L), at 30℃and 200rpm for 24 hours. The cells were collected by centrifugation, washed with physiological saline and then replaced with 40mL of the induction expression medium BMMY (yeast extract 10g/L, peptone 20g/L, K) 2 HPO 4 3g/L，KH 2 PO 4 11.8g/L，YNB 3.4g/L，(NH 4 ) 2 SO 4 10g/L, biotin 4X 10 -4 g/L, 10mL/L of methanol), at 30 ℃ and 200rpm, pure methanol is added into the culture medium at intervals of 24 hours to reach a final concentration of 1.0% (v/v) for induced expression, and the induced expression is carried out for 96 hours.
And after fermentation, determining the equivalent of reducing sugar generated by hydrolyzing the hyaluronic acid by adopting a DNS method, and calculating the activity of the hyaluronidase by using analytically pure glucose as a standard curve. The reaction system was 1mL: an appropriate amount of fermentation supernatant (blank fermentation supernatant inactivated by an equivalent volume of boiling) was added to 800. Mu.L of 2mg/mL hyaluronic acid substrate solution, 1mL was supplemented with 50mM citric acid buffer (pH 5.5), incubated at 38℃for 15min, and immediately after the completion of the reaction, placed in a boiling water bath for 2min to inactivate the enzyme to terminate the reaction. Adding 1mL of the treated reaction solution into 2mL of DNS (potassium sodium tartrate tetrahydrate 248g/L,3, 5-dinitrosalicylic acid 6.3g/L,2M sodium hydroxide 250mL/L, phenol 5.136g/L and sodium sulfite 5 g/L), vibrating and mixing uniformly, and carrying out boiling water bath for 10min together with a glucose standard yeast sample; and (3) cooling the mixture to room temperature in an ice water bath, adding 7mL of deionized water, shaking and uniformly mixing, measuring absorbance at 540nm, converting the absorbance into the amount of reducing sugar generated by the reaction, and calculating the crude enzyme activity of the fermentation supernatant of the recombinant engineering bacteria according to a glucose standard curve.
The results showed that the recombinant strain P.pastoris GS115/pPIC9K-HYAL_OM opt The enzyme activity of the fermentation supernatant of (a) is 3547.88U/mL, and the recombinant strain P.pastoris GS115/pPIC 9K-delta N24HYAL_OM opt The enzyme activity of the fermentation supernatant of (C) reaches 67970.04U/mL. This means that the hyaluronidase gene (Δn24hyal_om) was highly expressed opt ) The codon-optimized hyaluronidase gene (hyal_om) opt ) The expression capacity is improved by about 20 times, and the industrialized production of the oligosaccharide by using an enzyme method becomes possible.
EXAMPLE 3 high Density expression of hyaluronidase
Recombinant strain P.pastoris GS115/pPIC 9K-. DELTA.N24HYAL_OM opt High-density culture in 5-L fermenter is carried out. Inoculating single colony on YPD plate into 50mL YPD liquid culture medium (yeast extract 10g/L, peptone 20g/L, glucose 20 g/L), culturing at 30deg.C and 220rpm for 24 hr, inoculating the culture solution into 200mL BMGY culture medium (yeast extract 10g/L, peptone 20g/L, K) at 10% 2 HPO 4 3g/L，KH 2 PO 4 11.8g/L，YNB 3.4g/L，(NH 4 ) 2 SO 4 10g/L, biotin 4X 10 -4 g/L, glycerol 10 g/L), at 30℃for 24h at 220 rpm; 200mL of the seed solution for 24 hours was inoculated into a fermentation medium containing 2L of BSM (glycerol 40g/L, K) 2 SO 4 18g/L，KOH 4.13g/L，85％H 3 PO 4 26.7mL/L，CaSO 4 ·2H 2 O 0.93g/L，MgSO 4 ·7H 2 O14.9 g/L,4.4mL/L of filtered sterilized PTM1; PTM1 formula: cuSO 4 ·5H 2 O 6g/L，KI 0.09g/L，MnSO 4 ·H 2 O 3g/L，H 3 BO 3 0.02g/L，MoNa 2 O 4 ·2H 2 O 0.2g/L，CoCl 2 ·6H 2 O 0.92g/L，ZnCl 2 20g/L，FeSO 4 ·7H 2 O65 g/L, biotin 0.2g/L, H 2 SO 4 5.0 mL) of the fermentation tank. The initial fermentation parameters were set at a temperature of 30 ℃, pH 5.5, aeration rate of 2.0vvm and rotational speed of 500rpm; the pH is controlled to be 5.5 by automatically adding ammonia water in the fermentation process; after the glycerol in the BSM medium is exhausted, entering a fed-batch stage, adding 50% (v/v) glycerol (containing 12mL/LPTM 1) in an exponential feeding manner, simultaneously setting the rotating speed and the dissolved oxygen DO to be coupled, wherein the feeding rates are respectively 13.5, 16.2, 19.2, 22.8, 27.2 and 32.4mL/h/L in the first 6h, and then the feeding rate of 6h is set to be 30mL/h/L; after the material supplementing is finished, the material enters a starvation culture stage, and the starvation culture is carried out for 2-3 hours until the residual glycerol is exhausted; and (3) entering a methanol induction stage, feeding pure methanol containing 12mL/L PTM1, maintaining the final concentration at 1.8% (v/v), adjusting the fermentation temperature to 25 ℃, increasing the rotating speed to 1000rpm, and inducing for 88 hours, wherein the methanol feeding rate and the final concentration of the methanol in the culture medium are controlled by a methanol detector in real time on line.
The results show that when methanol is induced for 88 hours, the activity of the hyaluronidase of the fermentation supernatant is as high as 4.7X10 5 The enzyme activity or protein expression level obtained by high-density fermentation is 6.97 times of that of shaking flask fermentation, so that the expression quantity of the hyaluronidase is further improved. The high expression level of hyaluronidase provides a basis for the industrialized production of hyaluronic acid oligosaccharide.
EXAMPLE 4 purification preparation of hyaluronidase
After the fermentation process of example 3 was completed, the fermentation broth was centrifuged under centrifugation conditions: 11000rpm,10min,4 ℃. Collecting the centrifugal supernatant, filtering with 0.22 μm filter membrane to remove particulate impurities, and performing low-temperature ultrafiltration. The molecular weight cutoff of the organic ultrafiltration membrane is 10kDa, and small molecular impurities such as high-valence salt ions and the like of the product enzyme molecules in the cutoff liquid are discharged along with the permeation liquid. The ultrafiltration process uses cooling circulating water to cool the system. Detecting conductivity change of trapped fluid by ultrafiltration tracking, and diluting with purified water with equal volume when the conductivity of trapped concentrate fluid is no longer changed and the flow rate of permeate fluid is reduced so as to facilitate permeation; repeatedly diluting for several times, stopping ultrafiltration when the conductivity of the trapped concentrated solution is lower than 500 mu s/cm, collecting trapped enzyme solution, and refrigerating in a refrigerator for standby. The obtained hyaluronidase ultrafiltration concentrate is subjected to enzyme activity measurement by a DNS methodThe activity of the purified hyaluronidase is 2.8X10 5 U/mL。
EXAMPLE 5 preparation of hyaluronic acid oligosaccharides
The hyaluronidase ultrafiltration concentrate prepared in example 4 was used to hydrolyze hyaluronic acid to prepare hyaluronic acid oligosaccharide.
Adding the hyaluronidase ultrafiltration concentrate with a final concentration of 6000U/mL into 40g/L hyaluronic acid solution. The reaction was allowed to react at 37℃and 300rpm for 8 hours.
After pretreatment of samples taken after the 8-hour reaction was completed, LCMS-IT-TOF analysis was performed, and the negative ion species and molecular weights of HA oligosaccharides after electrospray ionization (ESI) are shown in Table 1. The mass spectrum detection result is shown in FIG. 1, and the mass spectrum peaks appearing at 3.75min and 4.05min on the mass spectrum total ion flow peak diagram are in the anion mode [ M-H ]] - 775.22, identified as hyaluronan tetrasaccharide (fig. 2); mass spectrum peaks appearing at 5.15min and 5.40min on the mass spectrum total ion current peak diagram are in anion mode [ M-H] - 1154.33, [ M-H ]] 2- 576.66, identified as hyaluronan hexasaccharide (fig. 3); the mass spectrum peak appearing at 6.30min on the mass spectrum total ion current peak diagram is in anion mode [ M-H ]] 2- 766.21, identified as octasaccharide hyaluronate (fig. 4); the mass spectrum peak appearing at 6.80min on the mass spectrum total ion current peak diagram is in anion mode [ M-H ]] 2- 955.77, identified analytically as hyaluronan (fig. 5).
Table 1 ESI anion species and molecular weight of HA oligosaccharides
Sequence listing
SEQ ID NO.1：
SEQ ID NO.2：
SEQ ID NO.3
SEQ ID NO.4：
/>
SEQ ID NO.5：
CCGGAATTCATGAAGACACTACGCGGCTC
SEQ ID NO.6：
ATTTGCGGCCGCTCAATGATGATGATGGTGGTGATGAAGGGTGAACTTCTT
Sequence listing
<110> Hua Xi Biotech Co., ltd
<120> method for preparing hyaluronic acid oligosaccharide by enzymatic method
<130> TPE01628
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 1074
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 1
atgatcccac ccgcacgtga ctcgcttatg tttgtctttg cgactgcggt aatcgctagt 60
tttttcggta gcgcaaagac actacgcggc tcttccccac agcaattcga cgtatactgg 120
aatgtgccaa ctttcatgtg tcacaagcac ggtatgaaat ttgaagagct gaaagatttc 180
ggtatacacc agaacgcaat ggatatgttt cgcggcgaag aaattgcgat tctttatgac 240
cctggcatgt ttcccgccct tctagtagat aaagatggat acgtcactaa acggaacggt 300
ggggtgccgc aagaggggaa cctcaaggaa catttagaaa cctttagaaa gcatctgacg 360
acacaaattc cggacgagag ctttagcggg ataggaatca tagactttga gagttggaga 420
ccgattttca ggcagaactg ggcgtcactc gagccctata aaactttgtc cataaagttg 480
gagagggaaa aacacccatt ttggtcggag gcagctgtga agaaggaggc caaacgtcga 540
ttcgagaaat ccgggcgaat atttatggag gaaaccctca aaatggccaa aaaactaaga 600
ccgaaagcaa agtggggcta ttatgggtat ccccactgtt tcaatcaaac ccctggacag 660
cagtcggttc actgcaatcg gcaaacgatg atggaaaatg acggtatgag ttggctgttt 720
acactcgaag acgttcatgc tcccagcgtt tacctacgat tggaaatcaa ggaggatgac 780
cggccttcat tcgtgaaagg ccgggtttcc gaggccttaa ggttagccgc taaatcgtct 840
tcaaaacaac gtatcctacc ttactactgg ttcatttatc aggataagaa ggatgagttc 900
ttaacggaaa aggatacaca aaacactata aatatgatcg ctaatctggg atctaatggt 960
ttcataattt ggggatctag tgacgatgtc aacacggaac gcaaatgcaa ggatttacag 1020
caatacgtaa aggaagtctt gggcccagcg attaagaagt tcacccttca ttga 1074
<210> 2
<211> 357
<212> PRT
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 2
Met Ile Pro Pro Ala Arg Asp Ser Leu Met Phe Val Phe Ala Thr Ala
1 5 10 15
Val Ile Ala Ser Phe Phe Gly Ser Ala Lys Thr Leu Arg Gly Ser Ser
20 25 30
Pro Gln Gln Phe Asp Val Tyr Trp Asn Val Pro Thr Phe Met Cys His
35 40 45
Lys His Gly Met Lys Phe Glu Glu Leu Lys Asp Phe Gly Ile His Gln
50 55 60
Asn Ala Met Asp Met Phe Arg Gly Glu Glu Ile Ala Ile Leu Tyr Asp
65 70 75 80
Pro Gly Met Phe Pro Ala Leu Leu Val Asp Lys Asp Gly Tyr Val Thr
85 90 95
Lys Arg Asn Gly Gly Val Pro Gln Glu Gly Asn Leu Lys Glu His Leu
100 105 110
Glu Thr Phe Arg Lys His Leu Thr Thr Gln Ile Pro Asp Glu Ser Phe
115 120 125
Ser Gly Ile Gly Ile Ile Asp Phe Glu Ser Trp Arg Pro Ile Phe Arg
130 135 140
Gln Asn Trp Ala Ser Leu Glu Pro Tyr Lys Thr Leu Ser Ile Lys Leu
145 150 155 160
Glu Arg Glu Lys His Pro Phe Trp Ser Glu Ala Ala Val Lys Lys Glu
165 170 175
Ala Lys Arg Arg Phe Glu Lys Ser Gly Arg Ile Phe Met Glu Glu Thr
180 185 190
Leu Lys Met Ala Lys Lys Leu Arg Pro Lys Ala Lys Trp Gly Tyr Tyr
195 200 205
Gly Tyr Pro His Cys Phe Asn Gln Thr Pro Gly Gln Gln Ser Val His
210 215 220
Cys Asn Arg Gln Thr Met Met Glu Asn Asp Gly Met Ser Trp Leu Phe
225 230 235 240
Thr Leu Glu Asp Val His Ala Pro Ser Val Tyr Leu Arg Leu Glu Ile
245 250 255
Lys Glu Asp Asp Arg Pro Ser Phe Val Lys Gly Arg Val Ser Glu Ala
260 265 270
Leu Arg Leu Ala Ala Lys Ser Ser Ser Lys Gln Arg Ile Leu Pro Tyr
275 280 285
Tyr Trp Phe Ile Tyr Gln Asp Lys Lys Asp Glu Phe Leu Thr Glu Lys
290 295 300
Asp Thr Gln Asn Thr Ile Asn Met Ile Ala Asn Leu Gly Ser Asn Gly
305 310 315 320
Phe Ile Ile Trp Gly Ser Ser Asp Asp Val Asn Thr Glu Arg Lys Cys
325 330 335
Lys Asp Leu Gln Gln Tyr Val Lys Glu Val Leu Gly Pro Ala Ile Lys
340 345 350
Lys Phe Thr Leu His
355
<210> 3
<211> 1020
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 3
atgaagacac tacgcggctc ttccccacag caattcgacg tatactggaa tgtgccaact 60
ttcatgtgtc acaagcacgg tatgaaattt gaagagctga aagatttcgg tatacaccag 120
aacgcaatgg atatgtttcg cggcgaagaa attgcgattc tttatgaccc tggcatgttt 180
cccgcccttc tagtagataa agatggatac gtcactaaac ggaacggtgg ggtgccgcaa 240
gaggggaacc tcaaggaaca tttagaaacc tttagaaagc atctgacgac acaaattccg 300
gacgagagct ttagcgggat aggaatcata gactttgaga gttggagacc gattttcagg 360
cagaactggg cgtcactcga gccctataaa actttgtcca taaagttgga gagggaaaaa 420
cacccatttt ggtcggaggc agctgtgaag aaggaggcca aacgtcgatt cgagaaatcc 480
gggcgaatat ttatggagga aaccctcaaa atggccaaaa aactaagacc gaaagcaaag 540
tggggctatt atgggtatcc ccactgtttc aatcaaaccc ctggacagca gtcggttcac 600
tgcaatcggc aaacgatgat ggaaaatgac ggtatgagtt ggctgtttac actcgaagac 660
gttcatgctc ccagcgttta cctacgattg gaaatcaagg aggatgaccg gccttcattc 720
gtgaaaggcc gggtttccga ggccttaagg ttagccgcta aatcgtcttc aaaacaacgt 780
atcctacctt actactggtt catttatcag gataagaagg atgagttctt aacggaaaag 840
gatacacaaa acactataaa tatgatcgct aatctgggat ctaatggttt cataatttgg 900
ggatctagtg acgatgtcaa cacggaacgc aaatgcaagg atttacagca atacgtaaag 960
gaagtcttgg gcccagcgat taagaagttc acccttcatc accaccatca tcatcattga 1020
<210> 4
<211> 339
<212> PRT
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 4
Met Lys Thr Leu Arg Gly Ser Ser Pro Gln Gln Phe Asp Val Tyr Trp
1 5 10 15
Asn Val Pro Thr Phe Met Cys His Lys His Gly Met Lys Phe Glu Glu
20 25 30
Leu Lys Asp Phe Gly Ile His Gln Asn Ala Met Asp Met Phe Arg Gly
35 40 45
Glu Glu Ile Ala Ile Leu Tyr Asp Pro Gly Met Phe Pro Ala Leu Leu
50 55 60
Val Asp Lys Asp Gly Tyr Val Thr Lys Arg Asn Gly Gly Val Pro Gln
65 70 75 80
Glu Gly Asn Leu Lys Glu His Leu Glu Thr Phe Arg Lys His Leu Thr
85 90 95
Thr Gln Ile Pro Asp Glu Ser Phe Ser Gly Ile Gly Ile Ile Asp Phe
100 105 110
Glu Ser Trp Arg Pro Ile Phe Arg Gln Asn Trp Ala Ser Leu Glu Pro
115 120 125
Tyr Lys Thr Leu Ser Ile Lys Leu Glu Arg Glu Lys His Pro Phe Trp
130 135 140
Ser Glu Ala Ala Val Lys Lys Glu Ala Lys Arg Arg Phe Glu Lys Ser
145 150 155 160
Gly Arg Ile Phe Met Glu Glu Thr Leu Lys Met Ala Lys Lys Leu Arg
165 170 175
Pro Lys Ala Lys Trp Gly Tyr Tyr Gly Tyr Pro His Cys Phe Asn Gln
180 185 190
Thr Pro Gly Gln Gln Ser Val His Cys Asn Arg Gln Thr Met Met Glu
195 200 205
Asn Asp Gly Met Ser Trp Leu Phe Thr Leu Glu Asp Val His Ala Pro
210 215 220
Ser Val Tyr Leu Arg Leu Glu Ile Lys Glu Asp Asp Arg Pro Ser Phe
225 230 235 240
Val Lys Gly Arg Val Ser Glu Ala Leu Arg Leu Ala Ala Lys Ser Ser
245 250 255
Ser Lys Gln Arg Ile Leu Pro Tyr Tyr Trp Phe Ile Tyr Gln Asp Lys
260 265 270
Lys Asp Glu Phe Leu Thr Glu Lys Asp Thr Gln Asn Thr Ile Asn Met
275 280 285
Ile Ala Asn Leu Gly Ser Asn Gly Phe Ile Ile Trp Gly Ser Ser Asp
290 295 300
Asp Val Asn Thr Glu Arg Lys Cys Lys Asp Leu Gln Gln Tyr Val Lys
305 310 315 320
Glu Val Leu Gly Pro Ala Ile Lys Lys Phe Thr Leu His His His His
325 330 335
His His His
<210> 5
<211> 29
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 5
ccggaattca tgaagacact acgcggctc 29
<210> 6
<211> 51
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 6
atttgcggcc gctcaatgat gatgatggtg gtgatgaagg gtgaacttct t 51
Claims (8)
1. A method for preparing hyaluronic acid oligosaccharide by an enzymatic method, which comprises the following steps:
preparing a hyaluronic acid solution,
adding hyaluronidase into the hyaluronic acid solution to react to obtain hyaluronic acid oligosaccharide,
wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID NO. 3.
2. The method according to claim 1, wherein the initial concentration of the hyaluronic acid in the reaction system composed of the hyaluronidase and the hyaluronic acid solution is 20-80g/L.
3. The method according to claim 1, wherein the hyaluronic acid has a molecular weight of 1 x 10 or more in a reaction system composed of the hyaluronidase and the hyaluronic acid solution 6 Da。
4. The method according to claim 1, wherein the concentration of the hyaluronidase in the reaction system comprising the hyaluronidase and the hyaluronic acid solution is 1.5X10 3 -1×10 5 U/mL。
5. The method according to claim 1, wherein the temperature of the reaction is 20-65 ℃ and the time of the reaction is 0.5-8h.
6. The method of claim 1, wherein the hyaluronic acid solution is formulated using 20-100mm acetic acid-sodium acetate buffer at a ph of 4.0-6.5.
7. The method of claim 1, wherein the hyaluronic acid oligosaccharide comprises a hyaluronic acid oligosaccharide that is reduced to saturated N-acetamido glucose.
8. The method of claim 1, wherein the hyaluronic acid oligosaccharide comprises hyaluronic acid tetraose, hyaluronic acid hexaose, hyaluronic acid octaose, and hyaluronic acid decaose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110937316.3A CN114350728B (en) | 2021-08-16 | 2021-08-16 | Method for preparing hyaluronic acid oligosaccharide by using enzyme method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110937316.3A CN114350728B (en) | 2021-08-16 | 2021-08-16 | Method for preparing hyaluronic acid oligosaccharide by using enzyme method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114350728A CN114350728A (en) | 2022-04-15 |
| CN114350728B true CN114350728B (en) | 2023-10-20 |
Family
ID=81095634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110937316.3A Active CN114350728B (en) | 2021-08-16 | 2021-08-16 | Method for preparing hyaluronic acid oligosaccharide by using enzyme method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114350728B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114350535A (en) * | 2021-10-09 | 2022-04-15 | 华熙生物科技股份有限公司 | Engineering yeast strain for high yield of hyaluronidase and application thereof |
| CN115944549A (en) * | 2022-12-26 | 2023-04-11 | 华熙生物科技股份有限公司 | Hyaluronic acid oligosaccharide composition and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008174642A (en) * | 2007-01-18 | 2008-07-31 | Denki Kagaku Kogyo Kk | 4-sulfated hyaluronic acid |
| JP2011252115A (en) * | 2010-06-03 | 2011-12-15 | Hirosaki Univ | Manufacturing method of hybrid sugar chain |
| CN103484513A (en) * | 2013-10-22 | 2014-01-01 | 江南大学 | Method for preparing small-molecule oligomeric hyaluronic acid through enzyme method |
-
2021
- 2021-08-16 CN CN202110937316.3A patent/CN114350728B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008174642A (en) * | 2007-01-18 | 2008-07-31 | Denki Kagaku Kogyo Kk | 4-sulfated hyaluronic acid |
| JP2011252115A (en) * | 2010-06-03 | 2011-12-15 | Hirosaki Univ | Manufacturing method of hybrid sugar chain |
| CN103484513A (en) * | 2013-10-22 | 2014-01-01 | 江南大学 | Method for preparing small-molecule oligomeric hyaluronic acid through enzyme method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114350728A (en) | 2022-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114350728B (en) | Method for preparing hyaluronic acid oligosaccharide by using enzyme method | |
| CN103484513B (en) | Method for preparing small-molecule oligomeric hyaluronic acid through enzyme method | |
| CN106995811B (en) | A kind of algin catenase, preparation method and application | |
| CN114350691B (en) | Gene for efficiently expressing hyaluronic acid hydrolase and expression method thereof | |
| EP3730623A1 (en) | Small-molecule hyaluronic acid or salt thereof, and preparation method therefor | |
| CN110331178B (en) | Method for preparing micromolecular hyaluronic acid by enzyme cleavage method, obtained micromolecular hyaluronic acid and application thereof | |
| RU2564566C2 (en) | K5 heparosan fermentation and purification | |
| CN107893061B (en) | Beta-1, 3-glucanase derived from rhizomucor miehei and application thereof | |
| CN112760311B (en) | Enzyme solution with better enzyme activity ratio of beta-mannase to alpha-galactosidase, and preparation method and application thereof | |
| CN114350639B (en) | Codon-optimized hyaluronan hydrolase gene and expression thereof | |
| CN110951714B (en) | Hyaluronic acid hydrolase, coding sequence thereof and method for preparing oligomeric hyaluronate by using same | |
| CN104178539B (en) | A kind of method of prepare with scale specified molecular weight micromolecule hyaluronic acid | |
| CN114350535A (en) | Engineering yeast strain for high yield of hyaluronidase and application thereof | |
| CN109929861A (en) | A kind of Glucomannan enzyme coding gene and enzyme and preparation and application | |
| CN110951805B (en) | Enzymolysis preparation method of low molecular weight laver polysaccharide and laver oligosaccharide | |
| CN109929860A (en) | A kind of preparation and application of fucoidin enzyme coding gene and enzyme | |
| CN113603732B (en) | Non-animal chondroitin sulfate oligosaccharide and preparation method thereof | |
| Manzoni et al. | Production of K5 polysaccharides of different molecular weight by Escherichia coli | |
| CN110684211A (en) | Method for preparing cross-linked dextran gel resistant to hydrolysis by alpha-glucosidase | |
| CN111575264B (en) | Porphyrase capable of receiving methylated galactose and application thereof | |
| CN115820766A (en) | Method for preparing chondroitin oligosaccharide by enzyme method and chondroitin oligosaccharide composition | |
| KR20150063057A (en) | Enzyme hyaluronan-lyase, method of production thereof, use thereof and method of preparation of low-molecular hyaluronan | |
| JPH09168384A (en) | Chondroitin sulfate hydrolase and production of chondroitin sulfate oligosaccharide using the same | |
| CN114807094B (en) | Chitosan SvChiAJ54 and encoding gene and application thereof | |
| CN114196655B (en) | Heat-resistant Kunmu polysaccharide degrading enzyme OUC-SaLam66 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |