CN116515803A

CN116515803A - Hyaluronidase and gene expression and application thereof

Info

Publication number: CN116515803A
Application number: CN202310065046.0A
Authority: CN
Inventors: 赵国刚; 李玲聪; 姚伟; 胡少峰; 刘妍池
Original assignee: Hebei Agricultural University
Current assignee: Hebei Agricultural University
Priority date: 2022-02-08
Filing date: 2023-01-17
Publication date: 2023-08-01
Also published as: CN114517194A

Abstract

The invention relates to the technical field of biochemical engineering, and particularly discloses hyaluronic acid lyase and gene expression and application thereof. The amino acid sequence of the hyaluronic acid lyase is shown as SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO.2. The invention also provides an expression vector and an expression bacterial body containing the coding gene, and application of the hyaluronic acid lyase and the coding gene thereof in preparing unsaturated hyaluronic acid disaccharide. The hyaluronic acid lyase provided by the invention has the advantages of high enzyme activity, high catalytic efficiency, good temperature and pH stability, wide temperature and pH range required by maintaining enzymolysis activity, direct conversion in pure water and small and uniform molecular weight of an enzymolysis product, and is suitable for large-scale industrialized enzymolysis of hyaluronic acid to produce unsaturated hyaluronic acid disaccharide.

Description

Hyaluronidase and gene expression and application thereof

Technical Field

The invention relates to the technical field of biochemical engineering, in particular to hyaluronic acid lyase and gene expression and application thereof.

Background

Hyaluronic acid is a high molecular weight polysaccharide widely existing in the extracellular matrix of higher animals and lower animals, and its basic structure is a polysaccharide composed of D-glucuronic acid and N-acetamido glucose as disaccharide units, and is widely used in the fields of cosmetics, foods and medicines. The effect and function of different molecular weights are different. The high molecular weight hyaluronic acid (> 160 Da) forms a compact protective film on the surface of the skin, thereby playing a long-acting moisturizing and good repairing role; the medium molecular weight hyaluronic acid (20-160 Da) plays roles of moisturizing, lubricating, slow release and stable emulsification; the low molecular weight hyaluronic acid (1-20 Da) plays a role in permanently moisturizing the nutrition skin; the hyaluronic acid oligosaccharide (< 10000 Da) can be absorbed transdermally for deep moisturizing, and has effects of resisting aging, repairing after sun drying, etc. Hyaluronic acid with ultra-low molecular weight (< 2000 Da) can permeate into dermis, supplement dermis moisture, remove wrinkles and tender skin, and increase skin elasticity; tightly combined with skin cells, scavenging free radicals in cells, repairing damaged collagen, and promoting wound healing. Therefore, the ultra-low molecular weight hyaluronic acid has wide application prospect in the fields of food health care, cosmetics and clinical medical treatment, and the market demand for the ultra-low molecular weight is increased year by year in recent years.

At present, the preparation of low molecular weight hyaluronic acid mainly comprises the steps of degrading macromolecular hyaluronic acid into low molecular weight hyaluronic acid through physical, chemical and enzymatic degradation methods. The physical method mainly comprises the steps of degrading hyaluronic acid by physical factors such as heating, mechanical shearing, ultraviolet rays, ultrasonic waves, gamma-ray radiation, high-pressure homogenization and the like, but the product obtained by the method has poor stability, uneven molecular weight distribution and lower degradation efficiency; the chemical degradation method mainly comprises alkali hydrolysis, hydrolysis and oxidative degradation, and can achieve the aim of controlling the molecular weight of the product to a certain extent, but the degradation conditions of different chemical reagents are complex, so that the properties of the product are easily affected, the purification of the product is difficult, and the problem of waste liquid pollution exists. The enzymatic degradation is an ideal method for preparing the hyaluronic acid with low molecular weight because the reaction condition is mild, the operation is simple, and the structure of the polysaccharide is not changed. Whereas ultra-low molecular weight hyaluronic acid can only be prepared by enzymatic hydrolysis of hyaluronic acid. However, the existing hyaluronidase has the problems of uneven molecular weight of enzymolysis products, low enzymolysis conversion efficiency, narrow temperature range and pH range required by enzyme activity maintenance, special buffer system, complex product separation steps and the like. Therefore, the hyaluronidase (or lyase) which has the advantages of small and uniform molecular weight of enzymolysis products, high catalytic efficiency, good temperature, pH stability, a conversion system and simple recovery method is developed, and has important application value.

Disclosure of Invention

Aiming at the problems existing in the existing preparation of ultra-low molecular weight hyaluronic acid by enzymolysis, the invention provides a hyaluronic acid lyase and gene expression and application thereof, and the hyaluronic acid lyase has the advantages of high enzyme activity and catalytic efficiency, good stability, small and uniform molecular weight of an enzymolysis product, simple reaction and recovery in pure water, and no need of removing salt.

In order to achieve the above purpose, the embodiment of the invention adopts the following technical scheme:

a hyaluronic acid lyase has an amino acid sequence shown in SEQ ID NO.1.

Compared with the prior art, the hyaluronic acid lyase provided by the invention has high conversion efficiency, and the enzymolysis conversion rate can reach 100% in a short time under the proper enzymolysis condition; the enzyme activity stability is good, the high enzymolysis activity and conversion efficiency can be maintained under the conditions of 20-60 ℃ and pH4-10, and the enzymolysis reaction can be carried out in water. The enzymolysis products have small and uniform molecular weight, are all unsaturated hyaluronic acid disaccharides, have molecular weight lower than 500Da and have high purity. The hyaluronic acid lyase provided by the invention has the advantages of high conversion efficiency, good activity stability, wide temperature and pH range required for keeping enzymolysis activity, small and uniform molecular weight of an enzymolysis product, capability of reacting in pure water, simple product recovery and no need of desalting, and is suitable for large-scale industrial production.

The invention also provides a coding gene of the hyaluronan lyase, and the nucleotide sequence of the coding gene is shown as SEQ ID NO.2.

The invention also provides a recombinant expression vector, which is obtained by inserting the coding gene of the hyaluronan lyase into the expression vector.

Preferably, the expression vector is plasmid pET28a-SUMO.

The invention also provides an expression thallus which is obtained by transferring the recombinant expression vector into a host cell.

Preferably, the host cell is E.coli BL21 (DE 3).

The invention also provides the application of the hyaluronan lyase, the coding gene of the hyaluronan lyase, the recombinant expression vector or the expression thallus in preparing unsaturated hyaluronan disaccharide.

The hyaluronic acid lyase can be used for preparing unsaturated hyaluronic acid disaccharide with uniform molecular weight, high purity and high yield.

The invention also provides a method for preparing unsaturated hyaluronic acid disaccharide, which comprises the following steps: adding sodium hyaluronate and the hyaluronate lyase into a water phase system, and performing enzymolysis reaction at the temperature of 20-60 ℃ and the pH value of 4-10 to obtain the unsaturated hyaluronate disaccharide.

Preferably, the aqueous phase system is pure water or calcium chloride aqueous solution.

Preferably, the temperature of the enzymolysis reaction is 40 ℃.

Preferably, the pH of the enzymatic reaction is 7.

Drawings

FIG. 1 is a schematic diagram showing the construction and structure of plasmid pACYC Duet-1-ulp in example 3 of the invention;

FIG. 2 is a graph showing the detection of a purified hyaluronic acid lyase in example 4 of the present invention; wherein M: maker;1: a semo tagged SaHyaL crude enzyme; 2: crude SaHyaL enzyme with SUMO tag excised; 3: purified recombinant enzyme;

FIG. 3 is a graph showing the enzymatic activities of the hyaluronan lyase detected in example 5 of the present invention at various temperatures;

FIG. 4 is a graph showing the enzymatic activity of hyaluronan lyase detected in example 5 of the present invention at various pH values;

FIG. 5 is a graph showing the temperature stability of the hyaluronan lyase detected in example 5 of the present invention;

FIG. 6 is a graph showing the pH stability of the hyaluronan lyase detected in example 5 of the present invention;

FIG. 7 is a TLC analysis chart of the enzymatic hydrolysate in example 8 of the present invention;

FIG. 8 is a HPLC detection chart of the enzymatic hydrolysate in example 8 of the present invention;

FIG. 9 is a graph of the conversion monitoring of sodium hyaluronate hydrolyzed by hyaluronan lyase using HPLC at various time points in example 8 of the present invention;

FIG. 10 is a HPLC chart of the final product of the enzymolysis in example 8 of the present invention;

FIG. 11 is a diagram of LC-MS/MS mass spectrometry analysis of the final enzymatic hydrolysis product in example 8 of the present invention.

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

Example 1

A hyaluronan lyase with an amino acid sequence shown in SEQ ID NO.1 is obtained from Streptomyces sp.B1010, which is obtained from laboratory sieves.

SEQ ID NO.1

ARAAEGRARLLANTADVFAGTAASNARPETAGRLAAIDKAARANLKAMDDAGDGELFAGLVLGADEANLNTAYRRLYEIALATRAPTPGATTGLYGDTAAQRRVIDGLEWLHERYYGDQSKGYYGNWFHWEIGLSQHISRTLVLLAGEVRAHRPDLARAYVASMDAYLRNGADGDVDLGSRFHTGANLADITTNRVLQGALLGADGDARIRKALVDQLTVFVTIDPYHLSHGVTDGHYADGSFIQHASVAYTGSYGKGLLSRVVQTLKILQGTGFAHGEELVPTVFGWVRDGFAPVIFEGWMMEIVKGRAVARTDSGYTDAAVVVEAVVDLSSLAEGAAAAALKSYVKHLGATSPAPLDPARFVSPVSIVRHADIAADDSVVPADLNPGERSVAFNAMDRTVHRRPGYAFALARNSDRISKYEYMNGENLMPWFQGEGAHYLYLTGQDQTQAYGVDYYTTVSPYGLAGVTAPVERRRTVPEAYGKPYYDNPDHPLRFTSSSESQNTYVYFPRGTARHSGGAVLGAYGTAAMVQSSDVAHRDRKLLPDDFLVHRGASATKSWFLLDDEIVVLAAGVGDFEGGGSGGRAVTTTVDARVAAPGDRVTLTGARADGGAWTGPGTADLRWLRYANATRGASVGYVFLDVPPVRVSLDRVTRSRRIVRTANADTAVTRSVFGVTVDGAAGARPAHLAYALLPNATEEGLRRYGDGKGDRWGSRGSRGPLRVLANSTRLQAVAHSGLGLTGVNSFTAGRHETAGLRIDGPASVLVRGSGRRGGITAVAVSDPTMRRDTVTVLLRGRRMRQVSADRGVRVSVTPGGTRIEVATRHAYGRSFTVTLRG

Obtaining the coding gene of the hyaluronic acid lyase:

the genome of a Streptomyces sp.B1010 strain obtained by screening is taken as a template (DNA template), an upstream primer and a downstream primer are designed, the annealing temperature of the primers is predicted, an EcoRI restriction enzyme cutting site and a protecting base are added at the 5 'end of the upstream primer, an XhoI restriction enzyme cutting site and a protecting base are introduced at the 5' end of the downstream primer, and the primer sequence is as follows:

hyal-F：(EcoRI)5′-TTAAGAATTCGCCAGGGCCGCCGAGG-3′(SEQ IDNO.3)；

hyal-R：(XhoI)5′-CCGCTCGAGGCCCCGCAGGGTCACC-3′(SEQ IDNO.4)。

the PCR instrument is used for large-scale amplification, the DNA polymerase kit is purchased from Beijing full-scale gold biotechnology Co., ltd, the PCR reaction system is shown in table 1, the PCR amplification program is shown in table 2, the target gene obtained after amplification is detected by using 0.8% agarose gel, then the agarose gel is cut for recovery, and purification is carried out, so that the encoding gene of the hyaluronic acid lyase is obtained, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO.2.

SEQ ID NO.2

GCCAGGGCCGCCGAGGGTCGTGCACGCCTGCTGGCAAACACCGCTGATGTGTTCGCTGGTACTGCAGCGTCTAACGCTCGTCCGGAAACTGCTGGTCGTCTGGCAGCAATTGATAAAGCCGCTCGTGCTAACCTGAAGGCGATGGACGACGCTGGCGACGGTGAACTGTTCGCTGGCCTGGTACTGGGTGCCGATGAAGCAAACCTGAATACCGCATACCGTCGCCTGTATGAAATCGCGCTGGCTACTCGTGCACCGACTCCAGGTGCGACTACTGGCCTGTATGGTGATACCGCCGCCCAGCGTCGCGTTATTGACGGTCTGGAATGGCTGCACGAACGTTATTACGGCGACCAGAGCAAAGGTTACTATGGCAACTGGTTCCACTGGGAGATCGGCCTGTCCCAGCACATTAGCCGTACTCTGGTGCTGCTGGCCGGTGAAGTGCGTGCTCACCGTCCAGATCTGGCACGTGCTTACGTTGCGAGCATGGACGCATACCTGCGTAACGGTGCTGATGGTGATGTCGATCTGGGCTCTCGTTTCCACACGGGTGCTAACCTGGCGGACATCACCACGAATCGCGTTCTGCAGGGTGCACTGCTGGGTGCAGATGGCGACGCTCGTATCCGTAAAGCGCTGGTAGACCAGCTGACTGTGTTCGTTACCATCGATCCGTATCACCTGTCTCACGGTGTTACCGATGGCCATTACGCCGACGGCTCTTTTATTCAGCACGCATCTGTTGCGTATACTGGTAGCTACGGTAAAGGTCTGCTGTCCCGCGTTGTTCAGACCCTGAAAATTCTGCAGGGTACCGGTTTCGCACACGGTGAAGAACTGGTCCCGACCGTTTTTGGTTGGGTACGCGACGGTTTTGCTCCGGTGATCTTCGAGGGTTGGATGATGGAGATTGTTAAGGGTCGTGCAGTTGCACGTACCGACTCTGGTTACACCGACGCTGCAGTTGTGGTTGAAGCGGTGGTTGACCTGTCCTCCCTGGCTGAAGGTGCAGCTGCGGCTGCACTGAAGTCCTACGTCAAACACCTGGGTGCAACTTCTCCAGCTCCGCTGGATCCGGCACGTTTCGTTTCCCCGGTTTCCATTGTTCGTCACGCGGACATCGCGGCTGACGACTCTGTAGTACCTGCAGACCTGAACCCGGGCGAACGCTCTGTTGCTTTCAACGCGATGGACCGTACCGTGCACCGTCGTCCAGGCTACGCTTTCGCCCTGGCTCGTAACAGCGATCGTATCTCCAAATATGAATATATGAACGGTGAAAATCTGATGCCGTGGTTTCAGGGCGAGGGTGCTCACTACCTGTACCTGACTGGTCAGGATCAGACTCAGGCTTACGGTGTGGACTACTATACTACCGTCTCTCCGTACGGTCTGGCGGGTGTCACTGCACCTGTTGAACGCCGTCGTACCGTACCGGAAGCGTACGGTAAACCGTACTACGATAACCCGGATCATCCGCTGCGCTTCACTTCTTCCAGCGAAAGCCAGAACACCTACGTTTATTTCCCTCGTGGCACCGCACGTCATTCCGGTGGTGCAGTACTGGGTGCATACGGTACCGCGGCCATGGTACAAAGCTCTGACGTTGCACACCGCGATCGTAAGCTGCTGCCGGACGATTTCCTGGTTCACCGTGGTGCGTCCGCGACTAAAAGCTGGTTTCTGCTGGACGATGAAATCGTTGTGCTGGCAGCTGGCGTGGGTGACTTCGAAGGTGGCGGTTCTGGCGGTCGTGCTGTTACTACCACTGTAGATGCCCGTGTTGCAGCACCGGGTGATCGCGTAACCCTGACTGGTGCTCGTGCAGATGGCGGTGCTTGGACTGGTCCAGGTACTGCAGATCTGCGCTGGCTGCGTTACGCTAACGCTACCCGCGGTGCTTCTGTTGGTTACGTTTTCCTGGACGTGCCGCCGGTTCGTGTTTCCCTGGATCGTGTAACGCGCTCTCGTCGTATTGTGCGTACCGCGAACGCGGATACCGCCGTAACCCGTTCTGTATTCGGTGTTACTGTGGATGGTGCGGCTGGTGCACGTCCTGCTCATCTGGCTTATGCGCTGCTGCCGAACGCAACCGAAGAAGGTCTGCGCCGTTATGGTGATGGTAAAGGTGACCGTTGGGGTTCTCGTGGCTCTCGTGGTCCGCTGCGTGTACTGGCTAACTCCACTCGTCTGCAGGCAGTTGCTCATTCTGGCCTGGGCCTGACCGGTGTTAACTCTTTCACCGCTGGTCGCCATGAAACTGCTGGTCTGCGTATTGATGGCCCGGCGTCTGTTCTGGTCCGTGGTTCTGGTCGTCGTGGTGGTATTACCGCCGTAGCTGTGAGCGATCCGACCATGCGCCGTGATACCGTGACTGTTCTGCTGCGTGGTCGTCGTATGCGTCAAGTTTCCGCAGATCGCGGTGTACGTGTATCCGTAACTCCGGGTGGTACCCGTATTGAAGTTGCAACCCGCCATGCCTATGGCCGCAGCTTCACGGTGACCCTGCGGGGC

TABLE 1PCR System

TABLE 2PCR amplification procedure

Example 2

Construction of the recombinant expression vector of the above-mentioned hyaluronan lyase:

1) The coding gene of the obtained hyaluronan lyase and the vector pET28a-SUMO were amplified and purified in double cleavage example 1.

The coding gene of the hyaluronan lyase and the vector pET28a-SUMO were subjected to double digestion with restriction enzymes EcoRI and XhoI, respectively, and the double digestion system is shown in Table 3. And (3) respectively placing the double enzyme digestion systems in water baths at 37 ℃ for 3 hours, respectively adding samples of the enzyme digestion systems into 0.8% agarose gel for detection after finishing, and carrying out gel cutting recovery and purification on enzyme digestion gene fragments with correct sizes and pET28a-SUMO carrier strips.

TABLE 3 enzyme digestion system

2) The digested gene fragment was enzymatically ligated with linearized pET28a-SUMO vector.

The purified digested fragment and linearized vector pET28a-SUMO were ligated by T4 DNA ligase, the ligation was performed for 12h at 16℃as shown in Table 4.

TABLE 4 enzyme-linked systems

3) Coli competent cells DH 5. Alpha. Were transformed.

Mixing 8 μl of the above enzyme-linked system with 80 μl of Escherichia coli competent cells DH5 α, adding into culture tube, standing on ice for 20min, heating at 42deg.C for 45s, standing on ice for 2min, adding 400 μl of liquid LB without resistance, and culturing at 37deg.C and 180rpm for 60min. 200. Mu.L of the cultured bacterial liquid was uniformly spread on a solid LB plate with resistance kan, and cultured at a constant temperature of 37℃overnight in an inverted manner.

4) Positive clone selection.

The single clones on the above plates were picked up and cultured overnight in LB liquid medium containing kan resistance at 37℃with shaking table 220rpm, and the bacterial cells of each strain were collected and plasmids were extracted. Double enzyme digestion verification is carried out by using restriction enzymes EcoRI and XhoI, a double enzyme digestion verification system is shown in table 5, a water bath kettle at 37 ℃ is used for incubation for 2 hours, plasmids with correct sequencing are selected for preservation, and the plasmids are recombinant expression vectors (pET 28 a-SUMO-Sahyal) inserted with the coding genes of the hyaluronan lyase.

Table 5 double cleavage verification System

Example 3

Obtaining expression thalli and expressing the hyaluronic acid lyase.

The plasmid pACYC Duet-1-Ulp (used for expressing the SUMO protease Ubiquitin-Like protein-specific Protease Ulp without His tag, capable of specifically recognizing and removing the SUMO tag, and the structure diagram of the pACYC Duet-1-Ulp plasmid is shown in FIG. 1, and is obtained by inserting a gene sequence for expressing Ulp into the pACYC Duet plasmid) and the recombinant plasmid pET28 a-SUMO-Sareal are simultaneously transformed into competent cells BL21 (DE 3) by a heat shock method, and 400 mu L of non-anti-LB liquid medium is added for culturing at 37 ℃ for 60min at 180 rpm. mu.L of the bacterial liquid was uniformly spread on a solid LB plate with double antibody (both kan and Cm resistance), and the culture was inverted at 37℃overnight. Single colonies were picked in 2mL of LB liquid medium (containing both kan and Cm resistances). After culturing overnight at 37℃at 200rpm, the culture was inoculated in 200mL of LB liquid medium (containing both kan and Cm resistances) at 1% by volume, and after culturing at 20℃at 200rpm until the bacterial liquid OD600 = 0.6, the culture was performed according to 1:1000 volume ratio IPTG at a concentration of 100mM was added to the culture broth to induce protein expression for 24h.

Example 4

Purification of hyaluronan lyase.

The IPTG-inducible protein expression system in example 3 was centrifuged at 6000rpm for 10min with a centrifuge, the cells were collected, washed with 10mL of Ni-NTA equilibration buffer, and vortexed with 8mL of Ni-NTA equilibration buffer until no clumps remained, to obtain a bacterial suspension. And (3) performing ultrasonic disruption on the bacterial suspension for 3s at intervals of 5s, wherein the total ultrasonic disruption time is 35min, and obtaining cell lysate. The cell lysate was centrifuged at 12000rpm at 4℃for 15min, and the supernatant was collected after centrifugation and placed on ice.

The supernatant (crude enzyme solution) was purified by nickel column affinity chromatography. Firstly, a nickel column is pretreated by using a Ni-NTA balance buffer solution with 5 times of column volume precooled, the nickel column is placed in a refrigerator with the temperature of 4 ℃, the supernatant placed on ice is added into the pretreated nickel column, 2mL of crude enzyme solution is added each time, and after incubation for 6min with the temperature of 4 ℃, the flow-through solution is released. 2mL of crude enzyme was added again for purification, and the above steps were repeated until all the supernatant had hung up the column. And then washing the hybrid protein by using a Ni-NTA washing buffer solution, adding 2mL each time, washing the hybrid protein to a total volume of 20mL, adding 5mL 250mM Ni-NTA and 5mL350mM Ni-NTA eluting buffer solution, eluting and collecting the target protein combined on a nickel column, concentrating the purified protein by using a 50kDa ultrafiltration column, replacing the eluting buffer solution in the protein by using 50mM Tris-HCL with a salt concentration of 50mM, and storing the final purified target protein in 1mL 50mM Tris-HCl buffer solution with a pH of 7.0 to obtain a purified enzyme solution. The purification effect was examined using 10% SDS-PAGE protein gel, and the results of the examination are shown in FIG. 2, and it can be seen that the target protein (hyaluronan lyase) was successfully expressed in a soluble manner, and cleavage of the SUMO tag was completed in vivo.

Example 5

The enzymatic properties of the hyaluronic acid lyase purified in example 4 were examined.

1) Determination of optimal enzymatic hydrolysis temperature

The reaction system: 200. Mu.L of 50mM Tris-HCl 7.0 buffer, 200. Mu.L of 0.5wt.% sodium hyaluronate (80-150 Da), 100. Mu.L of the purified enzyme solution obtained in example 4, were mixed and reacted at 20 ℃,25 ℃,30 ℃,35 ℃,40 ℃,45 ℃,50 ℃,55 ℃,60 ℃,65 ℃,70 ℃,75 ℃ and 80 ℃ for 15min, the reaction was terminated with 500. Mu.L of 20mM HCl and the enzyme activity was measured, the protein activity at the optimum temperature was defined as 100%, the protein activities at other temperatures were calculated as relative activities, and the catalytic activity was the highest when the reaction temperature was 50 ℃ as shown in FIG. 3.

2) Determination of optimal enzymatic pH

The reaction system: 0.5wt.% sodium hyaluronate (80-150 Da) 200. Mu.L, purified enzyme solution 100. Mu.L, wherein 200. Mu.L of buffer in the reaction system is buffer of different pH. The buffers utilized were: citric acid-Na ₂ HPO ₄ Buffer (pH 4.0-6.0), naH ₂ PO ₄ -Na ₂ HPO ₄ Buffers (pH 6.0-8.0), tris-HCl buffers (pH 8.0-9.0) and Gly-NaOH buffers (pH 9.0-10.0), all at 50mM. The reaction systems of different pH's were reacted at the optimum temperature for 15min, the reaction was terminated with 500. Mu.L of HCl of 20mM concentration and the enzyme activity was measured, the enzyme activity at the optimum pH was defined as 100%, the enzyme activities at other pH's were calculated as relative enzyme activities, and the catalytic activity was the highest when the pH was 7.0, as shown in FIG. 4.

3) Determination of temperature stability

The reaction system: 200 mu L of buffer solution with optimal pH value and 200 mu L of 0.5wt.% sodium hyaluronate (80-150 Da), and 100 mu L of purified enzyme solution, wherein the enzyme solution is firstly incubated for 60min under the conditions of 20 ℃,25 ℃,30 ℃,35 ℃,40 ℃,45 ℃,50 ℃,55 ℃,60 ℃,65 ℃,70 ℃,75 ℃ and 80 ℃ respectively, then the buffer solution is added into the reaction system and reacted for 15min under the optimal condition, the reaction is stopped by using 500 mu L of HCl with the concentration of 20mM and the enzyme activity is measured, the protease activity which is not subjected to temperature treatment is defined as 100%, the enzyme activity which is subjected to temperature treatment is calculated as relative activity, the relative activity still has more than 90% of activity after the enzyme incubation for 60min, and the activity still has more than 80% of activity after the incubation for 60min at 45-50 ℃, and the reaction system is shown in figure 5, so that the hyaluronic acid lyase shows good temperature stability.

4) Determination of pH stability

The reaction system: 200. Mu.L of optimal pH buffer, 200. Mu.L of 0.5wt.% sodium hyaluronate (80-150 Da), 100. Mu.L of purified enzyme, 2.5. Mu.L of CaCl with a final concentration of 1M ₂ . To determine the pH stability of the protein, the enzyme was mixed with the above buffers of different pH at 1:1 and then incubated for 1h at 37 ℃. The above-mentioned treated enzymes were added to the above-mentioned reaction systems, respectively, reacted under the optimum reaction conditions for 15 minutes, the reaction was terminated with 500. Mu.L of 20mM HCl and the enzyme activity was measured, and the activity of the protease not treated with pH was defined as 100%, and the activities of the other enzymes treated under different pH conditions were calculated as relative activities. It was determined that incubation for 60min at pH5.0-10.0 still maintained activity above 90% at pH4.0-5.0The activity of the hyaluronic acid lyase was still 60% or more after 60min incubation in the surrounding area, as shown in fig. 6, which shows that the hyaluronic acid lyase has good pH stability.

Example 6

The substrate profile of the resulting hyaluronan lyase was purified in example 4.

The reaction system: 0.2mL of sodium hyaluronate (5 mg/mL, molecular weight 80-150 ten thousand Da) and 0.1mL of purified enzyme solution were added to 0.2mM Tris-HCl buffer (pH 7.0). After incubation at 50℃for 15min, the reaction was terminated by adding 0.5mL of 20mM HCl, and the same mixture containing 0.1mL of heat-inactivated enzyme solution was used as a blank. The purified hyaluronan lyase was reacted with various substrates under the same reaction conditions and system under the optimum reaction conditions (50 ℃ C., pH 7.0) and then the enzyme activities were measured at 232nm wavelengths, respectively, and the results are shown in Table 6. The enzyme shows the highest activity on sodium hyaluronate, has lower protein activity on chondroitin sulfate A, chondroitin sulfate B and chondroitin sulfate C, and has no enzyme activity on heparin sodium, sodium alginate and carboxymethyl cellulose, so that the substrate of the hyaluronate lyase is specific, and the degradation activity on sodium hyaluronate reaches the highest (152.12 +/-5.17U/mg).

TABLE 6 substrate spectra of hyaluronan lyase

Note that: "/" indicates no enzymatic activity.

Example 7

Kinetic parameters of the purified hyaluronan lyase obtained in example 4 were determined.

The reaction system: 0.2mL of sodium hyaluronate (5 mg/mL,80-150 kDa) and 0.1mL of purified enzyme solution were added to 0.2mM Tris-HCl buffer (pH 7.0). After incubation at 50℃for 15min, the reaction was terminated by adding 0.5mL of 20mM HCl, and the same mixture containing 0.1mL of heat-inactivated enzyme solution was used as a blank. After incubating the purified hyaluronan lyase and sodium hyaluronate for various times in an optimal reaction environment, the amount of product produced was determined to determine transparencyWhen the reaction time of degrading sodium hyaluronate by the plasmin is 15min, the reaction speed is maximum. Kinetic parameters of hyaluronate lyase on sodium hyaluronate were calculated according to the Linesaver-Burk mapping method, as shown in Table 7. As a result of the analysis, it was found that the Michaelis constant Km for degrading sodium hyaluronate by hyaluronate lyase was 0.31mg/Ml, the maximum reaction rate Vmax was 135.14. Mu. Mol/min/mg, and the conversion kcat was 201.36s ^-1 The catalytic efficiency kcat/Km is 647.87mg/mL/s.

TABLE 7 kinetic parameters of hyaluronan lyase

Example 8

Analysis of the products of the hyaluronan lyase purified in example 4.

0.1mL of hyaluronan lyase (purified enzyme solution) and sodium hyaluronate (0.2 mL,5mg/mL,80-150 Da) were simultaneously added to the reaction system, hydrolysis was carried out in a shaker at 200rpm at 37℃and 500. Mu.L was taken out of the total reaction system at 0min, 1min, 2min, 10min, 30min and 60min, respectively, and the reaction was terminated by heat treatment at 100℃for 5 min. The products were analyzed by Thin Layer Chromatography (TLC) and the results are shown in FIG. 7, while the products at the different time points were analyzed by HPLC, and the results are shown in FIG. 8, and it was confirmed from the TLC and HPLC detection results that the final product of sodium hyaluronate was hydrolyzed by hyaluronate lyase, which is an exoenzyme, to yield unsaturated disaccharide products starting from the end of the substrate until sodium hyaluronate was completely degraded.

45g of sodium hyaluronate (80-150 Da) was added to 900mL of water, placed in a shaker at 37℃and 200rpm, 100mg of hyaluronate lyase (purified enzyme solution) was added, and the product of hyaluronate lyase hydrolysis of sodium hyaluronate was detected and analyzed by HPLC for 24 hours, as shown in FIG. 9, and the sodium hyaluronate was rapidly degraded at the initial stage of the reaction, and the conversion rate reached the maximum at 6 hours. The product was collected and purified when the conversion was maximized. The 3kDa ultrafiltration membrane is utilized to remove protein substances in the system, then the system is heated for 10 minutes to inactivate the protein substances, the product water is removed by spray drying, the yield of the finally obtained unsaturated hyaluronic acid disaccharide is 97.4 percent, the purity is more than or equal to 98.5 percent, the HPLC detection only has a single product peak, the peak-out time is consistent with the peak-out time of an unsaturated disaccharide standard, and as shown in figure 10, the hyaluronic acid lyase is proved to degrade only one hyaluronic acid disaccharide product as the final hyaluronic acid product.

Meanwhile, the analysis of sodium hyaluronate products degraded by using the LC-MS/MS shows that only one main peak exists in the product detection peaks, the mass-to-charge ratio m/z is 378.10, the size of the product is consistent with that of unsaturated hyaluronan disaccharide, and no product peaks such as unsaturated tetraose, unsaturated hexaose and the like appear through a mass spectrum diagram, so that the final product of sodium hyaluronate degradation by using the hyaluronan lyase only has a single product, namely unsaturated hyaluronan disaccharide.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, or alternatives falling within the spirit and principles of the invention.

Claims

1. A hyaluronan lyase, characterized in that: the amino acid sequence is shown as SEQ ID NO.1.

2. The hyaluronic acid lyase encoding gene according to claim 1, characterized in that: the nucleotide sequence is shown as SEQ ID NO.2.

3. A recombinant expression vector, characterized in that: the method comprising inserting the gene encoding the hyaluronan lyase according to claim 2 into an expression vector.

4. The recombinant expression vector of claim 3, wherein: the expression vector is plasmid pET28a-SUMO.

5. An expression cell, characterized in that: a recombinant expression vector according to claim 3 transformed in a host cell.

6. The expression cell according to claim 5, wherein: the host cell is Escherichia coli BL21 (DE 3).

7. Use of the hyaluronan lyase according to claim 1, the hyaluronan lyase encoding gene according to claim 2, the recombinant expression vector according to claim 3 or the expression cell according to claim 5 for the preparation of an unsaturated hyaluronan disaccharide.

8. A method for preparing an unsaturated hyaluronan disaccharide, characterized by: adding sodium hyaluronate and the hyaluronate lyase according to claim 1 into an aqueous phase system, and performing enzymolysis reaction at the temperature of 20-60 ℃ and the pH of 4-10 to obtain the unsaturated hyaluronate disaccharide.

9. The method for preparing unsaturated hyaluronan disaccharide according to claim 8, wherein: the water phase system is pure water or calcium chloride water solution.

10. The method for preparing unsaturated hyaluronan disaccharide according to claim 8, wherein: the temperature of the enzymolysis reaction is 40 ℃;

and/or the pH of the enzymatic hydrolysis reaction is 7.